ID: 1168469455

View in Genome Browser
Species Human (GRCh38)
Location 19:56628842-56628864
Sequence CCTGGCTTGCAGCCTGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168469450_1168469455 2 Left 1168469450 19:56628817-56628839 CCCTGGGGAAGAAGGAGATTTGA No data
Right 1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG No data
1168469451_1168469455 1 Left 1168469451 19:56628818-56628840 CCTGGGGAAGAAGGAGATTTGAC No data
Right 1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG No data
1168469449_1168469455 3 Left 1168469449 19:56628816-56628838 CCCCTGGGGAAGAAGGAGATTTG No data
Right 1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG No data
1168469443_1168469455 30 Left 1168469443 19:56628789-56628811 CCTGGACTGGACAGGCCACACAA No data
Right 1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG No data
1168469447_1168469455 15 Left 1168469447 19:56628804-56628826 CCACACAAAATACCCCTGGGGAA No data
Right 1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168469455 Original CRISPR CCTGGCTTGCAGCCTGTGTA GGG Intergenic
No off target data available for this crispr