ID: 1168469166

View in Genome Browser
Species Human (GRCh38)
Location 19:56627048-56627070
Sequence CATCTCCATCACGGGCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168469161_1168469166 29 Left 1168469161 19:56626996-56627018 CCATCACACGCACTGCAGTCTGT No data
Right 1168469166 19:56627048-56627070 CATCTCCATCACGGGCATTCAGG No data
1168469160_1168469166 30 Left 1168469160 19:56626995-56627017 CCCATCACACGCACTGCAGTCTG No data
Right 1168469166 19:56627048-56627070 CATCTCCATCACGGGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168469166 Original CRISPR CATCTCCATCACGGGCATTC AGG Intergenic
No off target data available for this crispr