ID: 1168469160

View in Genome Browser
Species Human (GRCh38)
Location 19:56626995-56627017
Sequence CAGACTGCAGTGCGTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168469160_1168469162 21 Left 1168469160 19:56626995-56627017 CCCATCACACGCACTGCAGTCTG No data
Right 1168469162 19:56627039-56627061 TTTACCATCCATCTCCATCACGG No data
1168469160_1168469166 30 Left 1168469160 19:56626995-56627017 CCCATCACACGCACTGCAGTCTG No data
Right 1168469166 19:56627048-56627070 CATCTCCATCACGGGCATTCAGG No data
1168469160_1168469163 22 Left 1168469160 19:56626995-56627017 CCCATCACACGCACTGCAGTCTG No data
Right 1168469163 19:56627040-56627062 TTACCATCCATCTCCATCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168469160 Original CRISPR CAGACTGCAGTGCGTGTGAT GGG (reversed) Intergenic
No off target data available for this crispr