ID: 1168471423

View in Genome Browser
Species Human (GRCh38)
Location 19:56643482-56643504
Sequence TTCCAGCCTCCTCGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 563}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168471413_1168471423 20 Left 1168471413 19:56643439-56643461 CCGCAGCGGAGGTCTGTGTCCTG 0: 1
1: 0
2: 0
3: 11
4: 203
Right 1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG 0: 1
1: 0
2: 1
3: 59
4: 563
1168471420_1168471423 1 Left 1168471420 19:56643458-56643480 CCTGGCTTGGGGGTTGCAGGTGA 0: 1
1: 0
2: 2
3: 27
4: 261
Right 1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG 0: 1
1: 0
2: 1
3: 59
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168471423 Original CRISPR TTCCAGCCTCCTCGTGAGGA GGG Intronic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
900804486 1:4758471-4758493 TTCCTGCCACCTTGTGAAGAAGG - Intronic
901643543 1:10704983-10705005 TGCCAGCCTCTTAGGGAGGATGG + Intronic
902123987 1:14193121-14193143 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
902137524 1:14322978-14323000 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
903246466 1:22019425-22019447 TCCCAGCCTCCCTCTGAGGATGG - Intergenic
903990542 1:27265208-27265230 TTCCAGCTTCTTTGTGAGGCTGG + Intronic
905860103 1:41344692-41344714 TTCCACCTTCCTCCTGAGGTTGG + Intergenic
905939703 1:41853406-41853428 TTCCTGCCACCTTGTGAAGAGGG - Intronic
907643555 1:56217451-56217473 TTACAGCCTCCCAGTGATGAAGG + Intergenic
909351655 1:74660171-74660193 TTCCTGCCACCATGTGAGGAAGG + Intronic
909433381 1:75615284-75615306 CTCCAATCTCCTCCTGAGGATGG + Intergenic
909849163 1:80438384-80438406 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
910042924 1:82875043-82875065 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
910150466 1:84137023-84137045 TTCCTGCCACCTTGTGAAGAAGG + Intronic
911417186 1:97589454-97589476 TTCCTGCCACCTTGTGAAGAAGG + Intronic
911951796 1:104182505-104182527 TTCCTGCCACCACGTGAAGAAGG + Intergenic
912083901 1:105975940-105975962 TTCCTGCCTCCATGTGAAGAAGG + Intergenic
912154747 1:106904033-106904055 TTCCTGCCGCCTGGTGAAGAAGG - Intergenic
912754352 1:112312221-112312243 CTCTAGCCTCCTCGTGGGCAGGG + Intergenic
914417957 1:147501998-147502020 TTCCTGCCGCCTGGTGAAGAAGG - Intergenic
914445516 1:147747405-147747427 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
914769670 1:150672833-150672855 TTTCAGCCTGATCGTGAGGAAGG + Intronic
915666573 1:157450520-157450542 ATCCTGCCTCCTTGTGAAGAAGG + Intergenic
916987398 1:170206587-170206609 TTCCTGCCTTCTTGTGAAGAAGG + Intergenic
917148935 1:171924519-171924541 TTCCTGCCACCTTGTGAAGAAGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
917894371 1:179473798-179473820 TTCCTGCCACCTTGTGAAGAAGG + Intronic
918352436 1:183671048-183671070 TTCCAGCCACCTTGTGAAGAAGG - Intronic
919227801 1:194730260-194730282 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
919480879 1:198087568-198087590 TTCCAGCCACCTTATGAAGAAGG - Intergenic
919485720 1:198144984-198145006 TTCCTGCCTCCATGTGAAGAAGG - Intergenic
920846662 1:209599071-209599093 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
921318844 1:213917823-213917845 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
921453807 1:215342397-215342419 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
921865102 1:220080553-220080575 TTCCTGCCACCTTGTGAAGAAGG - Intronic
922069985 1:222182687-222182709 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
922157759 1:223053376-223053398 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
922211021 1:223486962-223486984 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
923480610 1:234379731-234379753 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
924062888 1:240194643-240194665 TTTCAGCCTTCACCTGAGGATGG - Intronic
924116384 1:240752030-240752052 CTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1062917059 10:1248523-1248545 CTGCAGCCTCCTCCTGAGAATGG - Intronic
1063441879 10:6079392-6079414 TTCCTTCCTCCTGGTGGGGAGGG - Intergenic
1064220485 10:13436533-13436555 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
1065502303 10:26394312-26394334 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1065853408 10:29810432-29810454 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1066008532 10:31170813-31170835 TTCCTGCCACCATGTGAGGAAGG - Intergenic
1067573051 10:47385609-47385631 TTCCAGCCACCCTGTGAAGAAGG - Intergenic
1068458060 10:57285921-57285943 TTCCAACCTCCTTGTGGGGCAGG - Intergenic
1069287395 10:66732548-66732570 TTCCTGCCACCACGTGAAGAAGG - Intronic
1069340023 10:67398848-67398870 TTCCTGTCTCCACGTGAAGAAGG + Intronic
1069397395 10:68004732-68004754 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1069994128 10:72332319-72332341 TTTCAACCTCCTGGAGAGGAGGG + Intergenic
1070600592 10:77863907-77863929 TTCCAGCTTCCTCGTAAGGCAGG - Intronic
1070644972 10:78195443-78195465 TTCCTGCCTCCCTGAGAGGAAGG - Intergenic
1071230397 10:83579536-83579558 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1071306723 10:84305702-84305724 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1071878983 10:89874173-89874195 CTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1071951435 10:90707386-90707408 CTCCTGCCTTCTTGTGAGGAAGG + Intergenic
1071989123 10:91082693-91082715 TTCCTGCCTCCATGTGAAGAAGG + Intergenic
1073591702 10:104763895-104763917 CTCCTGCCACCTCGTGAGGAAGG + Intronic
1073628132 10:105120201-105120223 TTCCAGCCGCCCTGTGAAGAAGG + Intronic
1073906567 10:108287509-108287531 TTCCAGCTTCTCCATGAGGAGGG - Intergenic
1074822871 10:117194576-117194598 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1075059177 10:119242780-119242802 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1075736343 10:124666779-124666801 CTCCACCCTCCTCGTGGGGCTGG - Intronic
1075930877 10:126294333-126294355 TTCCAGCCTCATCCTCAGCAAGG - Intronic
1075938489 10:126365592-126365614 TTCCTGCCTCCCTGTGAAGAAGG - Intronic
1076123582 10:127955849-127955871 TTCCTGCCACCACGTGAAGAAGG - Intronic
1076856616 10:133118547-133118569 CTCCTGCCTCCTTGTGAAGAAGG - Intronic
1078187557 11:9065384-9065406 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1079147903 11:17870117-17870139 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1079802578 11:24888874-24888896 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
1080445948 11:32337356-32337378 TTCCAGCCTACTGGGGAAGACGG - Intergenic
1080568912 11:33538103-33538125 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1081160718 11:39744499-39744521 CTCCTGCCACCTTGTGAGGAAGG + Intergenic
1081271580 11:41090809-41090831 TTCCAGTCACCACGTGAAGAAGG + Intronic
1081271900 11:41095175-41095197 CTCCAGCCTCCATGTGAGGAAGG - Intronic
1081628889 11:44673942-44673964 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1081764968 11:45604180-45604202 TTCCACCCTTATCCTGAGGAAGG - Intergenic
1082132515 11:48507075-48507097 TTCCTGCCACCCTGTGAGGATGG + Intergenic
1082244323 11:49904428-49904450 TTCCTGCCACCCTGTGAGGATGG - Intergenic
1082565945 11:54677624-54677646 TTCCTGCCGCCCTGTGAGGATGG + Intergenic
1082790692 11:57344969-57344991 GTCCAGCCTCCACCTGAGGAAGG + Intronic
1082827366 11:57590006-57590028 TTCCTGCCACCTTGTGAAGAGGG - Intergenic
1083135943 11:60677282-60677304 CTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1083630185 11:64091263-64091285 TCCCAGCCTCCTTCTGAGGCAGG - Intronic
1083895036 11:65615814-65615836 TTCCGGCCTCCTCCTTAGGCCGG + Exonic
1083921310 11:65782441-65782463 TTCCTGCCTCACCGTGAGGGTGG - Intergenic
1083931728 11:65850018-65850040 CGCCGGCCTCATCGTGAGGAGGG + Exonic
1084010544 11:66346129-66346151 TTTCAGCCTCCTTTTGGGGATGG + Exonic
1086185082 11:84003544-84003566 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1087208553 11:95421941-95421963 TTACAGTATCCTAGTGAGGAAGG + Intergenic
1087427621 11:98011505-98011527 TTCCTGCCCCCTTGTGAAGAAGG - Intergenic
1087582690 11:100079000-100079022 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1088712366 11:112519951-112519973 TTCCTGCCACCTGGTGAAGAAGG + Intergenic
1089582101 11:119487888-119487910 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1089957328 11:122583881-122583903 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1091368290 11:135039537-135039559 TGCCAGCCTCTTCCTCAGGAAGG + Intergenic
1091589899 12:1836813-1836835 GTCCAGCCTCCTGGGGAGGTGGG - Intronic
1091843026 12:3633928-3633950 TTCCAGCATCCGCAGGAGGAAGG + Intronic
1092139500 12:6173108-6173130 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1092260861 12:6952648-6952670 TCCCAGCCGCCCCGTGGGGATGG + Intronic
1092796942 12:12121120-12121142 GTACAGACTCCTCCTGAGGAGGG - Exonic
1092917473 12:13201875-13201897 CTCCACCCTCTTCTTGAGGAGGG + Intronic
1093371251 12:18367965-18367987 TTCCTGCCACCTGGTGAAGAAGG - Intronic
1093533018 12:20189329-20189351 TTGCAGCCTGCTCCTGAGAAAGG + Intergenic
1094282744 12:28758082-28758104 CTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1094361136 12:29632517-29632539 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1094724149 12:33095347-33095369 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1096802524 12:54120601-54120623 TTCCAGCCCCGTCCTCAGGAGGG + Intergenic
1097469176 12:59967389-59967411 TTCCTGCCGCCTCGTGAAGAAGG - Intergenic
1097564180 12:61247934-61247956 TTTCAGCCTCCAGATGAGGAGGG + Intergenic
1097924765 12:65115111-65115133 TTCCAACCTCCTTGTGACCAAGG - Intronic
1098192786 12:67967978-67968000 TTCCAGCTGCTTTGTGAGGAAGG - Intergenic
1098485920 12:71021905-71021927 TTCCTGCTGCCTCGTGACGAAGG - Intergenic
1099397524 12:82159215-82159237 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1100290015 12:93204759-93204781 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1101516503 12:105440392-105440414 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1101560275 12:105850715-105850737 TTCCTGCCACCCTGTGAGGAAGG + Intergenic
1102476074 12:113189460-113189482 TTCCACCCTCCAGGTGAGCAAGG - Intronic
1103183332 12:118934475-118934497 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1103269145 12:119657678-119657700 CTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1103888601 12:124221591-124221613 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1103970720 12:124669491-124669513 CTTCTGCCGCCTCGTGAGGAAGG - Intergenic
1104487587 12:129164648-129164670 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
1105465164 13:20633304-20633326 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1105846951 13:24301634-24301656 TTCCTGCCACCTCGGGAGGTAGG + Intronic
1106046646 13:26148115-26148137 TTCCTGCCCCCTTGTGAAGAAGG - Intronic
1106714655 13:32375028-32375050 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1106936511 13:34728310-34728332 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1107298214 13:38937087-38937109 TTCCAGCCTGCTCTTGGGAATGG - Intergenic
1109122736 13:58478461-58478483 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1109718489 13:66247046-66247068 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1109977315 13:69855643-69855665 TTCCTGCCGCCTCGTAAAGAAGG + Intronic
1110088021 13:71406854-71406876 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1110166259 13:72447233-72447255 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1111010143 13:82301849-82301871 TTCCAGCTGCCTTGTGAAGAAGG - Intergenic
1111918246 13:94383869-94383891 CTCCTGCCACCTTGTGAGGAAGG - Intronic
1112146813 13:96709173-96709195 CTCCTGCCTCCTTGTGAAGAAGG + Intronic
1112265453 13:97919534-97919556 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
1112494232 13:99893171-99893193 TTCCGGCCTCTGAGTGAGGATGG - Exonic
1113167131 13:107454392-107454414 TTCTAGCCACCTAGTGAAGAAGG - Intronic
1113211870 13:107993015-107993037 TCCCTGCCACCTTGTGAGGAAGG - Intergenic
1114492245 14:23110440-23110462 TTTCAGCCACCTCATGAGGTAGG + Intergenic
1114850716 14:26379509-26379531 TTCCAACCTCCTCTTGAAGTGGG + Intergenic
1115934945 14:38542057-38542079 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
1116478131 14:45365337-45365359 TTCCAACCTCCAAGGGAGGATGG - Intergenic
1116714026 14:48406101-48406123 TTCCTGCCACCATGTGAGGAAGG - Intergenic
1116967090 14:51026058-51026080 TTCCAGCCTCCTCGTCCGCTGGG + Intronic
1118046349 14:61975523-61975545 TTCCAGCTGCCTTGTGAAGAAGG - Intergenic
1118073775 14:62276242-62276264 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
1119158086 14:72429943-72429965 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1120558161 14:85956176-85956198 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1120593685 14:86407284-86407306 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1120887763 14:89465080-89465102 TTGCAGCCGCCACGTGAAGAAGG + Intronic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1122409164 14:101517327-101517349 TCTCAGCCTCCTCGTTAGAATGG + Intergenic
1123574995 15:21656969-21656991 TTCCAGGCTCCTCCTGCAGAGGG - Intergenic
1123611611 15:22099458-22099480 TTCCAGGCTCCTCCTGCAGAGGG - Intergenic
1123696705 15:22883925-22883947 TTCCTGCCTTCTTGTGAAGAAGG - Intronic
1123697067 15:22886070-22886092 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1123876298 15:24627184-24627206 TTCCTGCCACCATGTGAGGAAGG + Intergenic
1124226753 15:27901590-27901612 TTCCACCCTCCTTGCGAGGTAGG - Intronic
1125225499 15:37390717-37390739 TTCCTGCCACCACGTGAAGAAGG - Intergenic
1125299472 15:38239278-38239300 TTCCGGCCACCTTGTGAAGAAGG - Intergenic
1125735196 15:41919813-41919835 TTCCTCCCTCCTCCTGTGGAAGG - Intronic
1126232078 15:46338945-46338967 TTCCTGCCACCTCGTGAAGAAGG + Intergenic
1127519579 15:59730040-59730062 CTCCAGCCACCTTGTGAAGAAGG - Intergenic
1127907082 15:63383896-63383918 TCCCAGCTTCCTAGTGAGGATGG - Intergenic
1128479325 15:68023704-68023726 TTTCAGCCTCCAAATGAGGAGGG + Intergenic
1129335330 15:74848776-74848798 CTCCTGGCTCCTAGTGAGGAGGG - Intronic
1129583908 15:76842457-76842479 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1129759577 15:78121652-78121674 TTCCTGCCGCCATGTGAGGAAGG + Intronic
1129823079 15:78617734-78617756 TTCCAACCTCCTGGGGATGAAGG + Intronic
1130189642 15:81721414-81721436 CTCCTGCCACCTTGTGAGGAAGG + Intergenic
1131036085 15:89222845-89222867 TTGCAGCCTGCTCTGGAGGAAGG - Intergenic
1131646904 15:94354492-94354514 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1131848974 15:96517509-96517531 TTCCAGCCGCCTTGTGAAGAAGG - Intergenic
1202983863 15_KI270727v1_random:391213-391235 TTCCAGGCTCCTCCTGCAGAGGG - Intergenic
1132590864 16:725931-725953 CCCCAGCGTGCTCGTGAGGAGGG - Intronic
1133921522 16:10157582-10157604 TTCCTGTCTCCCCGTGAAGAAGG - Intronic
1134450190 16:14358605-14358627 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1134755490 16:16663673-16663695 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1134990575 16:18695494-18695516 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1135140929 16:19921476-19921498 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1135387816 16:22059610-22059632 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1135831932 16:25782090-25782112 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
1137441450 16:48501932-48501954 TACCATCCTCATCATGAGGAAGG + Intergenic
1137888800 16:52136223-52136245 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1138210784 16:55161648-55161670 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1138621925 16:58218369-58218391 CTCCAGTCTCCTGCTGAGGAAGG - Intergenic
1138799966 16:60015712-60015734 CTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1139632249 16:68237697-68237719 TTCCAGGCTTATCGGGAGGAGGG - Intronic
1139685905 16:68603533-68603555 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1139914962 16:70422308-70422330 TTTCAGCCTCATAGAGAGGAAGG + Intronic
1140270345 16:73459761-73459783 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1141306259 16:82866760-82866782 TTCCTGCCTCCTTGTGAAGAAGG - Intronic
1141593736 16:85085255-85085277 TCCCAGCCTCCTCGTGCCGATGG - Intronic
1142269378 16:89081258-89081280 ATCCAGCCTCCTAGAGACGAGGG + Intergenic
1142516203 17:431117-431139 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
1143973004 17:10809285-10809307 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1144395591 17:14839638-14839660 TTCCTGCCACCACGTGAAGAAGG + Intergenic
1144524910 17:15981030-15981052 TGACAGCATCCTGGTGAGGATGG - Exonic
1144820358 17:18068912-18068934 TTCAAGCCTCCTAGGGAGGTGGG - Intergenic
1145831079 17:27916871-27916893 CTCCTGCCACCTTGTGAGGAAGG - Intergenic
1145866272 17:28243867-28243889 TTCCTGCCACCTTGTGAGGAGGG + Intergenic
1147925813 17:43944982-43945004 TTCCTGCCGCCTTGTGAGAAAGG - Intergenic
1149536423 17:57437082-57437104 TTCCATCTTCCTGATGAGGAGGG + Intronic
1150452682 17:65282014-65282036 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1150601871 17:66658116-66658138 TTCCTGCCGCCACGTGAAGAAGG - Intronic
1152373900 17:79908003-79908025 CTCCAGCCTCCTGCTGAGTAAGG + Intergenic
1152667318 17:81578608-81578630 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1152899303 17:82930853-82930875 TTCTAGCCTCCACATGAGGCAGG + Intronic
1153346772 18:4034576-4034598 TTCCAACTTCCTACTGAGGAAGG - Intronic
1153518789 18:5932178-5932200 TCACAGCCACCTAGTGAGGAGGG + Intergenic
1153706213 18:7748372-7748394 TGCCAAGCTCCTTGTGAGGAGGG + Intronic
1154125778 18:11690304-11690326 TGCCAGCCTCCTCGTGTAGCAGG - Intronic
1154503118 18:15006169-15006191 TTCCAGCTTCCTGGAGATGATGG - Intergenic
1155354382 18:24937285-24937307 TTCCAGCCTCCTTCTGAGTCAGG - Intergenic
1155919462 18:31588707-31588729 TTCCTGACGCCTTGTGAGGAAGG - Intergenic
1156721027 18:40070368-40070390 TTCCTGCCACCGCGTGAAGAAGG + Intergenic
1157389038 18:47285707-47285729 TTCCTGCTGCCTTGTGAGGAAGG + Intergenic
1157531789 18:48427429-48427451 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1157691195 18:49683190-49683212 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
1158102676 18:53847941-53847963 TTCCTGCCTCCATGTGAAGAAGG - Intergenic
1158262226 18:55620101-55620123 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1158984888 18:62804134-62804156 TTCCTGCCCCCTGGTGAAGAAGG - Intronic
1158986280 18:62820619-62820641 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1159476262 18:68924397-68924419 TTCCTGCCACCTTGTGAAGACGG + Intronic
1159780959 18:72659902-72659924 TTCCTGCTGCCTTGTGAGGAAGG - Intergenic
1159909256 18:74128737-74128759 TGCCAGCCTCATAGTGAGTATGG + Intronic
1162544610 19:11321293-11321315 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1162743539 19:12786610-12786632 TCCCACCCTCCTCGTGGGGCCGG + Intronic
1163321713 19:16578445-16578467 TTCCAGCCTCCCAGTGGAGAAGG - Intronic
1163510613 19:17733078-17733100 TTCAGGCCTCCTGCTGAGGAGGG + Intronic
1163550165 19:17962119-17962141 TTCTAGCCTGAGCGTGAGGAGGG + Intronic
1163695403 19:18761103-18761125 CTGCAGCCTCCTGGAGAGGAAGG - Intronic
1163834254 19:19563525-19563547 CTCCAGCCTCCTCCTGGGGGAGG - Exonic
1164302723 19:23976044-23976066 CTCCTGCCACCTCGTGAAGAAGG + Intergenic
1164464216 19:28473751-28473773 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1164540872 19:29120686-29120708 TTCCAGACTCCTCGAGGTGAAGG - Intergenic
1165081391 19:33308831-33308853 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1165711324 19:38012841-38012863 GTCCAGCCTCCTTGTGAGGCTGG - Intronic
1166166529 19:40993443-40993465 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1167199514 19:48054669-48054691 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1167517623 19:49932551-49932573 TTCCAGCTCCTTCTTGAGGAGGG - Exonic
1168459341 19:56540214-56540236 TTCCAGCCTCCTGTAGCGGAAGG + Intronic
1168471423 19:56643482-56643504 TTCCAGCCTCCTCGTGAGGAGGG + Intronic
1168706485 19:58473189-58473211 GTCCAGCCTCCAATTGAGGAGGG - Exonic
925047847 2:788208-788230 CTCCTGCCACCTTGTGAGGAAGG - Intergenic
925178268 2:1799925-1799947 TTCCTGCCACCTTGTGAAGAAGG + Intronic
925205543 2:2002883-2002905 TTCCTGCCACCTTGTGAAGAAGG + Intronic
925216747 2:2103068-2103090 TCTCAACCTCCTCTTGAGGATGG - Intronic
925653463 2:6117810-6117832 TTCCTGCCACCTAGTGAGGAAGG - Intergenic
925765400 2:7229557-7229579 TTCCTACCACCTTGTGAGGAAGG + Intergenic
925801698 2:7608303-7608325 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
925932065 2:8716099-8716121 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
926053869 2:9762358-9762380 TTCCAGACTTCTGGTGTGGAGGG - Intergenic
926449722 2:12987625-12987647 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
926645226 2:15283506-15283528 TTCCTGCCTCCCTGTGAAGAAGG + Intronic
927623473 2:24687613-24687635 CTCCTGCCTCCTTGTGAAGAAGG - Intronic
927827030 2:26316265-26316287 TTGCTGCCACCTGGTGAGGAAGG - Exonic
928757735 2:34546439-34546461 TTCCTGCCTCCTTGTGAAAAAGG + Intergenic
928800128 2:35079238-35079260 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
930607628 2:53508963-53508985 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
930959962 2:57250018-57250040 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
931519357 2:63078478-63078500 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
932325707 2:70860097-70860119 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
933031808 2:77337608-77337630 TTCCTGCCACCTTGTGAAGAAGG + Intronic
933497411 2:83067051-83067073 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
933852056 2:86376068-86376090 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
934103323 2:88673754-88673776 CTCCTGCCACCTTGTGAGGAAGG + Intergenic
934612459 2:95751395-95751417 CTGCAGCCTCCTCTTGGGGAAGG + Intergenic
934841693 2:97628049-97628071 CTGCAGCCTCCTCTTGGGGAAGG - Intergenic
935387003 2:102510387-102510409 TTCCAGCCTGCTCTTCTGGATGG - Intronic
935590339 2:104842371-104842393 ATCCAGCCTGCTCGTTAGGCTGG - Intergenic
935898891 2:107769283-107769305 ATCCAGCATCCTCATGAGGAAGG + Intergenic
936909566 2:117576178-117576200 TTCCTGCCACCACGTGAAGAAGG - Intergenic
937320753 2:120959303-120959325 TTCCAGAGTCCACCTGAGGAGGG + Intronic
937935111 2:127237751-127237773 TTTCTGCCTCCTTGTGAAGAAGG + Intergenic
937991794 2:127666776-127666798 TTCCTGCCACCTTGTGAAGAAGG - Intronic
938226986 2:129624843-129624865 TTCCCGCCTCTTGGGGAGGAAGG + Intergenic
939149913 2:138461023-138461045 TTCCTGCCACCTTGTGATGAAGG - Intergenic
939703139 2:145419553-145419575 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
940543430 2:155051619-155051641 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
940755677 2:157679234-157679256 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
942885496 2:180918769-180918791 TTCCTGCCGCCTCGTGAAGAAGG - Intergenic
943107210 2:183560461-183560483 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
943272174 2:185820265-185820287 TTCCTGCCACCTGGTGAAGAAGG + Intronic
943542760 2:189238679-189238701 TTCCTGCCACCTGGTGAAGAAGG - Intergenic
943823019 2:192351743-192351765 TTCCTGCCACCTTGTGAAGACGG - Intergenic
944078034 2:195754336-195754358 TACAAGCATCCTCCTGAGGATGG - Exonic
944975784 2:205049311-205049333 CTCCTGCCTCCTTGTGAAGAAGG - Intronic
945358011 2:208861325-208861347 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
945818102 2:214630422-214630444 TTCCGGCCACCTTGTGAAGAAGG - Intergenic
946023129 2:216655441-216655463 TTCCTGCCACCTTGTGAAGAAGG + Intronic
946461060 2:219869400-219869422 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
946544098 2:220717349-220717371 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
947032367 2:225811524-225811546 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
947230680 2:227882830-227882852 TTCCTGCCACCTTGTGAAGAAGG + Intronic
947364079 2:229376018-229376040 TTCCTGCCACCTTGTGAAGAAGG + Intronic
947619321 2:231578548-231578570 TTCCAGCATCTTCATGAGGCAGG - Intergenic
948397593 2:237658658-237658680 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
948767837 2:240232772-240232794 TCCCAGCCTCCTAGGAAGGACGG + Intergenic
948879076 2:240846838-240846860 TTCCTGCCTCCATGTGAAGAAGG + Intergenic
1169415592 20:5413393-5413415 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1169498143 20:6134137-6134159 TTCCTGCTGCCTCGTGAGAAAGG + Intergenic
1169578386 20:6991492-6991514 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1169619649 20:7491242-7491264 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1171750029 20:29039715-29039737 TTCCTGCCACCTCATGAAGAAGG - Intergenic
1172223039 20:33286672-33286694 TTCCAACCACCCAGTGAGGAAGG - Intronic
1172293670 20:33793114-33793136 TTCCCGCCTCCTCATGAGCCCGG - Intergenic
1173131900 20:40401755-40401777 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1173678189 20:44856439-44856461 TTCCAGCCTCCTCGTCAGCTTGG + Intergenic
1174651243 20:52127521-52127543 TTCCTGCCTCTTTGTGAAGAAGG + Intronic
1175013017 20:55759180-55759202 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1175543542 20:59763217-59763239 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1175745465 20:61453940-61453962 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1175861583 20:62153111-62153133 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
1175990754 20:62787489-62787511 TTCCTGCCACCGCGTGAAGAAGG + Intergenic
1176088647 20:63309317-63309339 TTCACACCTGCTCGTGAGGAGGG - Exonic
1176315190 21:5236201-5236223 TTCCTGCCACCTCATGAAGAAGG + Intergenic
1177151450 21:17459234-17459256 CTCCTGCCACCTCATGAGGAAGG - Intergenic
1177291386 21:19118250-19118272 CTCCTGCCACCTTGTGAGGAAGG - Intergenic
1177872605 21:26591509-26591531 ATCCAGGGTCCTGGTGAGGATGG - Intergenic
1178041416 21:28644210-28644232 TTCCTGCCACCTTGTGACGAAGG - Intergenic
1178468399 21:32869901-32869923 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1179186878 21:39091562-39091584 TCCCAGCCCCGTCGTGGGGAAGG + Intergenic
1179349157 21:40591146-40591168 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1179392846 21:41009687-41009709 TTCCAGACTCGGTGTGAGGAAGG - Intergenic
1180992140 22:19942960-19942982 TTCCAGCCAACACCTGAGGATGG - Intronic
1183004383 22:34889007-34889029 TTCCTGTCACCTTGTGAGGAAGG + Intergenic
1183151092 22:36038056-36038078 TTCCAGCCTCCCCGGGAGTCAGG + Intergenic
1183847538 22:40554506-40554528 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1184410720 22:44324726-44324748 TTCCAGGCTGCTCTTGGGGAAGG + Intergenic
1185008110 22:48297444-48297466 TTCCTGCCGCCTAGTGAAGAAGG + Intergenic
1185101092 22:48841223-48841245 TTCCTGCATCCTTGTGAAGAAGG - Intronic
1185103344 22:48853463-48853485 TTCCTGCATCCTTGTGAAGAAGG + Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
1185302095 22:50087184-50087206 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1185329418 22:50245506-50245528 TTCAAGCCACCAGGTGAGGATGG + Exonic
1185346620 22:50313377-50313399 TTCCCTCCTCCGGGTGAGGAAGG + Intronic
949156123 3:829468-829490 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
949156351 3:831299-831321 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
949228781 3:1726063-1726085 CTCCTGCCTCCTCGTGAAGAAGG - Intergenic
949733427 3:7142432-7142454 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
950401870 3:12775285-12775307 TTCCAGCATCCTGCTGAGGTGGG + Intergenic
950554509 3:13687139-13687161 TTCCTTCCTCCTTGTGTGGAGGG + Intergenic
951153781 3:19324339-19324361 TTCCTGCTTCCTTGTGAAGAAGG - Intronic
951395462 3:22160064-22160086 TTCCTGCCACCTTGTGAAGAAGG + Intronic
952102210 3:30027473-30027495 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
953228507 3:41043048-41043070 CTCCAGCCTCCTGGTGGGCAGGG + Intergenic
953456417 3:43045881-43045903 TTCCTGCCACCTTGTGAAGAAGG + Intronic
953591516 3:44260080-44260102 TTCCTGCCACCTTGTGAAGAAGG + Intronic
955208389 3:56918099-56918121 TTCCAGCCTCCTACACAGGAAGG + Intronic
955570480 3:60299748-60299770 CTCCAGCCTCCTTGTCAGGTTGG - Intronic
956534399 3:70259893-70259915 TTCCTGCTTCCTTGTGAAGAAGG - Intergenic
957142919 3:76384680-76384702 TTCCTGCCACCATGTGAGGAAGG - Intronic
957544868 3:81624146-81624168 TTCCTGCCACCTTGTGAAGAAGG - Intronic
958671392 3:97210301-97210323 TTCCTGCCACCTTGTGAAGAAGG - Intronic
959092417 3:101917971-101917993 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
959140946 3:102486369-102486391 CTCCAGCCTCCTCGTGAAGAAGG + Intergenic
959229576 3:103631301-103631323 TTCCTGCCACCACGTGAAGAAGG + Intergenic
959405161 3:105952730-105952752 TTCCTGCCTCCATGTGACGAAGG - Intergenic
960481063 3:118190594-118190616 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
961936774 3:130592947-130592969 ATACAGCCTCCTTGTGAGGCTGG - Intronic
962421716 3:135234710-135234732 TTCCTGCCACCACGTGAAGAAGG - Intronic
962778829 3:138691590-138691612 TTCCTGCCACCTTGTGAAGATGG + Intronic
962826529 3:139104704-139104726 TTCCAGCCACAGAGTGAGGAGGG - Intronic
963675067 3:148300347-148300369 TTCCTGCCACCTTGTGACGAAGG - Intergenic
964903208 3:161686145-161686167 TTCCTGCCGCCTTGTGAGGAAGG + Intergenic
966414626 3:179676125-179676147 TTCCAGCCGCCCTGTGAAGAAGG + Intronic
967485317 3:190023464-190023486 TTCCTGCCGCCTCGTAAAGAAGG - Intronic
967634043 3:191779394-191779416 TTCCAGCTGCCTTGTGAAGAAGG + Intergenic
970143971 4:13013711-13013733 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
970172187 4:13301209-13301231 TTCCTGCCTCCATGTGAAGAAGG - Intergenic
970403973 4:15744369-15744391 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
970659067 4:18264234-18264256 CTCCAGCCACCTTGTGAAGAAGG - Intergenic
971591466 4:28474191-28474213 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
971633166 4:29021472-29021494 TTCCTGCCACCACGTGAAGAAGG - Intergenic
971795190 4:31217784-31217806 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
971832378 4:31712618-31712640 TTCCCGCCACCTTGTGAAGAAGG + Intergenic
972667644 4:41182730-41182752 TTCCTGCTGCCTTGTGAGGAAGG - Intronic
973241543 4:47961326-47961348 TTCCAGCCTCCCATTGAGTAAGG + Intronic
974125549 4:57691962-57691984 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
974125822 4:57693958-57693980 TTCCTGCCTCTTTGTGAGGAAGG + Intergenic
974163961 4:58176234-58176256 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
974302863 4:60092318-60092340 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
974556963 4:63463927-63463949 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
975666562 4:76740080-76740102 CTCCAGCCTCCTCCAGAGGTTGG - Exonic
976018798 4:80594247-80594269 TTCCTGCCACCTTGTGAAGAAGG - Intronic
976936407 4:90640770-90640792 TTCCTGCCACCTTGTGAAGAAGG + Intronic
977121881 4:93112493-93112515 CTCCTGCCTCCTTGTGAAGAAGG + Intronic
977138735 4:93339834-93339856 TTCCTGCCACCTTGTGAAGAAGG - Intronic
977942754 4:102876877-102876899 CTCCAGCCTCCTTGTGAAGAAGG - Intronic
979126197 4:116975490-116975512 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
979511344 4:121557276-121557298 TTGCTGCCTCCATGTGAGGAAGG + Intergenic
979941037 4:126763254-126763276 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
980487007 4:133471300-133471322 TTCCGGCCACCTTGTGAAGAAGG + Intergenic
980635074 4:135491671-135491693 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
980751612 4:137097385-137097407 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
982301072 4:153880043-153880065 TTCCCGCCACCTTGTGAAGAAGG + Intergenic
982322386 4:154092406-154092428 TTCCAGTCTCCTCCTGAGCAAGG + Intergenic
982417409 4:155152152-155152174 TTCCTGCTGCCTCGTGAAGAAGG - Intergenic
982593768 4:157351803-157351825 TTCCCGCCACCTTGTGAAGAAGG + Intronic
982923608 4:161306340-161306362 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
983519238 4:168689561-168689583 TTCCAGCCTCCTCGGTAGCTGGG + Intronic
983671124 4:170238966-170238988 TTCACACCTCCTCATGAGGAAGG + Intergenic
983779057 4:171645039-171645061 TTCCAGCCCCCACAGGAGGAAGG - Intergenic
984138976 4:175978238-175978260 CTCCTGCCTCCTCGTGAAGAAGG - Intronic
984571721 4:181403468-181403490 CTCCAGCCACCTTGTGAAGAAGG - Intergenic
985431942 4:189889363-189889385 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
985507869 5:294794-294816 TTCCCGCCTCCTCCTGCCGATGG - Intronic
985740167 5:1610877-1610899 TTCCCGCCTCCTCCTGCCGATGG + Intergenic
986300001 5:6470923-6470945 TTCCAGCCTCCTGCTGCTGATGG - Intronic
986449894 5:7853282-7853304 TTCCTGCCACCTTGTGAAGAAGG + Intronic
986550740 5:8952041-8952063 CTCCTGCCTCCTTGTGAAGAAGG + Intergenic
986751991 5:10795469-10795491 TTCCTGCCACCTCGTGAAGAAGG + Intergenic
986987493 5:13515581-13515603 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
987162037 5:15154837-15154859 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
987441672 5:17964571-17964593 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
987442213 5:17969543-17969565 CTCCTGCCTCCTTGTGAAGAAGG - Intergenic
987496259 5:18648724-18648746 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
987509993 5:18825027-18825049 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
987683220 5:21164489-21164511 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
987893920 5:23919759-23919781 TTCCTGCCACCTTGTGATGAAGG + Intergenic
988230165 5:28466400-28466422 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
988318959 5:29668578-29668600 TTGCAGCCTCCTCATGAGTAAGG + Intergenic
988628418 5:32901751-32901773 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
989303984 5:39930067-39930089 TTCCTGCCGCCTTGTGAAGAGGG + Intergenic
990032888 5:51283211-51283233 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
990484103 5:56241289-56241311 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
990849934 5:60191470-60191492 TTCCTGCCTCCTTGTGAAGAAGG + Intronic
990943036 5:61222745-61222767 TTCCTGCCCCCTTGTGAAGAAGG + Intergenic
991358052 5:65790479-65790501 TTCCTGCCGCCACGTGAAGAAGG - Intronic
991626178 5:68603307-68603329 ATCAAGCCTCCTCTTGAGGCAGG - Intergenic
992818039 5:80464318-80464340 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
993594542 5:89836035-89836057 CTCCTGCCGCCTTGTGAGGAAGG + Intergenic
993769694 5:91910894-91910916 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
994853163 5:105082887-105082909 TTCTAGCCACCTTGTGACGAAGG - Intergenic
995358924 5:111270967-111270989 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
995627095 5:114091718-114091740 TTCCTGCCACCTCGTGAAGAAGG - Intergenic
995988835 5:118210794-118210816 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
996010271 5:118474611-118474633 TTCCGGTCACCTTGTGAGGAAGG - Intergenic
996071630 5:119137690-119137712 TTCCTGCCACCTTGTGAAGAAGG + Intronic
996267902 5:121564458-121564480 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
996365927 5:122701456-122701478 TTCCTGCCACCTTGTGAGGAAGG - Intergenic
996911549 5:128661736-128661758 TTCCTGCCACCTTGTGAAGAAGG + Intronic
997180798 5:131826750-131826772 TTCCTGCCACCTTGTGAAGAAGG + Intronic
998890039 5:146736161-146736183 TTCCTGCCTCCATGTGAAGAAGG + Intronic
998960652 5:147482887-147482909 TTTCTGCCTCCTTGTGAAGAAGG - Intronic
999693964 5:154171905-154171927 ATACAGCCTCCTGCTGAGGAGGG - Intronic
999960805 5:156753675-156753697 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1000515856 5:162235947-162235969 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1000516115 5:162237857-162237879 TTCCTGCCGCCTCATGAAGAAGG - Intergenic
1000728332 5:164800683-164800705 TTCCTGCCCCCACGTGAAGAGGG - Intergenic
1000787513 5:165564155-165564177 CTCCTGCCTCCTTGTGAAGACGG - Intergenic
1001539980 5:172531126-172531148 TTACAGCCTCCACGTGAGTGAGG - Intergenic
1002046408 5:176543816-176543838 TCCCATCCTCCTCCTGAAGAAGG - Intronic
1002959274 6:1898511-1898533 TTCCACCCTCCTTGTTTGGAGGG + Intronic
1003229898 6:4242660-4242682 CTCCAGCTGCCTTGTGAGGAAGG - Intergenic
1003428913 6:6021186-6021208 TTCCAGGCGCCTCCTGAGGTTGG + Intergenic
1005671466 6:28110183-28110205 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1006309673 6:33248982-33249004 CTCCAGCCTCAGCGCGAGGACGG - Intergenic
1007742491 6:44021460-44021482 TTCCAGCTTCTTTCTGAGGAGGG + Intergenic
1007817868 6:44537479-44537501 TTCCTGCTGCCTCGTGAAGAAGG + Intergenic
1008020087 6:46566422-46566444 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
1010024583 6:71200826-71200848 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1010651160 6:78456638-78456660 TTGCAGCCTCCACGTGAAGAAGG - Intergenic
1012038211 6:94170136-94170158 TTCCTGCTTCCTTGTGAAGAAGG - Intergenic
1012107549 6:95183008-95183030 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1012541433 6:100366431-100366453 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1013402449 6:109812127-109812149 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1013607820 6:111766658-111766680 TTCCTGCCATCACGTGAGGAAGG - Intronic
1013661088 6:112297791-112297813 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1013787239 6:113795510-113795532 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1013915995 6:115337273-115337295 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1014356723 6:120420800-120420822 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1014448027 6:121551325-121551347 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1015058724 6:128936067-128936089 TTCCTGCTGCCTTGTGAGGAAGG + Intronic
1015459838 6:133477040-133477062 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1015532038 6:134230469-134230491 TTCCGGCCGCCTTGTGAGGAAGG - Intronic
1015875114 6:137815319-137815341 TTCCAGCCTCCTCTAGGTGATGG - Intergenic
1016487985 6:144564636-144564658 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1016728471 6:147401990-147402012 TTCCTGCCACCTAGTGAAGAAGG - Intergenic
1016814930 6:148294485-148294507 TTCCTACCTCCTGGTGAGAAAGG - Intronic
1017429874 6:154360594-154360616 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1017638457 6:156466518-156466540 TTCCAGCCTCTTCTTCAGCAGGG - Intergenic
1017794969 6:157835726-157835748 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1017951802 6:159141467-159141489 TTCCTGCCACCATGTGAGGAAGG - Intergenic
1018674220 6:166205270-166205292 TTCCAGCCCCCTTGTGAGATGGG + Intergenic
1018680083 6:166257364-166257386 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1019281954 7:205091-205113 TTCCAGGGTCCTGGTGAGTACGG - Intronic
1019551208 7:1603588-1603610 ATCCTGCCTCCTGGTGGGGAAGG + Intergenic
1019564700 7:1673559-1673581 TTCCAGCCTCCTGGGGAGGGAGG + Intergenic
1020172589 7:5856677-5856699 TTCCAGCTGCCGCGGGAGGAGGG + Intergenic
1020173844 7:5866528-5866550 TTCCTGCCTCCTTGATAGGATGG + Intergenic
1020416058 7:7947003-7947025 TTCCAACCATCCCGTGAGGAAGG + Intronic
1021056623 7:16056166-16056188 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1022102434 7:27176457-27176479 TTCCACCCTTCTGGTGAGCAGGG - Intronic
1022456470 7:30562820-30562842 TTCCTGCTTCCTTGTGAAGAAGG - Intergenic
1022694724 7:32692973-32692995 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1025797713 7:64755466-64755488 TTCCTGCCACCTTGTGAAGACGG - Intergenic
1026540829 7:71278662-71278684 TTCCTGCCACCACGTGAAGAAGG - Intronic
1027375678 7:77546806-77546828 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1027501040 7:78951442-78951464 TTTCTGCCACCTCGTGAAGAAGG - Intronic
1028041630 7:86060975-86060997 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1029061341 7:97801136-97801158 TTCCTGCCTCCAGGTGAAGAAGG - Intergenic
1029900196 7:104030957-104030979 TTCCTGCCACCATGTGAGGAAGG + Intergenic
1030073234 7:105715273-105715295 TTCCATTCTCCACATGAGGAAGG - Intronic
1030114813 7:106055086-106055108 TTCCAGCCCCCTCCTGTGAAGGG + Intergenic
1030152412 7:106420565-106420587 GTCCTGCCACCTTGTGAGGAAGG - Intergenic
1030383047 7:108835086-108835108 TTTCTGCCTCCTTGTGAAGAAGG + Intergenic
1030703977 7:112672111-112672133 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1030785279 7:113652879-113652901 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1030873259 7:114783257-114783279 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1031397148 7:121286950-121286972 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1031614059 7:123860153-123860175 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1031755590 7:125637927-125637949 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1031884925 7:127236465-127236487 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1032636389 7:133713767-133713789 TTCTTGCCTCCTTGTGAAGAAGG + Intronic
1032759348 7:134924921-134924943 TTCCTGCCACCTAGTGAAGAAGG + Intronic
1033901758 7:146151017-146151039 TTCCTGCCACCTTGTGATGAAGG - Intronic
1033908707 7:146238812-146238834 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
1034508655 7:151517613-151517635 ATTCAGCGTCCTCCTGAGGACGG - Intronic
1034708849 7:153172694-153172716 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1035185789 7:157125187-157125209 TTCCTCCTTCCTCGGGAGGAAGG - Intergenic
1035845135 8:2855225-2855247 TTCCTGCCACCTCGTGAAGAAGG + Intergenic
1035918273 8:3649531-3649553 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1036125824 8:6061281-6061303 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1036405274 8:8449343-8449365 TTCCAGCTTCTTCGTGTGGACGG - Intergenic
1036527192 8:9546347-9546369 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1037151688 8:15643131-15643153 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1038129039 8:24708419-24708441 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1039098498 8:33913834-33913856 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1039956856 8:42214432-42214454 TTGCAGCCTCCTATGGAGGATGG + Intergenic
1040838509 8:51758673-51758695 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1042203093 8:66300785-66300807 TTTCAGCCTCTTGGTCAGGATGG - Intergenic
1042491084 8:69398518-69398540 CTCCAGCCTCCTCTTGAGCAAGG - Intergenic
1043266654 8:78274564-78274586 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1043321197 8:78988870-78988892 TTCCTGCCTCCTTGTGAAGAAGG - Intergenic
1043774957 8:84254848-84254870 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1044056072 8:87570657-87570679 TTCTTGCCTCCTTGTGAAGAAGG + Intronic
1044871838 8:96627368-96627390 TTCCTGCCTCCATGTGAAGAAGG + Intergenic
1045947619 8:107814312-107814334 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1046848382 8:118944454-118944476 TCCTAGCCTCCTGGTGAGGATGG - Intronic
1047017203 8:120736086-120736108 TTCCTGCCGCCTTGTGAAGAAGG - Intronic
1047033798 8:120913068-120913090 TTCCAGCCGCCCTGTGGGGAAGG + Intergenic
1047226754 8:122961617-122961639 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1048532813 8:135265712-135265734 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1048622699 8:136152249-136152271 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
1048691665 8:136971909-136971931 TTCCTGCCGCCTTGTGAAGAAGG + Intergenic
1048826971 8:138437467-138437489 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1049417824 8:142503601-142503623 TGCCAGCCTCCTGCTGGGGAGGG + Intronic
1049434983 8:142582328-142582350 CTCCAGCCTCTTCCTGGGGATGG - Intergenic
1049648002 8:143745139-143745161 TTCCAGCCTCCTCTTCAGTTTGG + Intergenic
1049784222 8:144442907-144442929 TTGCACCCACCTCGGGAGGAGGG - Intronic
1050660167 9:7875853-7875875 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1051117489 9:13713268-13713290 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1051255305 9:15207043-15207065 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1051368083 9:16335411-16335433 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1051539946 9:18204352-18204374 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1052084710 9:24250128-24250150 TTCCTGCCACCTCGTGAAGTAGG - Intergenic
1052432214 9:28381162-28381184 TTCCAGAGTCCTAGTGTGGAAGG + Intronic
1053721112 9:40947410-40947432 TTCCTGCCACCTCGTGAAGAAGG - Intergenic
1054344877 9:63904745-63904767 TTCCTGCCACCTCGTGAAGAAGG + Intergenic
1055171793 9:73267242-73267264 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1056104712 9:83335720-83335742 TTCCAGCCTCTTCTTTTGGATGG - Intronic
1056329847 9:85512115-85512137 CTCCAGCCTCCTCCTGGGAAAGG + Intergenic
1056481586 9:87011924-87011946 TGCCAGCTTCCTCCTGAGCAAGG + Intergenic
1056492824 9:87124875-87124897 TTCCAGCCTCCTCAAGGGGATGG + Intergenic
1056560120 9:87722813-87722835 TTCCAGCTTCCTCCTGCAGAGGG - Intergenic
1056568157 9:87792989-87793011 TTCCAGCTTCCTCCTGCAGAGGG + Intergenic
1056577768 9:87869129-87869151 ATCCAGCCTCTGAGTGAGGAAGG - Intergenic
1057938866 9:99263126-99263148 CTCCAGCTTCCTCCTGATGACGG - Intergenic
1058337675 9:103853217-103853239 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1059570212 9:115426172-115426194 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1059613835 9:115927452-115927474 TTCCTGCCACCTTTTGAGGAAGG + Intergenic
1059617966 9:115971502-115971524 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1060248334 9:121965374-121965396 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1060566680 9:124599019-124599041 CACCCGCCTCCTCATGAGGAGGG - Intronic
1061313401 9:129778531-129778553 TTCCAGCGTCCTGCAGAGGAGGG + Intergenic
1061890769 9:133617983-133618005 TTCCAGCCTCCTCCTGGGCATGG + Intergenic
1062345252 9:136111418-136111440 GACCAGCCGCCTCGTAAGGATGG + Intergenic
1203454075 Un_GL000219v1:148740-148762 TTCCTGCCACCTCGTGAAGAAGG + Intergenic
1185848618 X:3464480-3464502 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
1186024457 X:5293666-5293688 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1187102614 X:16210224-16210246 TTTCTGCCTACTCGTGAAGATGG + Intergenic
1187458747 X:19466488-19466510 TTCCTGCCGCCTTGTGAAGAAGG + Intronic
1187615624 X:20990839-20990861 TTCCTGCCACCACGTGAAGAAGG - Intergenic
1188018893 X:25135388-25135410 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1188616661 X:32165921-32165943 TTCCTGCCACCTTGTGAAGAAGG + Intronic
1190139079 X:47825691-47825713 TTCCTGCCGCCTTGTGAAGAAGG - Intergenic
1190889506 X:54556281-54556303 TTCCTGCCACCTTGTGAAGAAGG - Intronic
1193196899 X:78643355-78643377 TTCCAGGCTGCTGGTGAGCAGGG - Intergenic
1193236830 X:79116951-79116973 ATCCTGCCTCCTTGTGAAGAAGG - Intergenic
1193434849 X:81460216-81460238 CTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1193572943 X:83166393-83166415 TTCCTACCTCTACGTGAGGAAGG + Intergenic
1194084307 X:89506762-89506784 TTCCTGCCTCCATGTGAAGAAGG - Intergenic
1194447338 X:94004791-94004813 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1194893055 X:99404452-99404474 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1195032163 X:100936737-100936759 TTCCTGCCGCCTTGTGATGAAGG - Intergenic
1195124906 X:101798519-101798541 TTCCTGCCACCTGGTGAAGAAGG + Intergenic
1195179831 X:102347103-102347125 TTCCTGCCACCTTGTGACGAAGG - Intergenic
1195242969 X:102971539-102971561 TTCCTGCCACCTTGTGAGGAAGG + Intergenic
1195404382 X:104496912-104496934 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1196268482 X:113681889-113681911 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1196306431 X:114108408-114108430 TTCCTGCCTCCTTGTGAAGAAGG + Intergenic
1196996167 X:121386741-121386763 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1197040300 X:121928917-121928939 TTTCTGCCACCTTGTGAGGAAGG + Intergenic
1197040551 X:121930814-121930836 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1197953441 X:131921972-131921994 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1198847224 X:140925018-140925040 TTCCTGCCACCTTGTGAAGAAGG + Intergenic
1199051621 X:143242951-143242973 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1199272808 X:145904827-145904849 CTCCTGCCACCTTGTGAGGAAGG + Intergenic
1199620727 X:149697926-149697948 TTCCTGCCACCTTGTGAAGACGG + Intronic
1199708533 X:150451567-150451589 TTCCAGACTTCTGGGGAGGAGGG + Intronic
1199815214 X:151391721-151391743 TGCCAGCCTCCACGGGATGAGGG + Intergenic
1199829081 X:151531089-151531111 TTCCTGCCACCTTGTGAAGAAGG - Intergenic
1200121588 X:153793749-153793771 TTCCAGGCGCCTCGAGGGGAAGG + Exonic
1200436946 Y:3162650-3162672 TTCCTGCCTCCATGTGAAGAAGG - Intergenic
1200803806 Y:7411515-7411537 TTCCTGCCACCTTGTGAAGAAGG - Intergenic