ID: 1168469163

View in Genome Browser
Species Human (GRCh38)
Location 19:56627040-56627062
Sequence TTACCATCCATCTCCATCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168469160_1168469163 22 Left 1168469160 19:56626995-56627017 CCCATCACACGCACTGCAGTCTG No data
Right 1168469163 19:56627040-56627062 TTACCATCCATCTCCATCACGGG No data
1168469159_1168469163 23 Left 1168469159 19:56626994-56627016 CCCCATCACACGCACTGCAGTCT No data
Right 1168469163 19:56627040-56627062 TTACCATCCATCTCCATCACGGG No data
1168469161_1168469163 21 Left 1168469161 19:56626996-56627018 CCATCACACGCACTGCAGTCTGT No data
Right 1168469163 19:56627040-56627062 TTACCATCCATCTCCATCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168469163 Original CRISPR TTACCATCCATCTCCATCAC GGG Intergenic
No off target data available for this crispr