ID: 1168469161

View in Genome Browser
Species Human (GRCh38)
Location 19:56626996-56627018
Sequence ACAGACTGCAGTGCGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168469161_1168469162 20 Left 1168469161 19:56626996-56627018 CCATCACACGCACTGCAGTCTGT No data
Right 1168469162 19:56627039-56627061 TTTACCATCCATCTCCATCACGG No data
1168469161_1168469166 29 Left 1168469161 19:56626996-56627018 CCATCACACGCACTGCAGTCTGT No data
Right 1168469166 19:56627048-56627070 CATCTCCATCACGGGCATTCAGG No data
1168469161_1168469163 21 Left 1168469161 19:56626996-56627018 CCATCACACGCACTGCAGTCTGT No data
Right 1168469163 19:56627040-56627062 TTACCATCCATCTCCATCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168469161 Original CRISPR ACAGACTGCAGTGCGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr