ID: 1168471631

View in Genome Browser
Species Human (GRCh38)
Location 19:56644879-56644901
Sequence CTGTAGTCTCAGATATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1849
Summary {0: 1, 1: 4, 2: 12, 3: 202, 4: 1630}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168471631_1168471634 -3 Left 1168471631 19:56644879-56644901 CCTTCCAATATCTGAGACTACAG 0: 1
1: 4
2: 12
3: 202
4: 1630
Right 1168471634 19:56644899-56644921 CAGGCTCGTGACACCACACCTGG 0: 2
1: 53
2: 2146
3: 17657
4: 65707
1168471631_1168471638 17 Left 1168471631 19:56644879-56644901 CCTTCCAATATCTGAGACTACAG 0: 1
1: 4
2: 12
3: 202
4: 1630
Right 1168471638 19:56644919-56644941 TGGCTAATTTTTAAACTCCTGGG 0: 1
1: 0
2: 3
3: 65
4: 493
1168471631_1168471637 16 Left 1168471631 19:56644879-56644901 CCTTCCAATATCTGAGACTACAG 0: 1
1: 4
2: 12
3: 202
4: 1630
Right 1168471637 19:56644918-56644940 CTGGCTAATTTTTAAACTCCTGG 0: 1
1: 0
2: 6
3: 89
4: 687

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168471631 Original CRISPR CTGTAGTCTCAGATATTGGA AGG (reversed) Intronic
900804190 1:4756596-4756618 ATGTAGTCTCAGAGACAGGAGGG - Intronic
901104685 1:6745999-6746021 CTGTAGTCTCAGCTACTCGGTGG + Intergenic
901371405 1:8801134-8801156 CTGTAGCCTCAGCTACTGGAGGG + Intronic
901377724 1:8851513-8851535 CTGGAGTCTCAGTTACTTGAGGG + Intergenic
901399848 1:9008201-9008223 CTGTAGTCACAGTTATGAGACGG + Intronic
901557342 1:10042055-10042077 CTGTAATCCCAGATACTCGAGGG - Intronic
901588257 1:10316621-10316643 CTGTAGTCCCAGCTACTAGAGGG - Intronic
901607859 1:10473531-10473553 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
901609258 1:10484148-10484170 CTGTAATCCCAGCTACTGGAAGG - Intronic
901713760 1:11136619-11136641 CTGTAGTTTCAGCTACTGGGAGG - Intronic
901724456 1:11229852-11229874 CTGTAGTCCCAGCTACTTGAGGG + Intronic
901802766 1:11718588-11718610 CTGTAGTCCCAACTATAGGAAGG - Intronic
901893233 1:12286198-12286220 CTGTAGTCCCAGCTACTCGAGGG - Intronic
901899412 1:12345979-12346001 CTGTAGTCCCAGTGGTTGGAGGG + Intronic
902061388 1:13646278-13646300 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
902066042 1:13688734-13688756 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
902105863 1:14035590-14035612 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
902140878 1:14353344-14353366 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
902312806 1:15594577-15594599 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
902519527 1:17008262-17008284 CTGTAGTCCCAGCTATTTGGAGG - Intronic
902523185 1:17034267-17034289 CTGTAGTCCCAGCTACTGGGGGG - Intronic
902749094 1:18494253-18494275 CTGTAATCTCAGCTACTGGGAGG + Intergenic
902911713 1:19603206-19603228 CTGTAATCTCAGCTACTGGGAGG + Intronic
903110291 1:21127111-21127133 CTGTAGTCCCAGCTACTGGGTGG - Intronic
903237730 1:21961188-21961210 CTGTAGTCTCAGCTATTGGGAGG + Intergenic
903247773 1:22028773-22028795 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
903454053 1:23474703-23474725 CTGTAGTCCCAGCTATTCGGAGG - Intronic
903932108 1:26868471-26868493 CTGTAGTCTCAGCTACTTGAGGG - Intergenic
904024576 1:27494291-27494313 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
904062556 1:27723293-27723315 CTGTAATCCCAGATTTTGGGAGG + Intergenic
904116612 1:28166853-28166875 CTGTAGTCTCAGCTATTCAGAGG + Intronic
904135922 1:28312586-28312608 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
904150724 1:28437350-28437372 CAGTAGTCCCAGCTACTGGAGGG - Intronic
904529484 1:31158868-31158890 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
904628186 1:31820554-31820576 CTGTAGTCCCAGTTATTGGGAGG + Intergenic
904755030 1:32763980-32764002 CTGGGGTCCCAGATATTGGGAGG - Intronic
904984706 1:34535512-34535534 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
905698034 1:39990330-39990352 CTGTAATCTCAGCTACTTGAGGG + Intergenic
905788483 1:40776621-40776643 CTGGAGTCTCAGGGATTGGAGGG - Intergenic
906247443 1:44286812-44286834 CTGGACTCTCAGATCTTGGAAGG - Intronic
906272055 1:44487210-44487232 CTGTAGTCTCAGCTACTTGAGGG + Intronic
906284778 1:44579906-44579928 CTGTAGTCCCAGCTACTGGGAGG + Intronic
906339596 1:44967322-44967344 CTGTAGTCCCAGCTACTTGAGGG + Intronic
906425950 1:45712734-45712756 CTGCAGTCCCAGCTACTGGAAGG + Intronic
906838626 1:49111233-49111255 CTGTACTCCCAGCTATTGGGAGG - Intronic
907018750 1:51044151-51044173 CTGTAGTCCCAGCTCTTTGAAGG - Intergenic
907029472 1:51156604-51156626 CTGTAGTCCCAGATACTTGGGGG + Intergenic
907078880 1:51603031-51603053 CTGTAGTCCCAGTTATAGGGTGG + Intronic
907082802 1:51639944-51639966 CTATAGTCCCAGCTACTGGAGGG - Intronic
907191557 1:52653336-52653358 CTGTAGTCCCAGCTACTGGGAGG + Intronic
907193858 1:52670448-52670470 CTGTAATCCCAGCTATTGGGAGG + Intergenic
907339240 1:53722709-53722731 CTGCAGTCCCAGCTACTGGAAGG + Intronic
907351257 1:53833280-53833302 CTGTAATCCCAGCTACTGGAAGG - Intronic
907582557 1:55585024-55585046 CTGCAGACGCAGATATTGGAAGG - Intergenic
907717673 1:56942580-56942602 CTGTAGTCCCAGCTTTTGGGAGG + Intronic
907723236 1:56993715-56993737 CTGTAGTCCCAGCTATTTGGAGG + Intergenic
908084326 1:60614398-60614420 CTGTAGTCTCAGGTACTTGGGGG - Intergenic
908129960 1:61065347-61065369 TTGTAGTCTCAGCTACTTGAGGG - Intronic
908177468 1:61569939-61569961 CTGTAATCCCAGATTTTGGGAGG - Intergenic
908183825 1:61632576-61632598 CTGTAGTCCCAGTTACTTGAAGG - Intergenic
908274875 1:62459976-62459998 CTGTAGTCCCAGCTACTGGGAGG + Intronic
908326219 1:63026334-63026356 CTGTAGTCTCAGCTACTGGGAGG + Intergenic
908545927 1:65162126-65162148 CTGTAGTCCCAGCTACTGGGAGG + Intronic
909000749 1:70215018-70215040 CTGTAGTCTCAGCTATTCGGAGG - Intronic
909018710 1:70407744-70407766 CTGTAGTCTCAGCTACTTGTGGG + Intergenic
909192009 1:72565379-72565401 CTGTAATCCCAGCTACTGGAGGG - Intergenic
909242694 1:73235183-73235205 CTGTAATCCCAGACTTTGGAAGG - Intergenic
909255135 1:73410576-73410598 CTGTAGTCCCAGCTATTTGAGGG + Intergenic
909389556 1:75104168-75104190 CTGTAGTCTGAGCTACTCGAAGG + Intergenic
909389618 1:75105034-75105056 CTGCAGTCCCAGCTACTGGAAGG + Intergenic
909401937 1:75243257-75243279 CTGTAGTCTCAGCTACTCAAAGG - Intronic
909870199 1:80729340-80729362 CTGTGTTCTCACATAGTGGAAGG + Intergenic
909989007 1:82198764-82198786 CTTAAGTTTCAGAGATTGGAAGG + Intergenic
910175070 1:84420966-84420988 CTGTAGTCCCAGCTACTAGAGGG + Intergenic
910240659 1:85082565-85082587 CTGTAGTCTCAGCTACTTGGGGG - Intronic
910271674 1:85402106-85402128 CTGTAGTCTTAGCCATTTGAGGG - Intronic
910853779 1:91673533-91673555 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
910956313 1:92710219-92710241 CTATAGTCTCAGCTACTGGGGGG + Intronic
910964675 1:92796522-92796544 CTGTAGTCTCAGATACTTGGGGG - Intergenic
910992418 1:93069727-93069749 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
911116321 1:94249627-94249649 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
911342753 1:96658814-96658836 CTGTAGTCCTAGCTACTGGAAGG - Intergenic
912075427 1:105868917-105868939 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
912140068 1:106713808-106713830 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
912183241 1:107243673-107243695 CTGTAGTCCCAGCTACTGGAAGG - Intronic
912342321 1:108928865-108928887 CTATAGTCTCAGCTACTGGGAGG + Intronic
912403010 1:109411745-109411767 CTGTAGTCCCAGCTACTTGAAGG - Intronic
912726313 1:112061712-112061734 CTATAGTCTCAGCTACTGGGAGG - Intergenic
912912335 1:113774731-113774753 CTGTAGTCCCAGATACTTGGTGG + Intronic
914005355 1:143728263-143728285 CTGTAGTCCCAGCTACTGGTAGG + Intergenic
914097835 1:144559513-144559535 CTGTAGTCCCAGCTACTGGTAGG + Intergenic
914692133 1:150039497-150039519 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
914708744 1:150193793-150193815 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
914719739 1:150280099-150280121 CTGCAGTCCCAGCTATTGGGGGG + Intronic
914727300 1:150338635-150338657 CTGTAGTCCCAGCTACTTGAGGG - Intronic
914774759 1:150726523-150726545 CTCTAGTCCCAGCTACTGGAGGG + Intergenic
914776388 1:150739569-150739591 CTGTAGTCTCAGCTACTTGGAGG + Intronic
914777665 1:150752974-150752996 CTGTAGTCCCAGCTACTTGAGGG - Intronic
914910837 1:151785052-151785074 CTGTAGTCTCAGCTACTGGGAGG - Intronic
915132073 1:153702405-153702427 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
915257535 1:154645925-154645947 CTGTAGTCCCAGCTATTTGGAGG - Intergenic
915414415 1:155729660-155729682 CTGTAGTCACTGCTACTGGAAGG + Intronic
915647580 1:157284698-157284720 CTGTATTCTCACATGGTGGAAGG + Intergenic
915959308 1:160251593-160251615 CTGTAGTCCCAGCTACTGGAGGG - Intronic
916148633 1:161764200-161764222 CCGTAGTCTCAGCTATTGTGGGG + Intergenic
916572905 1:166042588-166042610 CTATAGTCTCAGCTACTTGAGGG - Intergenic
916896770 1:169171638-169171660 CTGTAGTCTCAGCTACTTGGGGG + Intronic
917088291 1:171326102-171326124 CTGTAATCTCAGTATTTGGAAGG - Intronic
917239951 1:172937606-172937628 CTGTAGTCCCAGATACTTGGGGG - Intergenic
917380003 1:174395725-174395747 CTGGAGTCTCAGCTATTGAGAGG + Intronic
917421891 1:174872661-174872683 CTGTAGTCTCAGCTATTTGCGGG - Intronic
917586315 1:176430687-176430709 CTGTGGTCTCAGCTACTTGAGGG + Intergenic
918214374 1:182380427-182380449 CTGTAGTCTCAGCTATCAGGAGG - Intergenic
918773899 1:188603422-188603444 CTGCAGTCTCACATAGTGAAAGG + Intergenic
918872719 1:189997290-189997312 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
918890716 1:190263709-190263731 CTGTAGTCCCAGCTACTGGGAGG - Intronic
919238204 1:194873961-194873983 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
919908509 1:202095140-202095162 CTGTGGTCCCAGCTACTGGAGGG + Intergenic
920325371 1:205159210-205159232 CTGTAGTCCCAGCTACTTGAGGG - Intronic
920568603 1:206998166-206998188 CTGTAGTCCCAGCTATTCGGAGG - Intergenic
920636539 1:207710085-207710107 CTGTAATCTCAGCATTTGGAAGG + Intronic
921044395 1:211463617-211463639 CTGTAGTCTCAGTTACTTGGTGG + Intergenic
921115438 1:212086510-212086532 CTGTAGTCCCAGCTATTGGGAGG - Intronic
921131483 1:212223530-212223552 CTGTAGTCTCAGATACTGGGAGG + Intergenic
921403365 1:214751757-214751779 CTGTAGTCTCAGCTCTCGGGAGG - Intergenic
921467314 1:215504323-215504345 CTGCAGTCTTACATATTTGAGGG + Intergenic
921567044 1:216733865-216733887 CTGTAATCTTAGCTATTGGGAGG + Intronic
921700494 1:218263596-218263618 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
921859388 1:220025915-220025937 CTGTAGTCCCAGCTATTTGGGGG - Intronic
921862571 1:220054932-220054954 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
921911133 1:220550473-220550495 CTGTAGTCCCAGCTACTTGAGGG - Intronic
922230383 1:223680568-223680590 CTGTAATCCCAGCTATTGGGAGG - Intergenic
922410919 1:225374381-225374403 CTGTAATCTCAGCTACTGGGAGG - Intronic
922418494 1:225443282-225443304 CTGTATTCCCAGATACTGGCTGG - Intergenic
922492246 1:226027390-226027412 CTGTAGTCTCAGCTACTGGGGGG - Intergenic
922846186 1:228686860-228686882 CTGTAATCCCAGCTATTGGGAGG - Intergenic
923549270 1:234949420-234949442 CTGTAATCTCAGCACTTGGAAGG + Intergenic
923599849 1:235392892-235392914 CTGTAGTCCCAGCTACTGGGAGG + Intronic
923634553 1:235682186-235682208 CTGTAGCCCCAGCTATTGGTAGG + Intronic
924111081 1:240700656-240700678 CTGTAGTCCCAGATACTCGGAGG + Intergenic
924292222 1:242548187-242548209 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
924301615 1:242644997-242645019 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
924369912 1:243336679-243336701 CTGTAATCCCCGATGTTGGAGGG - Intronic
924440101 1:244078813-244078835 CTGTAATCCCAGCTACTGGAGGG - Intergenic
924513828 1:244750159-244750181 CTGTAGCCTCAGCTATTCGGAGG - Intergenic
924515831 1:244765272-244765294 CTGTAGTCCCAGATAATTGAGGG - Intergenic
924778086 1:247124918-247124940 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1063400163 10:5736059-5736081 TTGTAGTCCCAGCTATTTGAGGG - Intronic
1063424582 10:5941407-5941429 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1063555058 10:7070546-7070568 CTGGAGTCTCTGATATTTCATGG - Intergenic
1063712731 10:8495299-8495321 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1064045556 10:12011473-12011495 CTGTAGTCCCAGTTATTGCTTGG + Intronic
1064069055 10:12209685-12209707 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1064134927 10:12742255-12742277 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1064200484 10:13280457-13280479 CTGTAGTCCCAGCTACTCGAAGG - Intronic
1064201874 10:13291599-13291621 TTGTAGTCCCTGCTATTGGAAGG - Intronic
1064394358 10:14969324-14969346 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1064396531 10:14986730-14986752 CTGTAGTCTCAGCTATTCGCAGG - Intronic
1064399124 10:15006098-15006120 CTGTAGTCTCAGCTACTTGGAGG - Intergenic
1064422266 10:15200511-15200533 CTGTGGTCTCAGATACTTGGGGG + Intergenic
1064440315 10:15347711-15347733 CTGTAGTCTCAGCTACTTGGAGG + Intronic
1064697564 10:17983363-17983385 CTGTGGTCTCAGATACTTGGGGG + Intronic
1064882316 10:20069706-20069728 CTGTAGTCTCAGCTACTTGAGGG + Intronic
1064967929 10:21034042-21034064 CTGTAGTCTCAGCTACTAGGGGG + Intronic
1065003940 10:21362469-21362491 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1065248961 10:23790855-23790877 CTGTAGTCCCAGCTATTGGGGGG - Intronic
1065391832 10:25190453-25190475 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1065542664 10:26785597-26785619 CTGTAGTCTCAGTTACTTGCGGG + Intronic
1065571225 10:27072547-27072569 CTGGAGTCTCAGACAATGGTTGG - Intronic
1065691468 10:28338286-28338308 CTGTAGTCTCAGCTACTTGGAGG + Intergenic
1065750899 10:28886151-28886173 CTGTAGTTGCAGCTATTGGGAGG + Intergenic
1066009396 10:31180328-31180350 CTGTAGTCACAGCTATTTGGGGG + Intergenic
1066097215 10:32083880-32083902 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1066281785 10:33924741-33924763 TTGTAGTCTCAGCTACTGGGGGG - Intergenic
1066319573 10:34288086-34288108 CTGTAGTCTCAGCTACTCAAGGG + Intronic
1066362540 10:34745238-34745260 CTGTAGTCCCAGATATTCGGAGG + Intronic
1066373754 10:34838946-34838968 TTGTAGTCTCAGCTACTGGGAGG + Intergenic
1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG + Intronic
1066485116 10:35835870-35835892 CTGTAGTCTTAGTTACTTGAAGG - Intergenic
1066549891 10:36544796-36544818 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1066686547 10:37987006-37987028 CTGTAGTCTCAGCTATCAGGAGG + Intergenic
1067398559 10:45948602-45948624 CTGTAGTCTCAGCTACATGAGGG + Intergenic
1067494917 10:46753316-46753338 CTGTAGTCCCAGCTAATGGGGGG - Intergenic
1067599737 10:47587080-47587102 CTGTAGTCCCAGCTAATGGGGGG + Intergenic
1067843031 10:49697068-49697090 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1067845251 10:49714813-49714835 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1068145698 10:53067731-53067753 CTGTAGTCTCAACACTTGGAAGG + Intergenic
1068490068 10:57711882-57711904 CTATAGTCTCAGCTACTGGGAGG - Intergenic
1068981744 10:63070012-63070034 CTGTAGACTCAGAAAATGGTTGG + Intergenic
1068990019 10:63140534-63140556 CTGTAGTCCCAGCTACAGGAGGG - Intronic
1069032202 10:63609327-63609349 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1069033794 10:63627414-63627436 CTGTAGTCCCAGCTATTTGCGGG + Intergenic
1069278646 10:66625509-66625531 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1069449138 10:68502071-68502093 CTGTAATCCCAGCTACTGGAGGG + Intronic
1069460635 10:68591778-68591800 CTGTAGTCCCAGCTACTGGCTGG + Intronic
1069483169 10:68802354-68802376 CTGTAGTCCCAGAACTTGGGAGG + Intergenic
1069689973 10:70344076-70344098 CTGTAGTCGCAGATACTTGGGGG + Intronic
1069975422 10:72209040-72209062 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1070049255 10:72871020-72871042 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1070067151 10:73047927-73047949 CTGTAGTCCCACATACTTGAGGG + Intronic
1070108670 10:73461322-73461344 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1070458760 10:76643970-76643992 CTGTACTCACAGTTGTTGGATGG + Intergenic
1070650984 10:78236261-78236283 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1070993371 10:80752676-80752698 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1071050141 10:81437471-81437493 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1071415635 10:85438408-85438430 CTATAGTCACAGATATAGTAAGG - Intergenic
1071534599 10:86417488-86417510 CTGTAGTCTCAGCTACTTGAGGG - Intergenic
1071614623 10:87063998-87064020 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1071651271 10:87394966-87394988 CTGTAGTCCCAGCTAATGGGGGG + Intergenic
1071787613 10:88919957-88919979 CTGTAGTCTCAACTACTTGAGGG - Intronic
1071927366 10:90425778-90425800 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1072055200 10:91748249-91748271 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1072060332 10:91803738-91803760 CTGTAGTCTGGGAGATTGGAAGG - Intronic
1072092020 10:92137876-92137898 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1072111468 10:92324482-92324504 CTGTAGTCCCAGCTATTCGGGGG - Intronic
1072505651 10:96063590-96063612 CTGTAGTCTCAGCTACTTGTGGG + Intergenic
1072611472 10:97020091-97020113 CTGTAGTCCCAGCTACTGGGTGG - Intronic
1072645357 10:97250504-97250526 CTGTAGTCTCAGCTACTTGGAGG - Intronic
1072647113 10:97265375-97265397 CTGTAGTCCCAGCTAGTGGGAGG + Intronic
1072805362 10:98420591-98420613 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1072926730 10:99622216-99622238 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1073011788 10:100365813-100365835 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
1073161711 10:101403711-101403733 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1073246224 10:102092085-102092107 CTGTAATCCCAGAATTTGGAAGG - Intergenic
1073313619 10:102562399-102562421 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1073378250 10:103055842-103055864 CTGTAATCTCAGCTCTTGGCGGG + Intronic
1073421953 10:103431468-103431490 CTGTAATCTCAGTTTTTGGGAGG + Intronic
1073714243 10:106084483-106084505 CTGTAATCTCAGCATTTGGAAGG + Intergenic
1073953619 10:108840874-108840896 CTGAAGTCTCTGATTTTTGACGG - Intergenic
1074381042 10:112980747-112980769 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1074440568 10:113474185-113474207 CTGTAGTCTCAGCTACTTGCGGG - Intergenic
1074802050 10:117009779-117009801 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1075113909 10:119610091-119610113 CTGTAATCTCAGCTACTGGAGGG - Intergenic
1075207976 10:120463147-120463169 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1075350012 10:121715625-121715647 CTGTGGTCTCAGCTTTTGGGAGG + Intergenic
1075528795 10:123209371-123209393 CTGTAGTCACAGCTACTTGAGGG + Intergenic
1075554022 10:123416585-123416607 CTGTAGTCTCAGCTACTAGGGGG - Intergenic
1076106155 10:127825267-127825289 CTGTAGTCCCAGGTACTGGGGGG + Intergenic
1076668653 10:132107004-132107026 CTGTGGTCTCAGTTATTTGAGGG - Intronic
1076710224 10:132329289-132329311 CTGTAGTCTCAGCTACTTGAGGG + Intronic
1077450540 11:2640406-2640428 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1077604345 11:3597893-3597915 CTGTAGTCTCAGCTACTTGGAGG - Intergenic
1077628342 11:3793408-3793430 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1077730709 11:4726338-4726360 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1078401499 11:11031658-11031680 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1078685504 11:13526960-13526982 CTGTAGTCTCAGTTACCGGGAGG - Intergenic
1078701788 11:13692043-13692065 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1078712129 11:13803622-13803644 CTGTAATCTCACACAGTGGAAGG - Intergenic
1079066942 11:17302859-17302881 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1079468873 11:20759313-20759335 CTGGAGTCTCAGACATTGAAAGG + Intronic
1079578413 11:22031429-22031451 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1079972243 11:27049505-27049527 CTGTAATCCCAGCTATTTGAGGG - Intronic
1080516508 11:33026723-33026745 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1080523713 11:33091834-33091856 CTGTAGTCCCAGATACTGGGAGG - Intronic
1080526224 11:33122791-33122813 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1080595055 11:33765649-33765671 CTGTAATCCCCAATATTGGAGGG + Intronic
1080884703 11:36356032-36356054 CTGTAGTCCCAGCTACTTGAAGG - Intronic
1080949709 11:37017597-37017619 CTGTAGTCCCAGCTACTGGGTGG - Intergenic
1080974180 11:37316245-37316267 CTGTAGTCTTAGCTACTGGGAGG - Intergenic
1081508714 11:43745772-43745794 CTGTAATCCCAGCTTTTGGAAGG + Intronic
1081790249 11:45777857-45777879 CTGTAGTCCTAGATACTGGGAGG - Intergenic
1081927592 11:46843606-46843628 CTGTAGTCCCAGCTACCGGAAGG + Intronic
1082039665 11:47674442-47674464 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1082051955 11:47777632-47777654 CTGTAGTCCCAGCTACTAGAGGG - Intergenic
1082194493 11:49285666-49285688 CTATAGTCTCAGTTATTGGCAGG - Intergenic
1082865918 11:57900088-57900110 CTGTAGTCCCAGCTACTGAAAGG + Intergenic
1083039374 11:59670715-59670737 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1083203857 11:61135675-61135697 CTGTAGTCCCAGCTATTGGAAGG - Intronic
1083407334 11:62467079-62467101 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1083818201 11:65149738-65149760 CTGTAGTCCCAGACTTTGGGAGG - Intergenic
1084045441 11:66565361-66565383 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1084374910 11:68769924-68769946 CTGTAGTTTCAGCTACTCGAGGG + Intronic
1084725915 11:70941934-70941956 CTGTAATCCCAGCTATTTGAGGG + Intronic
1084845503 11:71896154-71896176 CTGTAGTCTCAGCTACTCGGAGG + Intronic
1085106583 11:73848942-73848964 CTGTAGTCCCAGCTATTCCAGGG - Intronic
1085293561 11:75417642-75417664 CTGTAGTCTCAGCTACTGGGAGG + Intronic
1085356663 11:75844347-75844369 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1085367232 11:75960642-75960664 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1085623412 11:78054281-78054303 CTGTAATCTCAGACTTTGGGAGG - Intronic
1085658258 11:78337358-78337380 CTGTAGTCTCAGAAATGGCAGGG + Intronic
1086092315 11:83017214-83017236 CTGTAGTCCCAGCTACTAGAGGG + Intronic
1086162923 11:83743554-83743576 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1086467977 11:87075087-87075109 CTGTAGTCCCAGCTACTGGTCGG - Intronic
1086478116 11:87202146-87202168 CTGTAGTCCCAGATACTTGGGGG - Intronic
1086548040 11:88021710-88021732 CTGTAGTCTCAGCTCTTGAAAGG - Intergenic
1086579293 11:88378838-88378860 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1086671650 11:89555361-89555383 CTATAGTCTCAGTTATTGGCAGG + Intergenic
1087228924 11:95637648-95637670 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1087469723 11:98557083-98557105 CTGTAGTTCCAGCTACTGGACGG + Intergenic
1087667077 11:101063132-101063154 CTGTAGCATTAGATTTTGGAAGG - Intronic
1087771973 11:102220657-102220679 CTGGAGTCTCTGAGGTTGGAGGG + Intronic
1088101029 11:106155852-106155874 CTGTAATCCCAGTTACTGGAGGG - Intergenic
1088167176 11:106952760-106952782 CTGTAGTCCCAGATATTGGGAGG - Intronic
1088303607 11:108385192-108385214 CTGTAATCTCAGATACTCGGAGG - Intronic
1088333621 11:108678979-108679001 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1088588983 11:111386040-111386062 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1089250426 11:117156064-117156086 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1089278697 11:117357227-117357249 CTGTAATCCCAGCTATTTGAGGG - Intronic
1089363267 11:117905015-117905037 CTGTAGTCCCAGCTATGAGAGGG - Intronic
1090080937 11:123612186-123612208 CTGTAGTCCCAGCTAATGGGAGG - Intronic
1090124408 11:124070635-124070657 CTGTAGTTTCAGCTACTTGAAGG - Intergenic
1090275994 11:125420062-125420084 CTGTAGTCCCAGCTATTTGTGGG + Intronic
1090705153 11:129329554-129329576 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1090754271 11:129774973-129774995 CTGTAATCTCAGCAATTGGGAGG - Intergenic
1090782218 11:130017522-130017544 CTGTAATCTCAGCAATTGGGAGG - Intergenic
1090822166 11:130352782-130352804 CTGTAGTCCCAGATACTGGGAGG - Intergenic
1090848745 11:130552201-130552223 CTATATTCTCACATAGTGGACGG - Intergenic
1091401487 12:183433-183455 CTGTAATCCCAGCTATTCGAAGG + Intergenic
1091566761 12:1654519-1654541 CTGTAGTCCCAGCTACTGGCCGG + Intergenic
1091924827 12:4337286-4337308 CTGTAATCCCAGCTATTGGGAGG - Intronic
1092190951 12:6520363-6520385 CTGTGGTCTCAGCTACTCGAGGG - Intronic
1092431497 12:8413044-8413066 CTGTAGTCTCAGCTACTGGGAGG - Intergenic
1092434451 12:8435661-8435683 CTGTAGTCTCAGCTACTGGGAGG - Intergenic
1092447721 12:8573276-8573298 CTGTAGTCTCAGCTACTAGGAGG - Intergenic
1092484129 12:8887034-8887056 CTGTAGTCTCAGAAACTTGGGGG + Intergenic
1092605877 12:10118078-10118100 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1092749948 12:11709458-11709480 CTATATTCTCAGCTATTGGGAGG - Intronic
1092819737 12:12342063-12342085 ATGTAGTCCCAGCTATTGGGAGG - Intronic
1092828115 12:12416563-12416585 CTGTAGTCTCAGTTACTGGGAGG - Intronic
1093231130 12:16543332-16543354 CCGTAGTCAGAGATAGTGGATGG - Intronic
1093432292 12:19097858-19097880 CTGTTGTCCCAGCTCTTGGAAGG - Intergenic
1093586229 12:20840510-20840532 CTGTAATCTCAGCTACTGGGAGG - Intronic
1093598608 12:20993353-20993375 CTGTAATCTCACATGCTGGAAGG - Intergenic
1093888259 12:24488460-24488482 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1094137136 12:27139627-27139649 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1094173938 12:27522980-27523002 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
1094220575 12:27988464-27988486 CTTTAGTCTCAGATAATCCATGG + Intergenic
1094336107 12:29356142-29356164 CTGTAATCCCAGATACTCGAGGG - Intronic
1094555033 12:31490487-31490509 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1094602979 12:31926633-31926655 CTGTAGTCTCAGCTACCGGGAGG + Intergenic
1095402546 12:41831699-41831721 CTGTAATCCCAGACATTGGGAGG + Intergenic
1095783184 12:46083343-46083365 CTGTAATCTCAGAATTTGGGAGG - Intergenic
1096003882 12:48152878-48152900 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1096046977 12:48570852-48570874 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1096086968 12:48871847-48871869 CTGTAGTCTCAGCTACTGGAAGG + Intergenic
1096160433 12:49372165-49372187 CTGTAGTCTCAGCTACTTGGAGG - Intronic
1096170686 12:49467169-49467191 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1096170870 12:49468597-49468619 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1096364646 12:51018270-51018292 CTGTAATCCCAGCTATTGGGAGG + Intronic
1096406699 12:51349007-51349029 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1096419549 12:51445289-51445311 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1096502435 12:52072893-52072915 CTGTAGTCCCAGTTACTTGAGGG - Intronic
1096688443 12:53304710-53304732 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1096699007 12:53369985-53370007 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1096734901 12:53645240-53645262 CTGTAATCTCAGCTATTAGGTGG + Intronic
1096871419 12:54594890-54594912 CTGTATTCTGAGATTTTGGGTGG + Intergenic
1096991640 12:55809081-55809103 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1097022600 12:56031127-56031149 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1097075676 12:56391725-56391747 CTGTGGTCTCAGCTACTTGAAGG + Intergenic
1097112720 12:56673838-56673860 CTGTAGTCCCAGATACTTGAGGG + Intronic
1097630758 12:62059193-62059215 CTGTAGTCCCAGCTATCAGAGGG + Intronic
1098089875 12:66890049-66890071 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1098198327 12:68026412-68026434 CTGTAATCTCCAATGTTGGAGGG + Intergenic
1098234883 12:68408803-68408825 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
1098235524 12:68414547-68414569 CTGTGGTCTCACATGGTGGAAGG - Intergenic
1098357575 12:69626222-69626244 CTGTAGTCTCAGCTACTCCAGGG - Intergenic
1098453783 12:70649829-70649851 CTGTAGTCCCAGACTTTGGGAGG - Intronic
1098545332 12:71705562-71705584 CTGTAATCTCACACTTTGGAAGG - Intergenic
1099010861 12:77289478-77289500 CTGTAGTCCCAGTTACTCGAGGG + Intergenic
1099013518 12:77319866-77319888 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1099150196 12:79101782-79101804 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1099400138 12:82193762-82193784 CTGTTGTCTCAGACAGTGCAGGG - Intergenic
1099615489 12:84929330-84929352 CTGTAGTCTCAGCTATTTGGGGG + Intergenic
1099714862 12:86278299-86278321 CTGTAATCCCAGCTATTTGAGGG - Intronic
1099871972 12:88360881-88360903 CTCTAGTCTCAGCTATGTGAAGG - Intergenic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1100185327 12:92132720-92132742 CTGTAATCTCAGATTTGGTAAGG + Intronic
1100188159 12:92159968-92159990 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1100188801 12:92168016-92168038 CTATAGCCTCACATAATGGAAGG + Intergenic
1100265588 12:92972940-92972962 CTGTAGTCCCAGATACTCGGGGG + Intergenic
1100319286 12:93474968-93474990 CTGTAATCTCAGCTACTCGAGGG + Intronic
1100345591 12:93726841-93726863 CTGTTGTCAAAGACATTGGAAGG + Intronic
1100369250 12:93951028-93951050 CTGTAGTCTCAGGTACTTGAAGG + Intergenic
1100544325 12:95586827-95586849 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1100545254 12:95596278-95596300 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1100924040 12:99523673-99523695 CTGTGGTCCCAGCTATTGGGAGG - Intronic
1101034752 12:100694453-100694475 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1101118469 12:101554689-101554711 CTGTAATCCCAGACTTTGGAAGG + Intergenic
1101550149 12:105754035-105754057 CTGTAATCTCAGATCTCTGATGG - Intergenic
1101746470 12:107545364-107545386 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1101762408 12:107669672-107669694 CTGTAGTCTGAGATATTGGGAGG + Intergenic
1101907105 12:108835316-108835338 CTGTAATCCCAGCTATTGGGAGG + Intronic
1101960146 12:109242841-109242863 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1102091858 12:110197074-110197096 CTATAGTCTTAGCTATTGGGAGG + Intronic
1102144949 12:110648091-110648113 CTGTAGTCCCAGCTATTAGGAGG - Intronic
1102250676 12:111385091-111385113 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1102285009 12:111648802-111648824 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1102291834 12:111707209-111707231 CTGTAGTCTCAGCTACTAGGAGG - Intronic
1102596720 12:113998494-113998516 CTGTAGTCTCAGCTACTCGGGGG + Intergenic
1102631509 12:114284893-114284915 CTGTAGTCCCAGCTATTTGAGGG - Intergenic
1102776902 12:115527810-115527832 CTGTAGTCTCAGCTACTAGGGGG - Intergenic
1102808060 12:115799527-115799549 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1102941636 12:116947615-116947637 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1102990644 12:117313415-117313437 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1102992328 12:117324030-117324052 CTGTACTCCCACATCTTGGAAGG - Intronic
1103078253 12:118002852-118002874 CTGTAATCCCAGATTTTGGGAGG - Intergenic
1103263252 12:119607735-119607757 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1103365101 12:120376420-120376442 CTGTAGTCGCAGCTATTTGGGGG - Intergenic
1103383696 12:120514913-120514935 CTGTAATCCCAGCTATTTGAAGG - Intronic
1103798624 12:123522713-123522735 CTGTAGTCTGAGCTACTTGAAGG - Intronic
1103799051 12:123525337-123525359 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1103849424 12:123922248-123922270 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1104326794 12:127806293-127806315 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1104410057 12:128550425-128550447 CTGTAGTCTCAGCTACTTGGCGG - Intronic
1104678679 12:130733349-130733371 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1105009926 12:132748809-132748831 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1105043793 12:132985327-132985349 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1105057152 12:133112441-133112463 CTGTAGTCCCAGCTACTGGGAGG - Exonic
1105301731 13:19141434-19141456 CTGTAGTCCCAGATATTTGGAGG + Intergenic
1105752632 13:23435389-23435411 CTGTAATCTCAGATACTTGGAGG + Intergenic
1105838588 13:24232669-24232691 CTGTAGTCCCAGCTACTGGGTGG - Intronic
1105866587 13:24466302-24466324 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1106202419 13:27551163-27551185 CTGTAGTCCCAGTTACTGGGAGG + Intronic
1106244230 13:27933621-27933643 CTGTAGTCTCAGCTACTTGTGGG - Intergenic
1106521431 13:30501076-30501098 CTGTAATCTCACATTTTGGGAGG - Intronic
1106820276 13:33456739-33456761 CTGTATTCCCACATAGTGGAAGG - Intergenic
1106833189 13:33607417-33607439 CTGTAGTCCCAGATACTTGGAGG - Intergenic
1107031906 13:35861908-35861930 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1107507762 13:41052060-41052082 CTGTAATCTCAGCTACTTGAAGG - Intronic
1107855637 13:44612955-44612977 CTGTAGTCCCAGTTACTTGAGGG - Intergenic
1108030992 13:46229662-46229684 CTGTAGTCTCAGTTCTTGAGAGG + Intronic
1108035469 13:46285943-46285965 CTGTAGTCCCAGATATTTGTGGG + Intergenic
1108320187 13:49281934-49281956 CTGTAATCCCAGATACTGGGGGG - Intronic
1108334729 13:49427883-49427905 CTGTATCCTCACATAGTGGAAGG + Intronic
1108352702 13:49601776-49601798 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1108699903 13:52934758-52934780 CTGTAATCCCAGCTACTGGAAGG + Intergenic
1108729781 13:53222870-53222892 CTGTTGTCTCTGATATAGGATGG + Intergenic
1108890367 13:55250992-55251014 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1109801909 13:67390910-67390932 CTGTAATCCCAGCTATTTGAGGG - Intergenic
1109837639 13:67879395-67879417 CTGTAACCTCACATGTTGGAGGG + Intergenic
1109839619 13:67904944-67904966 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
1110073458 13:71208555-71208577 CTGTAGTCTCAGCTACTCGCGGG - Intergenic
1110903861 13:80860875-80860897 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1111124614 13:83898218-83898240 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1111507153 13:89207234-89207256 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1112547271 13:100383111-100383133 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1112657460 13:101467038-101467060 CTGTATCCTCACATGTTGGAAGG + Intronic
1112781979 13:102910883-102910905 CTGTAGTCCCAACTATTGGGAGG + Intergenic
1113181339 13:107631117-107631139 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1113502758 13:110790765-110790787 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1113827167 13:113265291-113265313 CTGTAGTCCCAGCTATGGGAGGG + Intronic
1114311471 14:21471493-21471515 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1114541560 14:23464074-23464096 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1114547079 14:23510921-23510943 CTGTAGTCTCAGCTACTTGGAGG + Intergenic
1114552350 14:23540111-23540133 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1114779784 14:25525737-25525759 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1115215256 14:31007781-31007803 CTATAGTCTCAGCTATGGGGAGG + Intronic
1115467441 14:33731169-33731191 CTGTAATCTCAGCACTTGGAGGG + Intronic
1115608150 14:35026348-35026370 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1115652413 14:35412320-35412342 CTGTAATCCCAGATTTTGGGAGG - Intergenic
1115669173 14:35589820-35589842 CTGTAGTCCCAGCTATTTGGAGG - Intronic
1115683298 14:35766096-35766118 CTTTAGGATCAGATACTGGAGGG + Intronic
1115825249 14:37264503-37264525 CTGTAGTCTCAACTATTCGGGGG + Intronic
1115976932 14:39007082-39007104 CTGTAGTCCCAGTTACTGGGAGG - Intergenic
1115998794 14:39220642-39220664 CTGTAGTCTCAGATACTTGGAGG - Intergenic
1116441220 14:44955661-44955683 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1116791367 14:49343607-49343629 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1116813748 14:49564789-49564811 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1116874906 14:50101318-50101340 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1116888251 14:50241452-50241474 CTGTAGTCTCAGCTATTCAGGGG + Intronic
1116911754 14:50474265-50474287 CTGTAGTCTCAGCTATTTCGGGG + Intronic
1117039822 14:51759709-51759731 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
1117114276 14:52493901-52493923 CTGTAGTCCCAGCTATTTGGTGG - Intronic
1117243147 14:53855909-53855931 CTGTAGTCTCAGTTACTCCAGGG + Intergenic
1117392370 14:55273926-55273948 CGGTAGTCCCAGCTATTCGAGGG - Intronic
1117423827 14:55575099-55575121 CTGTAGTCCCAGCTATTTGAGGG + Intronic
1117459467 14:55930631-55930653 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1117553653 14:56862207-56862229 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1117695527 14:58358343-58358365 CTGTAATCCCAGATATTGGGAGG + Intronic
1117700647 14:58409986-58410008 CTGTAGTCTCAGCTACTCCAGGG - Intronic
1117766195 14:59085812-59085834 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1117800974 14:59444681-59444703 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1117863031 14:60113057-60113079 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1118197164 14:63638065-63638087 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1118266451 14:64299480-64299502 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1118344602 14:64928368-64928390 CTGTAGTCTCAGCTACTCGAGGG - Intronic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1118658467 14:67980320-67980342 CTGTAATCCCAGTTATGGGAAGG + Intronic
1118672932 14:68149865-68149887 TTGTAGTCCCAGCTATTGGGAGG - Intronic
1118830046 14:69422342-69422364 CTGTTGTCCCAGATATGGGGAGG - Intronic
1118948382 14:70410299-70410321 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1119065411 14:71520873-71520895 CTGTAGTCTCAGCTACTCGGGGG - Intronic
1119079222 14:71676169-71676191 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1119112455 14:71987640-71987662 CTGTAGTCCCAGCTATGGGAAGG - Intronic
1119241907 14:73067525-73067547 CTGTAGTCCCAGCTCTTGGGAGG - Intronic
1119363658 14:74072920-74072942 CTGTAATCTCAGCTACTCGAAGG - Intronic
1119444389 14:74651219-74651241 CTGTAGTCTCAGCACTTGGGAGG - Intergenic
1119452535 14:74724405-74724427 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1119657968 14:76431037-76431059 CTGTAATCCCACATTTTGGAAGG + Intronic
1119933490 14:78569680-78569702 CTGTAGTCTCAGCTACTTGAAGG - Intronic
1120207793 14:81604675-81604697 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1120290421 14:82563149-82563171 CTGGAGTCCTAGATATTGGCAGG - Intergenic
1120527176 14:85590718-85590740 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1120583052 14:86278036-86278058 CTGTAATCCCAGCTATTGCAGGG + Intergenic
1120713676 14:87818168-87818190 CTGTATTCTCACATGATGGATGG - Intergenic
1120787028 14:88547529-88547551 CTGTAGTCCCAGCTCTTGGCAGG + Intronic
1120931809 14:89856309-89856331 CTGTAGTCCCAGTTATTTGGGGG - Intronic
1120994931 14:90409872-90409894 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1121041079 14:90748448-90748470 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1121202840 14:92133579-92133601 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1121300649 14:92867971-92867993 CTGTATCCTCACATGTTGGAAGG + Intergenic
1121726287 14:96153433-96153455 CTGTAATCTCAGCTAGTTGAGGG - Intergenic
1121751268 14:96359247-96359269 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1122002948 14:98678710-98678732 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1122213859 14:100190789-100190811 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1122383523 14:101328090-101328112 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1122481643 14:102051132-102051154 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1122668403 14:103351153-103351175 CTGTAGTCCCAGATACTTGGGGG + Intergenic
1122728746 14:103779164-103779186 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1123046920 14:105522088-105522110 CTGTAGTCACAGCTATTTGGGGG - Intergenic
1123051210 14:105544786-105544808 CTGTAGTCTTAGCTACTGGGAGG - Intergenic
1123174995 14:106408520-106408542 CTGTATTCCCAGATACTGGGAGG + Intergenic
1202905178 14_GL000194v1_random:67514-67536 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1202943687 14_KI270726v1_random:7261-7283 CTGTATTCCCAGATACTGGGAGG - Intergenic
1123679960 15:22755938-22755960 CTGTAGTCCCAGCTACTCGAAGG - Intergenic
1123916927 15:25040499-25040521 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
1123985632 15:25643608-25643630 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1124603973 15:31157032-31157054 CTGTAGTCCCAGGTATTAGGAGG - Intronic
1125064098 15:35461204-35461226 CTGTAGTCCCAGCTATTCGAAGG - Intronic
1125440777 15:39701027-39701049 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1125480603 15:40077128-40077150 CTGTAGTCCCAGATACTTGGCGG + Intergenic
1125583230 15:40802290-40802312 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1125640051 15:41223070-41223092 CTGTAGTCTCAGCTATTCGGAGG - Intronic
1125647321 15:41283514-41283536 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1125800620 15:42443605-42443627 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1125850299 15:42896669-42896691 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1125924728 15:43553463-43553485 CTGTAGTCCCAGCTATCCGAGGG - Intronic
1126040021 15:44581327-44581349 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1126077334 15:44923895-44923917 CTGTAGTCCCAGCTATTTGGAGG - Intergenic
1126414917 15:48407448-48407470 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1126574871 15:50186558-50186580 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1126608260 15:50502753-50502775 CTGTAGTCCCAGCTATTTGGGGG - Exonic
1126733714 15:51710706-51710728 CTGTAGTCCCAGCTATTAGGAGG - Intronic
1126766461 15:52015932-52015954 CTGTAATCCCAGCTACTGGAAGG + Intronic
1127067904 15:55259405-55259427 TTGTAGTCCCAGTTATTGGGAGG - Intronic
1127243673 15:57147999-57148021 CTGTACTCCCAGCTATTCGAAGG - Intronic
1127243707 15:57148307-57148329 CTGTAGTCCCAGCTGTTTGAAGG + Intronic
1127290642 15:57567642-57567664 CTGTAGTCTCAGCTACTCGTGGG - Intergenic
1127332393 15:57951752-57951774 CTGTAGTCAGAGAAATAGGAGGG - Intergenic
1127435216 15:58950567-58950589 CTGTAGTCCCAGCTATCGGTGGG - Intronic
1127449616 15:59103932-59103954 CTGTAGTCCCAGGTACTGGGAGG - Intergenic
1127457508 15:59168421-59168443 CTGTAGTCTCAGATACTTAGGGG + Intronic
1127603273 15:60560574-60560596 CTGTAGTCTCGGCTACTGGTCGG + Intronic
1127786622 15:62361165-62361187 CTGTAATCTCAGCTATTGGGAGG - Intergenic
1128024925 15:64427495-64427517 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1128165140 15:65457484-65457506 CTGTAGTCCCAGCTACTTGAAGG - Intronic
1128198024 15:65777910-65777932 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1128295801 15:66518401-66518423 CTGTAGTCCCAGTTACTGGGAGG - Intronic
1128655293 15:69456718-69456740 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1128831673 15:70774930-70774952 CTGTAGTCCCAGCTACTGGTCGG + Intergenic
1128878974 15:71225663-71225685 CTGTAGTCCCAGCTATAGGCTGG - Intronic
1129089841 15:73137617-73137639 CTGTAGTCTCAGCTACTTGTGGG - Intronic
1129250193 15:74304458-74304480 CTTTAGTCTCAGGTGATGGATGG - Intronic
1129395542 15:75243435-75243457 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1129438513 15:75561478-75561500 CTGTTGTCCCAGATATTGATAGG + Intronic
1129493451 15:75952677-75952699 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1129525833 15:76213684-76213706 CTGTACTCTCAGAGTCTGGAAGG + Intronic
1129556946 15:76520338-76520360 CTGTAGTCCCAGCTACTCGAAGG - Intronic
1129559530 15:76552158-76552180 CTGTAGTCCCAGCTATTAGGTGG + Intronic
1129596857 15:76971826-76971848 CTGTAATCCCAGAAATTGGTAGG - Intergenic
1129639418 15:77359315-77359337 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1129774495 15:78227095-78227117 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1129850929 15:78793483-78793505 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1130077524 15:80702240-80702262 CTGTAGTCTCAGTTACTGGGAGG + Intronic
1130251455 15:82302582-82302604 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1130405030 15:83591806-83591828 CTGTAGTCTCAGCTACTCGGGGG - Intronic
1130544700 15:84846561-84846583 CTGTAGTCTGAGCTATTTGCAGG + Intronic
1130844477 15:87731929-87731951 CTGTTGACTCGGATACTGGATGG + Intergenic
1130978361 15:88794649-88794671 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1130983940 15:88832486-88832508 CTGTAGTCTCAACTACTCGATGG + Intronic
1131227174 15:90634368-90634390 CTGTAATCTCAGACTTTGGGAGG - Intronic
1131544774 15:93306896-93306918 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1131698356 15:94904545-94904567 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1132129363 15:99261506-99261528 CTGTATTCTCACATGGTGGAAGG + Intronic
1132980033 16:2733560-2733582 CTGTAGTCTCAGCTACTGGGAGG + Intergenic
1133048840 16:3105270-3105292 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1133124223 16:3634630-3634652 CTGTCGTCTCAGCTACTTGAGGG - Intronic
1133125592 16:3643881-3643903 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1133389680 16:5399608-5399630 CTGTAGTCCCAGCTACTGAAAGG + Intergenic
1133836887 16:9375408-9375430 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1133890514 16:9874963-9874985 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1133928098 16:10210076-10210098 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1133950925 16:10391772-10391794 CTGTAGTCCCAGCTGCTGGAGGG + Intronic
1134030303 16:10986973-10986995 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1134040487 16:11064652-11064674 CTGTAGTCCCAGATACTTGAGGG + Intronic
1134182463 16:12058913-12058935 CTGTAGACCCAGCTACTGGAGGG - Intronic
1134383991 16:13754999-13755021 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1134467200 16:14490033-14490055 CTGTAGTCCCAGATACTTGGAGG + Intronic
1135005229 16:18814973-18814995 CTGTAATCTCAGCTACTTGAAGG - Intronic
1135075330 16:19388413-19388435 CTGCAATCTCAGCTATTCGAGGG + Intergenic
1135321030 16:21496536-21496558 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1135344304 16:21675411-21675433 CTGTAATCCCACATTTTGGAAGG - Intergenic
1135373864 16:21928038-21928060 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1135437922 16:22442683-22442705 CTGTGGTCCCAGCTATTGGGAGG - Intergenic
1135485218 16:22859041-22859063 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1135489501 16:22896928-22896950 CTGTAGTCTCAGCTACTTGATGG - Intronic
1135541777 16:23335567-23335589 CTGTAATCCCAGCTATTGGGAGG - Intronic
1135549531 16:23387616-23387638 CTGCAGTCTCAGCTATTTAACGG + Intergenic
1135678199 16:24435195-24435217 CTGTATTCCCAGCTATCGGAGGG + Intergenic
1135699964 16:24623778-24623800 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
1135702643 16:24645894-24645916 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1135758502 16:25117728-25117750 CTGTAATCTCAGCTATTGGGAGG + Intronic
1135794084 16:25424803-25424825 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1136108122 16:28045550-28045572 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1136119571 16:28123226-28123248 CTGTAGTCCCCGCTATGGGAGGG - Intronic
1136136855 16:28261505-28261527 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1136253828 16:29025003-29025025 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1136332511 16:29589644-29589666 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1136447205 16:30329740-30329762 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1136458703 16:30396809-30396831 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1136514237 16:30758192-30758214 CTGTAGTCCCAGCTACTGGGAGG - Exonic
1136598272 16:31266462-31266484 CTGTAGTCTTAGCTATTTGGAGG + Intronic
1136668318 16:31834132-31834154 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1137320115 16:47372033-47372055 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1137320254 16:47373402-47373424 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1137631717 16:49951061-49951083 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1137824153 16:51475216-51475238 CTGTAGTCTCAGCTATTCCAGGG - Intergenic
1137833716 16:51570048-51570070 CTATAGTCTCTGATTTTGCAGGG - Intergenic
1137902873 16:52288044-52288066 CTGAAGACCCAGAAATTGGATGG + Intergenic
1137916195 16:52432900-52432922 ATGTGGTCTCAGAAATTGAATGG + Intergenic
1137990866 16:53153649-53153671 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1138027780 16:53536167-53536189 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1138089116 16:54159603-54159625 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1138089181 16:54160325-54160347 TTGTAGTCCCAGCTATTGGGAGG - Intergenic
1138186023 16:54978255-54978277 CTGAAGACTCAGATATTAGCAGG + Intergenic
1138241519 16:55431186-55431208 CTGTAATCCCAGCTATTGGAAGG - Intronic
1138424257 16:56920109-56920131 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1138437032 16:57007605-57007627 CTGTAATCCCAGCTATTGGGAGG + Intronic
1138672545 16:58627281-58627303 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1138876033 16:60951062-60951084 CTGTAGTCCCAGCTATTCAAGGG - Intergenic
1139082934 16:63547623-63547645 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1139451625 16:67031946-67031968 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1139540225 16:67609743-67609765 CTGTAGTCCCAGCTCTTGGGAGG - Intronic
1139553093 16:67687023-67687045 CTGTATTCTCAGCTACTCGAGGG + Intronic
1139699692 16:68700474-68700496 CTGAAGCCTCAGACTTTGGATGG + Intronic
1139708932 16:68761539-68761561 TTGTATTCTCAGGTATTGCAGGG + Intronic
1139845732 16:69919914-69919936 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1139890271 16:70248715-70248737 CTGTAGTCCCAGCTACTTGAAGG - Exonic
1139892647 16:70263757-70263779 CTGTAGTCCCAGCTATTTGTGGG - Intronic
1139930309 16:70521008-70521030 CTATAGTCACAGATATTTGGGGG - Intronic
1140077498 16:71715235-71715257 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1140082204 16:71759336-71759358 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1140161642 16:72501828-72501850 CTGTACTCTCCGACAGTGGATGG + Intergenic
1140351433 16:74265680-74265702 CTCTAGTCTCTGATATTTAAAGG - Intergenic
1140764499 16:78144641-78144663 CTGTAATCCCAGCTATTGGGAGG - Intronic
1140871028 16:79106738-79106760 CTGTAGTCTCAGTTACTCGGAGG - Intronic
1140936783 16:79678692-79678714 CTGTAATCTCAGCTATCGGGAGG - Intergenic
1141198787 16:81881764-81881786 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1141269676 16:82527839-82527861 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1141386588 16:83627165-83627187 CTGTAGTCTCAGCTACTGGAGGG + Intronic
1141536405 16:84684038-84684060 CTGTAGTCTCAGCTATGGGGAGG + Intergenic
1141973786 16:87500489-87500511 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1142386449 16:89768154-89768176 CTGTGGTCTCAGCTACTGGGAGG + Intronic
1142470191 17:158920-158942 CTGTAATCCCAGCTATTGGGAGG + Intronic
1142726011 17:1814699-1814721 TTGTAGTCTCAGCTATTGGGAGG + Intronic
1142857649 17:2740842-2740864 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1143132155 17:4685668-4685690 CTGTAGTCCCAGCTATTGGTGGG + Intronic
1143219370 17:5248705-5248727 CTATAGTCCCAGCTATTGGGAGG - Intergenic
1143444753 17:7001067-7001089 CTGTGGTCCCAGCTACTGGAGGG - Intronic
1143549838 17:7623578-7623600 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1143552518 17:7639698-7639720 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1143574604 17:7783673-7783695 TTGTAGTCTCAGCTATTGGGAGG + Intronic
1143933370 17:10455570-10455592 GTGTAGACTAAGACATTGGAAGG + Intronic
1143974042 17:10816873-10816895 CTGCAGCCTCAGAGATAGGAGGG + Intergenic
1144008186 17:11120247-11120269 CTGTAATCTCAGCTATTCGGGGG + Intergenic
1144548799 17:16221407-16221429 CTATAGTCTCAACTATTGGTAGG - Intronic
1144583800 17:16475693-16475715 CTGTAGTCTCAGCTATTCAGGGG - Intronic
1144711243 17:17403051-17403073 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1144820981 17:18074198-18074220 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1145073197 17:19829412-19829434 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1145189507 17:20826713-20826735 CTGCAGTCCCAGATATTGGAGGG + Intergenic
1145225936 17:21128156-21128178 CTGTAGTCCCAGCTATTTGTTGG + Intronic
1146106655 17:30044452-30044474 CTGTAATCTCAGCTACTGGGTGG + Intronic
1146179793 17:30690416-30690438 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1146408166 17:32557627-32557649 CTGTAGTCCCAGCTACTGGATGG - Intronic
1146576504 17:33997261-33997283 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1146682615 17:34819019-34819041 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1146755125 17:35423861-35423883 CTGTGTTCTCACATAGTGGAAGG - Intronic
1146756409 17:35435384-35435406 CTGTAGTCCCAGCTACTGGGAGG - Exonic
1146966413 17:37035000-37035022 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1146982726 17:37181025-37181047 CTGCCAACTCAGATATTGGATGG - Intronic
1147048373 17:37771788-37771810 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1147117246 17:38310449-38310471 CTGTAGTCTCAGCTACTCCAGGG - Intronic
1147270132 17:39263391-39263413 CTGTAGTCTCAGCTGTTGGGAGG + Intronic
1147279402 17:39346210-39346232 CTGTAGTCCCAGCTATTTGGTGG + Intronic
1147407194 17:40220516-40220538 CTGTGGTCCCAGCTATTGGCGGG - Intronic
1147430963 17:40370489-40370511 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1147728901 17:42584683-42584705 CTGTAGTCCCAGCTACTGAAGGG + Intronic
1147796632 17:43048323-43048345 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1148036906 17:44670659-44670681 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1148057678 17:44810894-44810916 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1148162755 17:45460678-45460700 CTGTAGTCTCAGCTATTCAGTGG - Intronic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148272231 17:46270782-46270804 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148446428 17:47740606-47740628 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
1148490632 17:48021847-48021869 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1148840445 17:50492705-50492727 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1148997925 17:51728006-51728028 CTGTAGTCTCAGCTACTCAAGGG - Intronic
1149364195 17:55924363-55924385 CTGTAGTCTTAGCTACTTGAGGG - Intergenic
1149828234 17:59848975-59848997 CTGTAGTCCCAGCTACTGGTGGG - Intergenic
1149971543 17:61223277-61223299 CTGTAATCCCAGCTATTGGGGGG - Intronic
1150077394 17:62204219-62204241 CTGCAGTCCCAGATACTGGAGGG - Intergenic
1150090125 17:62316504-62316526 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1150304522 17:64073125-64073147 CTGTAGTCTCAACTATGGGGAGG - Intronic
1150362732 17:64551238-64551260 TTGTAGTCTCAGCTACTTGAGGG + Intronic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1150636106 17:66914419-66914441 CTGTAGTCTCAGCTACTTTAGGG - Intergenic
1150704803 17:67477196-67477218 CTGTAGTCTCAGGTACTTGGGGG - Intronic
1150793038 17:68214904-68214926 CTGTAGTCCCAGCTATTTGCGGG - Intergenic
1151328356 17:73392389-73392411 CTGTAGTCTCAGCTACTGGGAGG - Intronic
1151446651 17:74170329-74170351 CTGTAATCTCAGCAATTTGAAGG - Intergenic
1151484896 17:74392750-74392772 CTGTAGTCCCAGCTCTTGGGAGG + Intergenic
1151621863 17:75250638-75250660 CTGTAATCTCAGCTACTTGAAGG + Intronic
1151640586 17:75389721-75389743 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1151670570 17:75569679-75569701 CTGTAATCCCAGCTACTGGAAGG + Intronic
1151800902 17:76379122-76379144 CTGTAGTCTCAGCTACTAAAGGG + Intronic
1151845163 17:76648576-76648598 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1152086333 17:78221371-78221393 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1152127761 17:78457614-78457636 CTGTAGTCCCAGCACTTGGAGGG - Intronic
1152255160 17:79234851-79234873 CTGTAGTCCCAGCTACTGGTAGG - Intronic
1152478047 17:80531251-80531273 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1152791093 17:82280323-82280345 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
1153243027 18:3047813-3047835 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
1153274787 18:3357671-3357693 CTGTAGTCTCAGCTACTCGGGGG + Intergenic
1153495366 18:5692846-5692868 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1153672637 18:7427135-7427157 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1153788704 18:8557838-8557860 CTGTAGTCCCAGCTATTTGTGGG - Intergenic
1153858309 18:9173324-9173346 CTGTAATCTCAGACTTTGGGAGG - Intronic
1154222921 18:12472780-12472802 CTGTAGTCCTAGCTACTGGAAGG - Intronic
1154243697 18:12676395-12676417 CTGTAGTCCCAGATACTCGGAGG - Intronic
1155028894 18:21967095-21967117 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1155097633 18:22574102-22574124 CTGTAGTCTTAGCTATTTGGGGG + Intergenic
1155135497 18:22987574-22987596 CTGTAGTCTCAGCTTCTTGAGGG - Intronic
1155158022 18:23173839-23173861 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1155434793 18:25801185-25801207 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1155471617 18:26197627-26197649 CTGTAGTCCCAGGTATTTGGGGG + Intergenic
1155563074 18:27101468-27101490 CTGTAGTCCCAGCTACTGGCGGG + Intronic
1155631226 18:27895914-27895936 CTGTAATCTCTGATATTAGAAGG - Intergenic
1155707624 18:28836916-28836938 CTGTAGTCTCACTTACTTGAGGG + Intergenic
1155757722 18:29522614-29522636 CTGTAGTCCCAGATACTCCAGGG - Intergenic
1155836751 18:30594960-30594982 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1156383472 18:36584682-36584704 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1156842764 18:41628905-41628927 CTGTAGTCCCAGCTATTCCAGGG - Intergenic
1157088125 18:44603461-44603483 CTGTGGTATCAGCTATTGGGAGG - Intergenic
1157264967 18:46210785-46210807 CTGTAGTCTCAGCTACTTGAGGG + Intronic
1157369433 18:47096995-47097017 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1157863749 18:51163791-51163813 CTGTAGTCTCAGCTACTTGGAGG - Intergenic
1158361287 18:56676830-56676852 CTGTAGTCCCAGATACTTGGAGG - Intronic
1158612143 18:58951076-58951098 CTGTAGTCTCAGCTATTCGGGGG - Intronic
1158637208 18:59170595-59170617 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1159036373 18:63281542-63281564 CTGTAGTCTCAGCTACTTGCAGG + Intronic
1159208992 18:65291613-65291635 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1159341592 18:67141057-67141079 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1159441366 18:68484859-68484881 CTGTAGTCTCAGCTTCTTGAGGG + Intergenic
1159502756 18:69295017-69295039 CTGTGTCCTCACATATTGGAAGG + Intergenic
1159963317 18:74572663-74572685 CTGTAGTCCCAGCTATTTAAGGG + Intronic
1160187445 18:76686636-76686658 CTGTGGTCCCAGCTACTGGAAGG - Intergenic
1160800914 19:968235-968257 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1161692870 19:5747294-5747316 CTGTAGTCCCAGTTACTGGGAGG - Intronic
1161756397 19:6137332-6137354 CTGTAGTCCCAGCTATCTGAGGG + Intronic
1161909046 19:7179031-7179053 CTGTAGTCCCAGGTACTTGAGGG - Intronic
1162081723 19:8222001-8222023 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1162216395 19:9137461-9137483 CTGTAGTCCCAGATACTTGGGGG + Intergenic
1162417719 19:10548150-10548172 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1162437044 19:10667375-10667397 CTGTAGTCCCAGCTATAGGGAGG - Intronic
1162492352 19:11000754-11000776 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1162513968 19:11137335-11137357 CTGTAGTCCCAGATACTTGGAGG + Intronic
1162517930 19:11160954-11160976 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1162543208 19:11310958-11310980 CTGTAGTCCCAGATACTTGGGGG - Intronic
1162568838 19:11459068-11459090 CTGTAGTCTCAGCTACTTGCGGG - Intronic
1162729290 19:12708252-12708274 CTGTAGTCCTAGCTATTGGGAGG - Intronic
1162740952 19:12773369-12773391 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1162773894 19:12967114-12967136 CTGTAGTCTCAGCTATTCGGTGG + Intronic
1162842380 19:13365788-13365810 CTGTAGTCCTAGCTATTGCAGGG - Intronic
1162890955 19:13732729-13732751 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1162978817 19:14225146-14225168 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1162984749 19:14262477-14262499 CTGTAATCCCAGATACTTGAGGG - Intergenic
1163001078 19:14367674-14367696 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1163014946 19:14449060-14449082 CTGTAGTCCCAGCTATTAGAAGG - Intronic
1163206877 19:15809937-15809959 CTGTAGTCCCAGCTATTTAAGGG - Intergenic
1163410542 19:17151154-17151176 CTGTAATCTCAGCTACTGGAAGG + Intronic
1163465355 19:17465054-17465076 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1163532245 19:17856964-17856986 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1163744481 19:19037061-19037083 CTGTAGTCTCAGCTACTTGGAGG + Intronic
1163937998 19:20467652-20467674 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1164043471 19:21512991-21513013 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1164393874 19:27847261-27847283 CTGTAGTTCCAGCTACTGGAGGG - Intergenic
1164521386 19:28982753-28982775 CTGTAGTCACAGCTATTCGGGGG + Intergenic
1164641763 19:29831492-29831514 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1164930252 19:32169834-32169856 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1164934095 19:32197730-32197752 CTGTAGTCTCAGCTACTCGAGGG - Intergenic
1164949082 19:32321244-32321266 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1164975249 19:32568227-32568249 CTGTAGTCTCAGATACTCGGGGG - Intergenic
1165055092 19:33170737-33170759 CTGTAGTCCCAGCTATTCGGGGG + Intronic
1165196349 19:34107047-34107069 CTGTAGTCTCAGCTACTTGCAGG - Intergenic
1165336913 19:35177119-35177141 CTGTGGTCCCAGCTATTTGAGGG + Intergenic
1165368468 19:35385794-35385816 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1165492073 19:36129566-36129588 CTGTAGTCTCAGCTATTCATGGG - Intergenic
1165598506 19:37032215-37032237 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1165737788 19:38187872-38187894 CTGTAGTCTCAGCTATTGGGAGG + Intronic
1165760367 19:38317699-38317721 CTGTAATCTCAGCTATCGGGAGG - Intergenic
1165842013 19:38793844-38793866 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1165871751 19:38977806-38977828 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1165880404 19:39038616-39038638 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1166000401 19:39874177-39874199 CTGTAGTCCCAGATACTCGGGGG - Intronic
1166076012 19:40414244-40414266 CTGTGGTCCCAGCTATTTGAGGG - Intergenic
1166082035 19:40450073-40450095 CTGTAGTCCCAGCTATTCGGGGG + Intronic
1166134967 19:40770676-40770698 CTGTAGTCTCAGCTACTTGGAGG + Intergenic
1166312953 19:41973376-41973398 CTGTAGTCTCAGAGACTTGGGGG - Intronic
1166513087 19:43424110-43424132 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
1166529073 19:43531902-43531924 CTGTAGTCCCAGCTATTTCACGG - Intronic
1166533685 19:43558210-43558232 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1166578511 19:43868202-43868224 CTGTAATCTCAGCATTTGGAAGG - Intergenic
1166697427 19:44860388-44860410 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1167168319 19:47814176-47814198 CTGTATTCCCAGCTATTGGGAGG - Intronic
1167255893 19:48428483-48428505 CTGTAATCTCAGCTACAGGAGGG - Intronic
1167268419 19:48494448-48494470 CTGTAGTCCCAGCTATTCGGTGG - Intronic
1167512617 19:49903959-49903981 CTGTAGTTTCAGATACTTGGAGG - Intronic
1167655302 19:50759770-50759792 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1167787549 19:51647980-51648002 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1167841929 19:52129153-52129175 CTGTAATCCCAGCTATTGGGAGG + Intronic
1167932278 19:52875656-52875678 CTGTGGTCTCAGCCATTTGAGGG + Intronic
1167950988 19:53027640-53027662 CTGTAATCACAGCTATTGGGAGG - Intergenic
1168013384 19:53552608-53552630 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
1168385569 19:55960294-55960316 CTGTTCACTCAGATATTGAATGG + Intronic
1168471631 19:56644879-56644901 CTGTAGTCTCAGATATTGGAAGG - Intronic
1168555622 19:57337201-57337223 CTGTAGTCCCAGTTACTGAAAGG - Intergenic
1168607852 19:57774092-57774114 CTGTAATCCCAGATATTCGGGGG + Intronic
1168704064 19:58458288-58458310 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1168708845 19:58486213-58486235 CTGTAGTCTCAGCTATCGGGAGG - Intronic
925684134 2:6453631-6453653 CTGTAGTCCCAGATACTTGGAGG + Intergenic
925981832 2:9183354-9183376 CTGTGGTCCCAGATATTTGGGGG + Intergenic
926178281 2:10616669-10616691 CTGTAGTCCCAGCTACTTGAAGG - Intronic
926181683 2:10650281-10650303 CTGTAGTCCCAGATACTCTAAGG - Intronic
926262612 2:11280506-11280528 CTGTAGTCTCAGCTACTAGGAGG + Intronic
926497849 2:13613991-13614013 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
926770775 2:16373025-16373047 CTGTAGTCCCAGCTACTGCAGGG - Intergenic
927221802 2:20717906-20717928 CTGTAGTCCCAGCTAATTGAAGG - Intronic
927344674 2:22024270-22024292 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
927368524 2:22327486-22327508 CTGTAGTCCCAGCTATTGGGAGG + Intergenic
927375018 2:22403527-22403549 CTGTAGTCCCAACTATTGGGAGG - Intergenic
927664231 2:25018616-25018638 CTGTAGTCCCATCTACTGGAGGG - Intergenic
927734007 2:25502059-25502081 CTGTGGTCTCAGCTATTTGTGGG + Intronic
927755402 2:25704581-25704603 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
927952040 2:27177572-27177594 CTGTAGTCCCAGGTACAGGAGGG - Intergenic
928036246 2:27826529-27826551 CTGTAGTCTCAGCTACTTGGGGG - Intronic
928041681 2:27884367-27884389 CTGTAGTCCCAGCTACTGGGGGG - Intronic
928168691 2:28989519-28989541 CTGTAGTCTCAGTTACTTGGGGG - Intronic
928307623 2:30183495-30183517 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
928519940 2:32078958-32078980 CTGTAGTCCCAGCTACTTGAGGG - Intronic
928538834 2:32265301-32265323 CTGTAGTCTTAGCTACTGGGAGG - Intronic
928577504 2:32669998-32670020 CTGTAGTCTCAGCTACTCGGAGG - Intronic
928579076 2:32687099-32687121 CTGTAATCTCAGACTTTGGGAGG - Intronic
928639283 2:33280947-33280969 CTGTAATCTCAGCTACTTGAAGG + Intronic
928678707 2:33676996-33677018 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
928706008 2:33950456-33950478 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
928773500 2:34730972-34730994 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
928775618 2:34759670-34759692 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
928798990 2:35063891-35063913 CTGTAGTCTCAGCTGTTCGGGGG - Intergenic
929058075 2:37895796-37895818 CTGTAGTCCCAGCTATGGGGAGG + Intergenic
929135304 2:38618222-38618244 CTGTAGTCCCAGCTATTTGGCGG - Intergenic
929212021 2:39367646-39367668 CTGTAGTCCCAGATATTTGGGGG + Intronic
929557665 2:42935697-42935719 CTGTAGTCTCAGCTATATGGGGG + Intergenic
929745806 2:44657075-44657097 CTGTATCCTCAGATATCTGAAGG - Intronic
929981831 2:46688499-46688521 CTATAGTCCCAGCTATTGGGAGG + Intergenic
930009450 2:46924747-46924769 CTGTAGTCCCAGCTATTCCAGGG - Intronic
930142174 2:47963932-47963954 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
930485172 2:52002362-52002384 CTGTGTTCTCACATAGTGGATGG + Intergenic
930704364 2:54489575-54489597 CTGTAATCTCTGTTCTTGGAAGG + Intronic
930824060 2:55677859-55677881 CTGTAGTCCCAGCTACTGGGAGG - Intronic
931331037 2:61283736-61283758 TTGTAGTCCCAGCTATTGGGAGG - Intronic
931359486 2:61566039-61566061 CTGTAATCTCAGCTACTGGGAGG - Intergenic
931469475 2:62524062-62524084 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
931832534 2:66067651-66067673 CTGTAGTCCCAGCTATTTAAGGG - Intergenic
931874699 2:66499085-66499107 CTGTAGCCTCAGATAATCAAAGG + Intronic
931947806 2:67330844-67330866 CCGTAGTCCCAGATCTTGGGAGG + Intergenic
931963961 2:67512981-67513003 CTGTAGTCCCAGCTATTGAGAGG + Intergenic
931987263 2:67754080-67754102 CTGTAACCTCACATAGTGGAAGG - Intergenic
932192720 2:69754515-69754537 CTGTAATCTCAGCTACTGGGAGG - Intronic
932335690 2:70930074-70930096 CTGTAGTCCCAGAACTTGGGAGG + Intronic
932350980 2:71031666-71031688 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
932634853 2:73379197-73379219 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
933425088 2:82100563-82100585 CTGTAGTCACAGCTATTACATGG + Intergenic
933563995 2:83926883-83926905 CTGTAGTCTCAGCACTTAGAAGG - Intergenic
933736045 2:85495169-85495191 CTGTAGTCTCAGCTACTTGCGGG - Intergenic
933873453 2:86593910-86593932 CTGTAGTCCCAGATACTTGTGGG - Intronic
933881160 2:86671236-86671258 CTGTAATCCCAGCTATTGGGAGG + Intronic
934090467 2:88546395-88546417 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
934504976 2:94883017-94883039 CTGTAGTCCCAGCTATGGGGGGG - Intergenic
934754931 2:96818205-96818227 CTGTAGTCCCAGCTACTCGAAGG - Intronic
934757658 2:96835588-96835610 CTGTAGTCCCAGCTATGGGGAGG - Intronic
934869339 2:97847054-97847076 CTGTAGTCCCAGCTACTGGGGGG + Intronic
935464689 2:103382386-103382408 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
935513123 2:104001047-104001069 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
935677023 2:105603559-105603581 CTGTAATCTTAGATAATTGAGGG - Intergenic
935979389 2:108611754-108611776 CTGTAGTCTCAGCTACTAGGAGG + Intronic
936021743 2:109000402-109000424 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
936066182 2:109334233-109334255 CTGTAGTCTCAGCTACTCGAGGG + Intronic
936067556 2:109343864-109343886 CTGTAGTCTCAGCTATTGGGAGG - Intronic
936162984 2:110098877-110098899 CTGTAGTCTCAGCTACTCGGGGG + Intronic
936374403 2:111928346-111928368 CTGTAGTCCCAGCTATTTGGGGG - Intronic
936434517 2:112492606-112492628 CTGTAGTCCCAGCTACTGGGAGG + Intronic
936614215 2:114032430-114032452 CTGACTTCTCAGAAATTGGATGG + Intergenic
936896372 2:117432506-117432528 CTGTGTCCTCAGATAGTGGAAGG + Intergenic
937294335 2:120800625-120800647 CTGTAGTCCCAGCTACTGGGAGG - Intronic
937626480 2:124049898-124049920 CTGTAATCTCACATGGTGGAGGG + Intronic
937714133 2:125012245-125012267 CTGTATTCTCACATAGTGAAAGG - Intergenic
937873787 2:126804904-126804926 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
937992083 2:127669593-127669615 CTGTAGTCCCAGCTACTGGAGGG + Intronic
938027309 2:127961259-127961281 CTGTAGTCTCAGCTGCTAGAGGG - Intronic
938143664 2:128816278-128816300 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
938205725 2:129421186-129421208 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
938294370 2:130168299-130168321 CTGTAGTCCCAGATACTTGGGGG + Intronic
938417166 2:131113202-131113224 CTGTAGTCCCAGCTACTGGGGGG - Intronic
938462283 2:131505602-131505624 CTGTAGTCCCAGATACTTGGGGG - Intergenic
939153567 2:138500200-138500222 CTGTAGTCCCAGATACTTGGTGG + Intergenic
939366767 2:141243358-141243380 CTGTGGTCTCAGATACTCAAAGG + Intronic
939444670 2:142292923-142292945 CTGTAGTCTCAGTTATTCAGGGG - Intergenic
939795027 2:146632652-146632674 CTGTGTTCTCACATGTTGGAAGG + Intergenic
939916123 2:148046104-148046126 CTGTAGTCCCAGCTACTCGAGGG - Intronic
939953776 2:148507634-148507656 CTGTAGTCCCAGCTACTCGAGGG + Intronic
939984229 2:148814302-148814324 CTGTAGTCCCAGCTACTGGGTGG + Intergenic
940186972 2:150996654-150996676 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
940312182 2:152290648-152290670 CTGTTGTCCCAGATACTTGAGGG + Intergenic
940870510 2:158856308-158856330 CTGTAGTCTCAGCTACTGGGAGG + Intronic
940873214 2:158877435-158877457 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
940877561 2:158913162-158913184 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
941368316 2:164633880-164633902 CTGTAGTCCCAGTTATTTGGGGG - Intergenic
941455156 2:165706380-165706402 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
941616237 2:167723651-167723673 CTGTAGTCCCAGTTACTCGAGGG - Intergenic
941730186 2:168908811-168908833 CTGTAGTCTTAGCTAATGGGAGG - Intronic
942034855 2:172000876-172000898 CTGTAGTCTCAGCTATTCTGGGG + Intronic
942175183 2:173326420-173326442 CTGTAGTCTCAGTTACTTGGGGG + Intergenic
942574039 2:177343925-177343947 CCGTAGTCTCAGCTACTGGGAGG + Intronic
942999931 2:182314302-182314324 CTGTAGTCCCAGCTACTTGAAGG + Intronic
943432600 2:187823541-187823563 CTGTGTTCTCACATGTTGGAAGG - Intergenic
943561801 2:189472959-189472981 CTGTAATCCCACATTTTGGAAGG + Intronic
944105880 2:196078757-196078779 CTGTAGTCTCAGCTACTGGGAGG + Intergenic
944337385 2:198551784-198551806 CTGTAGTCCCAGCTACTGGGAGG + Intronic
944474139 2:200086809-200086831 CTATAGTGTGAGCTATTGGAGGG - Intergenic
944551685 2:200850087-200850109 CTGTAGTCTCAGCTACTTGGTGG - Intergenic
944571165 2:201045152-201045174 CTAGAGTCTCCTATATTGGACGG + Intronic
944674633 2:202024858-202024880 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
944739485 2:202597793-202597815 CTGTAGTCCTAGCTACTGGAGGG - Intergenic
944829271 2:203516490-203516512 CTGTAATCCCAGATTTTGGGAGG + Intronic
944841281 2:203626167-203626189 CTGTAGTCCCAGAACTTTGAGGG + Intergenic
945139864 2:206673378-206673400 CTGTAATCCCAGCTACTGGAGGG - Intronic
945271935 2:207949416-207949438 CTGTAATCCCAGCTACTGGAAGG + Intronic
945329898 2:208527120-208527142 CTGTAGTCTCAGCTACTTGAAGG - Intronic
945422852 2:209660513-209660535 CTGTAGTCCCAGCTATTGGGAGG - Intronic
945452815 2:210013436-210013458 CTGCAGTCCCAGCTACTGGAGGG - Intronic
945456041 2:210053472-210053494 CTGTAATCTCAGCTACTTGAGGG + Intronic
945649645 2:212541119-212541141 CTGTAGTCTTAGCTATTGGGAGG + Intergenic
945802658 2:214452275-214452297 CTGTAGTCCCAGCTACTGGGAGG - Intronic
946148217 2:217746919-217746941 CTGCTCTCTCAGATATTGCAGGG + Intronic
946264307 2:218525358-218525380 CTGTAGTCCCAGCTACTGGGGGG + Intronic
946314555 2:218901777-218901799 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
946323375 2:218967579-218967601 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
947004334 2:225493106-225493128 CTGTAGTCCCAGCTATTTGTTGG - Intronic
947007249 2:225526380-225526402 CTGTATTCTCAGGTAGGGGAGGG + Intronic
947012375 2:225580661-225580683 CTGAAGTCTCAGTTGATGGATGG + Intronic
947080262 2:226388158-226388180 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
947561489 2:231157687-231157709 CTGTAGTCCCAGCTACAGGAGGG - Intronic
947811374 2:233006071-233006093 CTGTAATCCCAGATTTTGGGAGG - Intronic
948394818 2:237637343-237637365 CTGTAGTCTCAGCTACTCGGGGG + Intronic
948414933 2:237796259-237796281 CTGTAATCCCAGCTACTGGAAGG + Intronic
948617352 2:239208997-239209019 CTGTAGTCTCAGCTACTTGAGGG - Intronic
1169024091 20:2352609-2352631 CTGTAATCTCACATTTTGGGAGG + Intergenic
1169152210 20:3298438-3298460 CTGTAGTCTCAGCTACTTGAAGG - Intronic
1169364959 20:4984429-4984451 CTGTAGTCCCAGCTATTTGGAGG + Intronic
1169461495 20:5799421-5799443 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1169631885 20:7642314-7642336 CTGTAATCTCAGCTATTAGGGGG - Intergenic
1169786624 20:9366273-9366295 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1169790634 20:9406615-9406637 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1170014536 20:11766056-11766078 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1170186871 20:13601154-13601176 CTGTAGTCCCAGCTATTGAGCGG + Intronic
1170221836 20:13949539-13949561 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1170770099 20:19325321-19325343 CTGTAGTCCCAGCTACTGGTGGG + Intronic
1171221837 20:23405180-23405202 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1171475060 20:25402269-25402291 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1171978621 20:31611175-31611197 CGGTAGACTCAGCTACTGGAGGG - Intergenic
1171980163 20:31622334-31622356 CTGTACTCCCAGGTATTGGGAGG + Intergenic
1172059966 20:32180686-32180708 CTGTAGTCCCAGCTATTCGGAGG - Intergenic
1172077920 20:32313827-32313849 CTGTAGTCCCAGATACTCGAAGG - Intronic
1172227704 20:33316274-33316296 CTGTAGTCTCAGCTACTTGGAGG + Intergenic
1172248273 20:33461038-33461060 CTGTAGTCCCAGATATTCAGGGG + Intergenic
1172287690 20:33752772-33752794 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1172367650 20:34362464-34362486 CTGTAATCTCAGCGATTGGGAGG + Intergenic
1172381992 20:34502259-34502281 CTGTAGTCCCAGTTATTTGGAGG + Intronic
1172415809 20:34766503-34766525 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1172545363 20:35756789-35756811 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1172663082 20:36580685-36580707 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1172665995 20:36600672-36600694 CTGTAGTCCCAGCTATTTGAAGG - Intronic
1172725018 20:37033139-37033161 CTGTAGTCTCAGCTATTTGCGGG - Intronic
1172743579 20:37188737-37188759 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1172755050 20:37277800-37277822 CTGTAGTCCCAGCTACTTGATGG + Intergenic
1172820643 20:37730717-37730739 CTGTAGTCTCAGCTATTCAGAGG + Intronic
1172903885 20:38354957-38354979 CTGTAGTCTCAGCTACTTCAGGG + Intronic
1173245339 20:41333859-41333881 CTGTAGTCTCAGCTACTTGGCGG - Intergenic
1173480522 20:43395153-43395175 CTGTAATCCCAGATACTTGAGGG + Intergenic
1173638833 20:44584844-44584866 CTGTAATCCCAGCTATTCGAGGG - Intronic
1173729805 20:45320241-45320263 CTGTAGTCCCAGCTATGGGGTGG + Intergenic
1174018640 20:47510713-47510735 CTGTAGTCACAGCTACTGGGAGG - Intronic
1174021609 20:47534791-47534813 CTGTAGTCCCAGCTGTTGGGTGG + Intronic
1174128666 20:48326747-48326769 CTGTAGCCTCAGTCATGGGAGGG + Intergenic
1174187077 20:48713613-48713635 CTGTAGTTCCAGCTTTTGGAAGG + Intronic
1174194694 20:48764658-48764680 CTGTGGTCCCAGCTCTTGGAAGG + Intronic
1174301121 20:49583258-49583280 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1174375794 20:50125713-50125735 CTGTAGTCTCAGCTACTCGGAGG - Intronic
1174566597 20:51469143-51469165 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1174649802 20:52115080-52115102 CTGTAGTCCCAGGTACTGGGAGG + Intronic
1175104187 20:56602675-56602697 CTGTAATCTCAGCTACTAGAGGG + Intergenic
1175153243 20:56951921-56951943 CTGTAGTCTCAGCTACTGTGGGG - Intergenic
1175380869 20:58563014-58563036 CTGTAGTCTCAGGTACTTGGGGG - Intergenic
1175433011 20:58920365-58920387 CTGTAGTCCCAGCTATAGGGAGG + Intergenic
1176175872 20:63723946-63723968 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1176212460 20:63931634-63931656 CTGTAGTCACAGAGATGGGAAGG + Exonic
1176624544 21:9082269-9082291 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1176726095 21:10434278-10434300 CTGTAGTCCCAGATACTCGGGGG - Intergenic
1176943993 21:14956538-14956560 CTGTAATCCCAGCTACTGGAGGG + Intergenic
1177154087 21:17483985-17484007 CTGTAGTCTCAGCTACTCAAAGG + Intergenic
1177158426 21:17522102-17522124 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1177214101 21:18106615-18106637 CTGTAGTCCCAGCTATTTGGAGG - Intronic
1177303998 21:19288780-19288802 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
1177353213 21:19972065-19972087 CTGTAGTCCCAGATACTTGTGGG - Intergenic
1177429463 21:20972393-20972415 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1177535302 21:22419542-22419564 CTGTATTCTCACATGGTGGAAGG - Intergenic
1177545178 21:22546737-22546759 CTGTAATCCCAGAATTTGGAAGG - Intergenic
1177599949 21:23298189-23298211 CTGTAGTCCCAGCTACTTGACGG + Intergenic
1178359067 21:31933036-31933058 CTGTAGTCTCAGCTACAGGCTGG - Intronic
1178507956 21:33178284-33178306 CTGTAGTTTCAGCTACTGGGGGG + Intergenic
1178564072 21:33667074-33667096 CTGTAATCTCAGAATTTGGGAGG - Intronic
1178878525 21:36430650-36430672 CTGTAGTCCCAGCTATTTGTGGG - Intergenic
1178937986 21:36881090-36881112 CTGTAGTCCCAGCTAGTTGAGGG - Intronic
1178958377 21:37043104-37043126 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1179193928 21:39147504-39147526 CTGTAGTCTCAGCTACTCGGGGG - Intergenic
1179977879 21:44880595-44880617 CTGTAGTCTCAGCTACTTGGAGG + Intergenic
1180138775 21:45878227-45878249 CTGTGGTCTCAGAGAATGAAGGG + Intronic
1180200580 21:46221477-46221499 CTGTAGTCTCAGCTACTTGGAGG - Intronic
1180236386 21:46461937-46461959 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1180288276 22:10772840-10772862 CTGTAGTCCCAGATACTCGGGGG + Intergenic
1180993448 22:19952515-19952537 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1181293648 22:21817722-21817744 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1181600724 22:23950269-23950291 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1181607789 22:23991053-23991075 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1181687789 22:24541505-24541527 CTGTAGTCCCAGCTAGTGGGGGG + Intronic
1181829783 22:25550961-25550983 CTGTATCCTCACATAATGGAAGG - Intergenic
1181947817 22:26532009-26532031 CTGTAGTCTCAGCTTCTTGAGGG + Intronic
1182054346 22:27338270-27338292 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1182076264 22:27497490-27497512 CTATAGTCTCAGCTACTCGAGGG - Intergenic
1182094778 22:27618675-27618697 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1182460552 22:30480667-30480689 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1182461633 22:30487585-30487607 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1182489367 22:30660428-30660450 CTGTAGTCCCAGCTATTTGTTGG - Intronic
1182501279 22:30749728-30749750 CTGTAATCTCAGATACTTGGAGG - Intronic
1182502985 22:30762096-30762118 CTGTAGTCTCAGCTATTTGGAGG + Intronic
1182592315 22:31391012-31391034 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1182628857 22:31668983-31669005 CTGTAATCTCAGCTATAGGGAGG + Intergenic
1182706398 22:32283272-32283294 CTCTTGTCTCAGATATTCGCTGG + Intergenic
1182832053 22:33312316-33312338 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1182849281 22:33458226-33458248 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1183242803 22:36670752-36670774 CTGTAGTCTCAGCTACTTGAGGG - Intronic
1183514975 22:38260031-38260053 CTGTAGTCCCAGTTACTGGGAGG - Intronic
1183756151 22:39767365-39767387 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1183870859 22:40741116-40741138 CTGTAATCTCACATGCTGGAAGG - Intergenic
1184008481 22:41728736-41728758 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1184017494 22:41797118-41797140 CTGTAGTCTCAGCTACTCGGAGG - Intronic
1184209566 22:43027535-43027557 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1184394721 22:44226338-44226360 CTCTTGTCTCAGATATTCGCTGG + Intergenic
1184529568 22:45046306-45046328 CTATAGTCCCAGATACTGGGGGG + Intergenic
1184873261 22:47255518-47255540 CTGTAGTCTCAGCTCTCGGGAGG - Intergenic
1184985834 22:48133017-48133039 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
949708583 3:6847409-6847431 CTGTAGTTCCAGCTATTTGAGGG - Intronic
949885581 3:8690895-8690917 CTGTAGTCTCAGCTACTCGGAGG + Intronic
950007581 3:9701411-9701433 CTGTAGTCCCAGCTACTTGAGGG + Intronic
950056781 3:10031378-10031400 CTGTAGTCCCAGCTACTGGGAGG + Intronic
950242418 3:11383569-11383591 CTGTAGTCCCAGCTATTTGTGGG - Intronic
950761937 3:15238234-15238256 CTGTAGTCTCAGCTACTTGGGGG - Intronic
950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG + Intronic
950975947 3:17245068-17245090 CTGTAGTCCCAGCTACTTGAGGG + Intronic
951173308 3:19568536-19568558 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
951208831 3:19952089-19952111 CTGTAGTCCCAGGTATTTGGAGG + Intronic
951210161 3:19965853-19965875 CTGTAGTCCCAGCTACTGGGCGG - Intronic
951312951 3:21151843-21151865 CTGAAGTCTCAGGTAATGGAGGG - Intergenic
951357297 3:21683493-21683515 CTGTAGTCCCAGCTACTCGAAGG + Intronic
951554089 3:23903234-23903256 CTGTAGTCCCAGCTACTTGAAGG - Intronic
951560193 3:23958516-23958538 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
951717126 3:25661754-25661776 TTGTAGTTTCAGATATTGAAAGG + Intronic
951741146 3:25925121-25925143 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
952064216 3:29548167-29548189 CTGTAGTCCCAGAGCTTGGGAGG + Intronic
952148800 3:30563497-30563519 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG + Intergenic
952380304 3:32799328-32799350 CTGTAGTCTCAGCTACTTGGCGG + Intergenic
952617991 3:35298697-35298719 CTGTAGTCTCAACTACTGGGAGG - Intergenic
952800201 3:37283646-37283668 CTGTAGTCCCAGCTACTTGAGGG - Intronic
952927458 3:38331174-38331196 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
953258112 3:41309458-41309480 CTGCAGTCTCAGTTACTGGGAGG - Intronic
953328057 3:42029359-42029381 CTGCAGTCCCAGCTACTGGAGGG - Intronic
953332891 3:42069207-42069229 CTGTAGTCTCAGCTACAGGTGGG + Intronic
953483379 3:43271901-43271923 CTGTAGGCTCAGCTACTGGGAGG - Intergenic
953511383 3:43543509-43543531 CTGTAGTCCCAGCTACTGGGAGG - Intronic
953527306 3:43703299-43703321 CTGTAGTCACAGCTATTCAAAGG - Intronic
953620276 3:44526941-44526963 CTGTAGTCCCAACTACTGGAGGG + Intergenic
953719243 3:45340866-45340888 CTGTAAGATCAGAGATTGGAGGG - Intergenic
953762480 3:45700792-45700814 CTGTAGTCCCAGCTATTGGGAGG - Intronic
953804531 3:46056594-46056616 CTGTAGTCCCAGTTATTTGAGGG - Intergenic
954012145 3:47650691-47650713 CTGTAGTCCCAGATACTCGGAGG + Intronic
954037598 3:47860313-47860335 CTGTAGTCTCAGCCACTTGAGGG - Intronic
954075178 3:48173094-48173116 CTGTAGTCCCAGCTACTGGGAGG + Intronic
954282986 3:49597450-49597472 CTGTAGTCCCAGCTACTGGCAGG - Intronic
954738415 3:52726781-52726803 CTGTAGTCCCAGCTACTCGAAGG + Intronic
955196015 3:56805355-56805377 CTGTAGTCCCAGCTACTTGAGGG - Intronic
955350676 3:58190919-58190941 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
955370952 3:58351348-58351370 CTGTAGTCTCAGCTATTTGGGGG - Intronic
955558074 3:60159241-60159263 CTGTAGTCTCAGCTAGTTGGAGG - Intronic
955742931 3:62111570-62111592 CTGTAGTCTCAGCTACTTGGAGG - Intronic
955840940 3:63112091-63112113 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
955921633 3:63963036-63963058 CTGTAGTCCCAGGTACTGGAAGG - Intronic
956579037 3:70789569-70789591 CTGCAGTCTCAGCTACTTGAGGG + Intergenic
956790474 3:72676299-72676321 CTGGAGTCACAAATTTTGGAGGG + Intergenic
956858395 3:73298425-73298447 CTGTAATCTGGGATATTGCAAGG + Intergenic
956988395 3:74731522-74731544 AACTAGTCTCAGGTATTGGAAGG - Intergenic
957043412 3:75354752-75354774 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
957504480 3:81101719-81101741 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
957706191 3:83788539-83788561 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
957778064 3:84781690-84781712 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
957924273 3:86788607-86788629 CTGTAATCCCAGCTACTGGAGGG - Intergenic
958933298 3:100230517-100230539 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
958958813 3:100489879-100489901 CTGTAGTCTCAGGTACAGGTGGG - Intergenic
959066537 3:101662884-101662906 CTGTAGTCCCAGCTATTTGTTGG - Intronic
959469751 3:106735895-106735917 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
959716185 3:109435513-109435535 AGTTAGCCTCAGATATTGGATGG + Intergenic
960042060 3:113160675-113160697 CTGTAGTCCCAGTTACTGGGAGG - Intergenic
960138170 3:114126341-114126363 CTTTAATCTCAGTTGTTGGAGGG + Intergenic
960586735 3:119327016-119327038 CTGTAGTCTCAGTTACTCGGAGG + Intronic
960683026 3:120268656-120268678 CTGTAGTCCCAGCTACTTGATGG - Intronic
960918365 3:122720848-122720870 CTGTAGTCCCAGCTATTGGGAGG + Intronic
960961648 3:123074820-123074842 CTGTAGTCTACGAATTTGGATGG - Intronic
960978406 3:123199578-123199600 CTGTAGTCTCAGCTACTTGTGGG - Intronic
961030305 3:123597216-123597238 CTGTAGTCCCAGTTATCGGAAGG - Intergenic
961137645 3:124526753-124526775 CTATAGTCTCTGATAGTGGAGGG - Intronic
961273251 3:125706089-125706111 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
961292170 3:125856543-125856565 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
961807090 3:129497144-129497166 CTGTAGTCCCAGCTACTGGGAGG + Intronic
961997561 3:131262262-131262284 CTGTAGTCCCAGCTATTGGGAGG + Intronic
962056192 3:131874209-131874231 CTGTAGTCTCAGCTACTCGGGGG - Intronic
962113907 3:132481456-132481478 CTGTAGTCCCAGCTACTTGAGGG + Intronic
962231233 3:133667233-133667255 CTGTAGTCCCAGGTACTGGGAGG + Intergenic
962581115 3:136798840-136798862 CTGTAGTCCCAGCTATTAGGGGG - Intergenic
962765886 3:138561899-138561921 CTGTAGTCCCAGCTATTGGGAGG + Intronic
963006297 3:140728864-140728886 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
963206603 3:142642811-142642833 CTGTAGTCTCAGCTACTTGGAGG - Intronic
963407586 3:144887016-144887038 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
963573957 3:147035360-147035382 CTGTAGTCCCAGCTACTTGATGG + Intergenic
963728760 3:148950263-148950285 GTGTTTTCTCAGATATTGTAAGG - Intergenic
963748621 3:149151128-149151150 CTGTAGTCCCAGCTACTTGAGGG - Intronic
964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG + Intergenic
964369268 3:155982838-155982860 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
964571953 3:158117418-158117440 CTGTAGTCCCAGCTACTTGAGGG - Intronic
964718601 3:159749189-159749211 CTGTAGTCCCAGCTACTGGTGGG + Intronic
964764978 3:160170910-160170932 TCATAGTTTCAGATATTGGATGG - Intergenic
964849617 3:161081166-161081188 CTGTAGTCCCAGATACTTGGGGG + Intergenic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
965368548 3:167830132-167830154 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
965981659 3:174699368-174699390 CTGTAGTCCCAGCTACTTGAAGG + Intronic
966356630 3:179086832-179086854 CTGTAGTCTCAGCTATTCAGGGG + Intergenic
966555020 3:181249438-181249460 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
966629432 3:182056155-182056177 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
966837964 3:184064129-184064151 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
967024363 3:185550926-185550948 CTGTAATCCCAGACTTTGGAAGG + Intronic
967066379 3:185920664-185920686 CTGTAGTCCCAGCTACTGGCAGG - Intronic
967077654 3:186018455-186018477 CTGTAGTCTCAGCTACTGGGGGG + Intergenic
967172477 3:186832763-186832785 CTGTGGTCACAGATAGGGGAAGG + Intergenic
967183476 3:186926848-186926870 CTGCAGCCTCACATGTTGGAAGG + Intergenic
967281124 3:187824657-187824679 CTGTAGTCTCAGCACTTGGGAGG - Intergenic
967757750 3:193189237-193189259 TTGAAGTCTCATACATTGGATGG + Intergenic
967974275 3:195023389-195023411 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
968031991 3:195507885-195507907 CTGTAGTCTCAGTTACTGGGGGG + Intergenic
968118124 3:196105197-196105219 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
968153179 3:196355816-196355838 CTGCAGACTCAGACAATGGAGGG + Exonic
968665756 4:1821564-1821586 CTGTACTCCCAGATATTGGGAGG + Intronic
968768559 4:2488339-2488361 CTGTAGTCCCAGCTACTGGGAGG + Intronic
968792875 4:2680440-2680462 CTGTAATCCCAGCTATTGGGGGG - Intronic
968843428 4:3025146-3025168 CTGTAGTCCCAGCTACTTGAGGG + Intronic
969018783 4:4124543-4124565 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
969045427 4:4333191-4333213 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
969599668 4:8168722-8168744 CTGTAGTCTCTGTTTTTGGGTGG + Intergenic
969730329 4:8952341-8952363 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
969735204 4:8984154-8984176 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
969815730 4:9686020-9686042 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
970074461 4:12201678-12201700 CTGTAGTCCCAGTTACTGGTGGG + Intergenic
971275636 4:25193955-25193977 CTGTAGTCTCAGCTACTCAAGGG + Intronic
971278218 4:25217808-25217830 CTGTAGTCCCAGCTACTCGAGGG - Intronic
971322589 4:25617259-25617281 CTGTAATCCCAGCTATTGGGAGG + Intergenic
971386366 4:26143803-26143825 CTGTAGTCTCAGATACTCTGGGG + Intergenic
971446925 4:26760441-26760463 CTGTAGTTTCAGCTACTGGTGGG + Intergenic
971456693 4:26851836-26851858 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
972037761 4:34548095-34548117 CTGTAGTCCCAGCTATTTGGAGG + Intergenic
972175224 4:36396586-36396608 CTGTAACCTCACATGTTGGAAGG + Intergenic
972409918 4:38783293-38783315 CTGTAGTCCCAGACATTTGCGGG - Intergenic
972479403 4:39483698-39483720 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
972513809 4:39794121-39794143 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
972514865 4:39802103-39802125 CTGTGGTCTCAGATACTTGGGGG - Intergenic
972533497 4:39980615-39980637 CTGTAGTCCCAGATCTTGGGAGG - Intergenic
972759929 4:42093105-42093127 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
972762888 4:42124228-42124250 CTGTAGTCTCGGCTATTTGCGGG + Intronic
972792484 4:42386518-42386540 CTGTAGTCTCAGCTACTCGGGGG + Intergenic
972977726 4:44658269-44658291 TTGTATCCTCACATATTGGAAGG - Intronic
973099109 4:46240222-46240244 CTGTAGTCCCAGTTATCGGGAGG + Intergenic
973132290 4:46662502-46662524 CTGTAGTCCCAGATACTTGGGGG - Intergenic
973195620 4:47436430-47436452 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
973202245 4:47517292-47517314 GTGTAGTCCCAGATATTGGGAGG + Intronic
973210149 4:47606376-47606398 CTGTAGTCTCAGCTACTTGGTGG - Intronic
973727049 4:53787336-53787358 CCATAGTCACAGAGATTGGAGGG - Intronic
973755360 4:54068376-54068398 CTGTGTTCTAAGATAGTGGAAGG - Intronic
973756208 4:54076164-54076186 CTGTAGTCCCAGTTATTTGGGGG + Intronic
973910946 4:55579785-55579807 CTGTAATCTCAGACTTTGGGAGG - Intronic
974654146 4:64797996-64798018 CTGTAATCCCAGCTATTGGGTGG - Intergenic
975179113 4:71323077-71323099 CTGCAGTTTCAAATATTGTAAGG + Intronic
975576241 4:75865506-75865528 CTGTAGACCCAGCTATTGGGAGG - Intronic
975804544 4:78098395-78098417 CTGTAGTCCCAGCTACTGGGAGG - Intronic
975826275 4:78322495-78322517 CTGTAGTCTCAAAGAAAGGAAGG - Intronic
975913033 4:79291338-79291360 CTGTAGTCTCAGCTACTAGGGGG + Intronic
975914646 4:79309836-79309858 CTGTAGTCCCAGCTACTGGAGGG - Intronic
975935706 4:79577398-79577420 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
976022852 4:80651486-80651508 CTCTAGTCTCAGTTACTTGAGGG - Intronic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
976116054 4:81728267-81728289 CTGTAGTCCCAGATACTTGGAGG + Intronic
976279233 4:83310547-83310569 CTGTAGTCCCAGCTATTTGTGGG + Intronic
976295988 4:83472881-83472903 TTGCAGTCTCTGTTATTGGAAGG - Intronic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
976407617 4:84677838-84677860 CTATAGTCCCAGTTATTTGAGGG + Intronic
976447301 4:85145826-85145848 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
976641263 4:87341292-87341314 CTGTAGTCCCAGCTACTTGAGGG - Intronic
976644600 4:87374196-87374218 CTGTAGTCCCAGCTACTTGAGGG + Intronic
977055675 4:92187443-92187465 CTGTAGTCTCAGCTACTCGGGGG - Intergenic
977163906 4:93671851-93671873 CTGTAGTCCCAGATACTTGGAGG + Intronic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
977315514 4:95442586-95442608 CTGTAGTCTCAGCTACTTGGGGG - Intronic
977342299 4:95774060-95774082 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
977478795 4:97547331-97547353 CTGTAGTCTCAGCTATTCAGGGG - Intronic
977508273 4:97930019-97930041 CTGTAGTCCCAGGTATCGGGAGG - Intronic
977603154 4:98955697-98955719 CTGTAATCCCAGATTTTGGGAGG - Intergenic
977656376 4:99525670-99525692 CTGTAGTCCCAGCTACTGGGAGG + Intronic
977898619 4:102393894-102393916 CTGTAGTCTCAGTTACTCGGGGG + Intronic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
978222899 4:106298486-106298508 CTGTAGTCCCAGCTACTCGATGG + Intronic
978428458 4:108606600-108606622 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
978462042 4:108966726-108966748 CTGTAGTCCCAGCTATTCGGGGG + Intronic
978573613 4:110166488-110166510 CTGTAGTCCCAGCTACTAGAAGG + Intronic
978730625 4:112022390-112022412 TAGTAGTCTCAGATATAGTAGGG - Intergenic
978732080 4:112039562-112039584 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
978762733 4:112372333-112372355 CTGTAGTCACAGCTATTGGGAGG - Intronic
979302343 4:119101295-119101317 CTGTAGTCTCAGCTACTCGGGGG + Intergenic
979540443 4:121874873-121874895 CTGTAGTCTCAGCTATTTGAAGG + Intergenic
979562543 4:122116704-122116726 CTGTAGTTTCAGCTATTAGAGGG - Intergenic
979594644 4:122521167-122521189 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
979803922 4:124946999-124947021 CTGTAGTCCCAGCTATTGGGGGG - Intergenic
980029836 4:127814687-127814709 CTGTAATCTCAGCTACTAGAAGG - Intronic
980278008 4:130680204-130680226 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
980417823 4:132515798-132515820 CTGTAGTCTAAGCTACTTGAGGG - Intergenic
980508390 4:133754126-133754148 CTGTGGCCTCACATGTTGGAAGG + Intergenic
980539662 4:134177296-134177318 CTGTAGTCCCAGCTGTTGGGAGG - Intergenic
980554173 4:134381483-134381505 CTGTAATCTCAGCTACTTGAAGG - Intergenic
981098235 4:140803525-140803547 CTGTAGTCTCCGCTATTTGGAGG - Intergenic
981295955 4:143131657-143131679 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
981314762 4:143331278-143331300 CTGTAGTCCCAGCTACTGGGTGG + Intergenic
981690291 4:147500593-147500615 CTGCAGTCCCAGCTACTGGAAGG + Intronic
981843105 4:149135301-149135323 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
982003284 4:151040765-151040787 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
982348273 4:154385607-154385629 CTGTAGTCTCAGCACTTGGGAGG - Intronic
982359549 4:154504918-154504940 CTGTAGACCCAGCTATTGGGAGG - Intergenic
982695937 4:158600703-158600725 CTGTAGTCTCAGCTACTTGGAGG + Intronic
982743831 4:159085816-159085838 CTGTAGTCCCAGATACTTGGGGG - Intergenic
982814015 4:159862881-159862903 CTGTAATCCCAGCTATTTGAGGG + Intergenic
982993324 4:162307543-162307565 CTGTAATCTTAGCTACTGGAAGG + Intergenic
983155348 4:164340361-164340383 CTGTAGTCTCAGCTACTCGGGGG - Intronic
983305549 4:165980666-165980688 CAGTAGGCTCAGGTATTTGAAGG - Intronic
983378209 4:166957130-166957152 CTGTAGTCCCAGCTACTGGGAGG + Intronic
983568929 4:169183623-169183645 CTGTAGTCTCAGCTACTTGAGGG + Intronic
983901591 4:173141664-173141686 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
984072752 4:175135916-175135938 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
984261682 4:177450565-177450587 CTGTAGTCCCAGCTATTAAATGG + Intergenic
984284265 4:177709197-177709219 CTGTAATCCCAGCTATTGGGAGG + Intergenic
984477178 4:180250260-180250282 CTGTAGTCCCAGGTATTGGGAGG + Intergenic
984523351 4:180826654-180826676 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
984783047 4:183543312-183543334 CTGTAGTCCCAGCTACTTGAAGG + Intergenic
984974803 4:185220987-185221009 CTGTAGTCCCAGCCATTGGCGGG - Intronic
985142142 4:186851911-186851933 CTGTAGTCTCTGCTATTGCCTGG + Intergenic
985483530 5:135064-135086 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
985555599 5:556487-556509 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
986686895 5:10282658-10282680 CTGTAGTCTCAGCTACTTGCGGG + Intronic
987593510 5:19964473-19964495 CTGTAGTCCCAGCTACTTGAGGG + Intronic
987627402 5:20419598-20419620 CTGTAGTCCCAGCTACTGAAGGG - Intronic
987685486 5:21194640-21194662 CTGTAGTCCCAGTTAGTCGAAGG + Intergenic
987807281 5:22785638-22785660 CTGTAGTCTCAGCTACTTGGAGG - Intronic
988496637 5:31751117-31751139 CTGTAGTCTCAGCTACTCGGAGG + Intronic
988867893 5:35355281-35355303 CTGTAGTCGCAGCTATTTGGGGG - Intergenic
988883933 5:35534625-35534647 CTGTAGTCCCAGTTATTTGGAGG + Intergenic
989018314 5:36967972-36967994 CTGTAGTCCCAGCTATTTGGAGG + Intronic
989054166 5:37350679-37350701 CTGTAATCCCAGCTATTGGGAGG + Intronic
989315046 5:40068770-40068792 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
989463099 5:41724244-41724266 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
989721831 5:44538180-44538202 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
990298598 5:54427986-54428008 CTGTAATCTCAGCTACTGGGAGG + Intergenic
990468963 5:56095741-56095763 CTGTAGACTGTGAGATTGGAAGG - Intergenic
990589416 5:57247560-57247582 CTGTGGTCCCAGATCTTGGGAGG + Intronic
990598099 5:57331191-57331213 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
990700167 5:58466505-58466527 CTGTGGTCTCACATGGTGGAAGG - Intergenic
990958342 5:61366015-61366037 CTGTAGTCCCAGCTACTGGTGGG - Intronic
991061612 5:62382317-62382339 CTGTAGTCCCAGCTATTGGGAGG + Intronic
991253548 5:64589803-64589825 CTATAGTCCCAGCTATTGGGAGG + Intronic
991709479 5:69394181-69394203 CTGTAGTCCCAGCTACTAGATGG - Intronic
991732838 5:69605583-69605605 CTGTAGTCCCAGCTATTGTGGGG + Intergenic
991809272 5:70460727-70460749 CTGTAGTCCCAGCTATTGTGGGG + Intergenic
991862117 5:71022269-71022291 CTGTAGTCCCAGCTATTGTGGGG - Intronic
992056951 5:72999637-72999659 CTGTGATCTCAGACTTTGGAAGG - Intronic
992175024 5:74141462-74141484 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
992310644 5:75495433-75495455 CTGTAGTCTCAGCTACTCGGGGG + Intronic
992660215 5:78952457-78952479 CTGTAGTCCAAGCTACTGGAGGG - Intronic
992683549 5:79177347-79177369 CTGTAATCTCAGCTACTGGGAGG - Intronic
992695209 5:79279209-79279231 CTGTAGTCCCAGCTACTCGAAGG + Intronic
992763481 5:79972515-79972537 CTGTTTTCTCAGCTATTAGATGG - Intergenic
992812803 5:80407083-80407105 CTGTAGTCCCAGCTACTGGCTGG - Intergenic
993606475 5:89996404-89996426 ATGTAGTCCCCGATATTTGAAGG + Intergenic
993726110 5:91368103-91368125 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
993766229 5:91862268-91862290 CTGTAATCTCAGCTATTCAAGGG - Intergenic
993978551 5:94512772-94512794 CTGTAGTCCCAGCTACTGGGAGG + Intronic
993994264 5:94702174-94702196 CTGTTGTCACAGTTATGGGAGGG + Intronic
994047197 5:95323378-95323400 CTGTAGTCTCAGCTATCAGGAGG + Intergenic
994370207 5:98959046-98959068 CTGTAATCTCAGATACTGGGAGG + Intergenic
994803053 5:104404628-104404650 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
995109423 5:108412417-108412439 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
995773007 5:115692202-115692224 CTGTAGTCTCGGCTACTGGTCGG + Intergenic
996557349 5:124792612-124792634 CTGTAGTCTCAGCTACCGGGAGG - Intergenic
996721013 5:126630162-126630184 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
996741275 5:126801104-126801126 CTGTAGTCCCAGCTACTAGAGGG - Intronic
997402927 5:133616522-133616544 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
997554919 5:134787872-134787894 CTGTAGTCCTAGATACTGGGAGG + Intronic
998071230 5:139199272-139199294 CTGTGGTCCCAGCTACTGGATGG - Intronic
998303323 5:141047912-141047934 CTGTAGTCCCAGTTACTTGAGGG - Intergenic
998386367 5:141759350-141759372 CTGTAGTCCCAGCTACTGGTGGG - Intergenic
998434109 5:142092658-142092680 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
998990028 5:147805523-147805545 CTGTAATCCCAGACATTGGGAGG - Intergenic
999792357 5:154953231-154953253 CTGTAGTCCCAGCTACTGGGAGG + Intronic
999994100 5:157075454-157075476 CTGTAGTCACAGCTATTTGGGGG + Intergenic
1000064336 5:157682202-157682224 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1000313723 5:160069160-160069182 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1000595579 5:163211693-163211715 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1000748563 5:165066317-165066339 CTGTAGTCTCAGTTACTTGGGGG - Intergenic
1000880244 5:166689183-166689205 CTGTAGTCCCAGCTATTCGGAGG - Intergenic
1001083661 5:168685070-168685092 CTGTAATCCCAGCTATTGGGAGG - Intronic
1001107140 5:168864085-168864107 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1001344337 5:170877385-170877407 CTGTAGTCCCAGCTATTAGAGGG - Intronic
1001407193 5:171484511-171484533 CTGTGGACTCACATATTAGACGG - Intergenic
1001410942 5:171511168-171511190 CTGTAGTCCCAGCTACTAGAGGG - Intergenic
1001477429 5:172060490-172060512 CTGTATCCTCACATAGTGGAAGG - Intronic
1001502248 5:172246564-172246586 CTGTAGTCCCAGCTTTTGGGAGG - Intronic
1001624073 5:173115725-173115747 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1001968732 5:175936650-175936672 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1002012436 5:176294399-176294421 CTGTAGTCCCAGCTACTTGAAGG - Intronic
1002028042 5:176408775-176408797 CTGTAATCCCAGATTTTGGGAGG - Intronic
1002062390 5:176633354-176633376 CTGTAGTCTCATCTACTGAAAGG - Intronic
1002215388 5:177628204-177628226 CTGTAGTCCCAGCTACTTGAAGG + Intergenic
1002248711 5:177907087-177907109 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1002492286 5:179587173-179587195 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1002627043 5:180536731-180536753 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1002646822 5:180661909-180661931 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1002958041 6:1888069-1888091 CTGTAGTCTCAGGTACTTGGTGG - Intronic
1003447776 6:6200427-6200449 CTGTAGTCTCAGCTACTTGAGGG + Intronic
1004104494 6:12653320-12653342 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1004214135 6:13685803-13685825 CTGTAGTCCCAGCTAATGGGAGG + Intronic
1004224560 6:13773748-13773770 TTGTAGTCTCAGCTATATGAAGG + Intergenic
1004381637 6:15137737-15137759 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1004415276 6:15417619-15417641 CTGTAGTCCCAGTTACAGGAGGG + Intronic
1004675921 6:17842170-17842192 CTGTGGTCTCAGCTACTTGAGGG - Intronic
1004863567 6:19832153-19832175 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1004893452 6:20123933-20123955 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1004992684 6:21156299-21156321 CTGTAGTCCCAGCTACTGGCAGG + Intronic
1005079778 6:21945139-21945161 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1005722726 6:28618678-28618700 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1005751979 6:28891958-28891980 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1005817598 6:29568563-29568585 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1005911138 6:30310553-30310575 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1006291871 6:33144102-33144124 CTGTAATCCCAGATACTCGAGGG + Intergenic
1006322416 6:33327735-33327757 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1006354487 6:33546676-33546698 CTGTAGTCCCAGATACAGGCAGG - Intergenic
1006545904 6:34781091-34781113 CTGTAGTCCCAGCTACTCGAAGG - Intergenic
1006647798 6:35527016-35527038 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1006755224 6:36409702-36409724 CTGTAGTCTCAGATCTCGGGAGG + Intronic
1006999474 6:38295924-38295946 CTGTAATCCCAGCTATTGGGAGG + Intronic
1007001227 6:38314969-38314991 CTGTAGTCCCAGATACTTGGAGG - Intronic
1007080407 6:39097996-39098018 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1007460429 6:42014242-42014264 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1007547258 6:42703976-42703998 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1007601800 6:43086712-43086734 CTGTAGTCTCAGCTACTCAAAGG + Intronic
1007620446 6:43210231-43210253 CTGTAGTCCCAGACTTTGGCAGG - Intronic
1008098117 6:47360957-47360979 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
1008161252 6:48078994-48079016 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1008187304 6:48409964-48409986 CTGTAGTCCCAGCTATTTGAGGG + Intergenic
1008508308 6:52252646-52252668 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1008568972 6:52796663-52796685 CTGTAATCCCAGCTATTGGGAGG - Intronic
1008877338 6:56343818-56343840 CTGTAGTCCCAGCTACTCGATGG + Intronic
1008936101 6:56994334-56994356 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1009059477 6:58380730-58380752 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1009431477 6:63571639-63571661 ATGTTGTCTCAGATAATGAAAGG - Intronic
1009741469 6:67752549-67752571 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
1009965548 6:70574196-70574218 CTGTAATCCCAGCTATTGGGAGG + Intronic
1010002655 6:70963233-70963255 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1010032683 6:71287780-71287802 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1010234419 6:73563385-73563407 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1010405996 6:75506230-75506252 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1010701449 6:79053189-79053211 CTGCAGTCTCAGCTACTTGAGGG + Intronic
1010724468 6:79317573-79317595 CTGTAATCCCAGATACTTGAGGG - Intergenic
1010731023 6:79391505-79391527 CTGTATTCTCACATGATGGAAGG + Intergenic
1010736044 6:79444512-79444534 CTGTAGTCCCAGCTACTAGAGGG + Intergenic
1010983804 6:82399658-82399680 CTGTAGTCCCAGCTATTCGTGGG + Intergenic
1011482695 6:87811029-87811051 CTGTAATCTCAGCTATTGGGAGG - Intergenic
1011587499 6:88942490-88942512 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1011906305 6:92372847-92372869 AGGTAGACTCAGTTATTGGAGGG + Intergenic
1012161646 6:95891931-95891953 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1012358713 6:98349448-98349470 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
1012546834 6:100429245-100429267 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1012582784 6:100889577-100889599 CTGCAGTCTCGGATATTGCTGGG + Intergenic
1013101402 6:106990076-106990098 CTGTAGTCTCAGCTACTGTGGGG + Intergenic
1013108209 6:107043998-107044020 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1013299458 6:108790239-108790261 CTGTAGTCCCAGCTATTTGTTGG - Intergenic
1013555684 6:111254941-111254963 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1013604354 6:111733962-111733984 CTGTAGTCTCAGTTACTTGGGGG + Intronic
1013606262 6:111751741-111751763 CTGTAGTCCCAGGTACTGGGAGG - Intronic
1013611778 6:111802552-111802574 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1013810955 6:114043877-114043899 CTGTAATCCCAGATTTTGAAGGG + Intergenic
1014008135 6:116444714-116444736 CTGTAGCCTCACATGTTGGAAGG - Intergenic
1014235408 6:118948471-118948493 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1014501574 6:122196947-122196969 CTGTACTCTCAGATAATTGCCGG - Intergenic
1014806024 6:125830565-125830587 CTGTAGTCCCAGTTACTGGCAGG + Intronic
1014914999 6:127135802-127135824 CTGTAGTCTCAGCTACTGTGGGG + Intronic
1014917251 6:127166653-127166675 ATGTAGTCTCAAACATTTGATGG + Intronic
1015028625 6:128567986-128568008 CTGTAGTCCCAGCTACTTGAAGG + Intergenic
1015725644 6:136296797-136296819 CTGTAGTCTCAGCTACTCGGGGG - Intergenic
1015777573 6:136829813-136829835 CTGTAGTCCCAGCTATTTGGTGG + Intronic
1016451677 6:144189143-144189165 CTGTAGTCTCAGCTATTTGTAGG - Intergenic
1016732408 6:147440746-147440768 CTCTAATCTCACATAGTGGAAGG + Intergenic
1016810898 6:148260482-148260504 CTGTAGTCCCAGCTCTTGGGAGG + Intergenic
1016821761 6:148353188-148353210 CTATAGTCTCAGCTACTGGGAGG - Intronic
1016833785 6:148456737-148456759 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1017181429 6:151556331-151556353 CTGTAATCCCAGCTATTGGGAGG + Intronic
1017241544 6:152175069-152175091 CTGTAGTCCCAGGGATTGGGAGG + Intronic
1017256408 6:152338497-152338519 CTATAGTCCCAGCTATTGGGAGG + Intronic
1017494143 6:154968352-154968374 CTGTAGTCTCAGTACTTGGGAGG + Intronic
1017603171 6:156105383-156105405 CTGTAGTCCCAGATACTTGAAGG + Intergenic
1017607680 6:156150875-156150897 CTGTATTCTCACATGGTGGAAGG + Intergenic
1017690906 6:156962902-156962924 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1017696143 6:157018336-157018358 CTGTAGTCCCAGCTGTTGGGAGG - Intronic
1017734156 6:157345790-157345812 CTGCAGTTTCACATATTTGAGGG + Intergenic
1017742740 6:157421367-157421389 CTGTAGTCCCAGCTATTCGGAGG + Intronic
1017915298 6:158826872-158826894 CTGTAGTCCCAGGTACTTGAGGG - Intergenic
1017919272 6:158857274-158857296 CTGTAGTCTCAGCTACCTGAAGG + Intergenic
1018006433 6:159626648-159626670 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG + Intronic
1018451722 6:163915129-163915151 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1018476347 6:164145889-164145911 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1018663963 6:166116571-166116593 CTGTAGTTTCAGCTACAGGAAGG + Intergenic
1018673671 6:166200595-166200617 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
1018786636 6:167113496-167113518 CTGTAGTTCCAAGTATTGGAAGG + Intergenic
1019809691 7:3156189-3156211 CTGTAGTCTCAGCTACTGGTGGG + Intronic
1019881554 7:3865629-3865651 CTGTAGTCCCAGTTACTTGAGGG - Intronic
1019982749 7:4633490-4633512 CTGTAGTCCCAGCTACTAGAAGG + Intergenic
1020095147 7:5364174-5364196 CTGTAGTCCCAGCTATTCGGGGG + Intronic
1020102898 7:5404993-5405015 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1020202530 7:6091347-6091369 CTGCAGTCTCAGCTACTTGAGGG - Intergenic
1020223788 7:6263537-6263559 CTGTAATCCCAGAATTTGGAAGG + Intronic
1020310588 7:6864909-6864931 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
1020394484 7:7698975-7698997 CTGTAGTCCCAGATACTTGGGGG - Intronic
1020653364 7:10901684-10901706 CTGTAATCCCAGAAATTGGGAGG + Intergenic
1021037848 7:15823179-15823201 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1021085397 7:16416717-16416739 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1021442544 7:20693242-20693264 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1021549834 7:21859234-21859256 CTGTAGTCCCAGTTACTTGAGGG - Intronic
1021689340 7:23217093-23217115 CTGTAGTCCCAGATACTGGGTGG - Intergenic
1021712780 7:23432761-23432783 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1021802485 7:24321218-24321240 CTGTAATCTCAGATTTTGGGAGG + Intergenic
1021838617 7:24704810-24704832 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1022117012 7:27270183-27270205 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1022551551 7:31244752-31244774 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1022706845 7:32809791-32809813 CTGCAGTCCCAGCTACTGGAGGG + Intergenic
1022731559 7:33031463-33031485 CTGTAGTCCCAGATACTCGGAGG + Intronic
1022786021 7:33637859-33637881 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1022800005 7:33767707-33767729 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1023009563 7:35913710-35913732 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1023078825 7:36508727-36508749 CTGTAGTCTCAGCATTTGGGAGG - Intergenic
1023553394 7:41393185-41393207 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1023751325 7:43375768-43375790 CTGTAATCCCAGCTACTGGAGGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1023810581 7:43908198-43908220 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1023958155 7:44904453-44904475 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1024062605 7:45710148-45710170 CTGTAATCACAGATATTGAAAGG + Intronic
1024292839 7:47817745-47817767 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1024335140 7:48199417-48199439 CTGTGTTCTCACATAATGGAAGG + Intronic
1024503666 7:50141849-50141871 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1024758285 7:52562800-52562822 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1025123240 7:56323982-56324004 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1025827664 7:65023794-65023816 ATGTAGTCCCAGCTCTTGGAAGG + Intergenic
1025828796 7:65032781-65032803 CTGTAGTCTCAGCTACTCAAAGG + Intergenic
1025915197 7:65860250-65860272 ATGTAGTCCCAGCTCTTGGAAGG + Intergenic
1025916318 7:65869190-65869212 CTGTAGTCTCAGCTACTCAAAGG + Intergenic
1025953223 7:66162583-66162605 CTGTAGTCTCAGCTATCGGGAGG - Intergenic
1025966594 7:66278659-66278681 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1025997176 7:66535272-66535294 CTGTAGTCTCAGCTACTCGAGGG + Intergenic
1026001282 7:66560579-66560601 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1026006827 7:66606647-66606669 ATGTAGTCCCAGCTCTTGGAAGG - Intergenic
1026023181 7:66726484-66726506 CTGTAGTCTCAGCTACTTGGAGG - Intronic
1026049441 7:66932635-66932657 CTGTAATCCCAGCTATTGGGAGG - Intronic
1026063857 7:67051428-67051450 CTGTAGTCTCAGCTATTCAGGGG - Intronic
1026072977 7:67139172-67139194 CTGTAGTCCCAGTTACTTGAAGG - Intronic
1026204328 7:68242644-68242666 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1026238295 7:68548742-68548764 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1026257020 7:68721213-68721235 CTGGAGTCTCAGCTACTGGGAGG - Intergenic
1026266640 7:68801153-68801175 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1026306274 7:69144760-69144782 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1026349659 7:69504546-69504568 CTGTAGTCTTAGCTACTCGAGGG + Intergenic
1026464147 7:70639491-70639513 CTGTGGTCTCAGCTACTGGGGGG + Intronic
1026714490 7:72776022-72776044 CTGTAGTCTCAGCTATTCAGGGG + Intronic
1026728886 7:72894139-72894161 CTGTAGTCCCAGATATTTGGAGG + Intronic
1026820905 7:73547995-73548017 CTGTAGTTTCAGCTACTGGGAGG + Intronic
1026826969 7:73590044-73590066 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
1026897034 7:74015275-74015297 CTGTAGTCTCAGCTACTTGGCGG - Intergenic
1026905113 7:74058474-74058496 CTGTGGTCTCAGCTCTTGGGGGG - Intronic
1026934185 7:74242960-74242982 CTGTAGTCTCAGCTACTGGGAGG + Intronic
1026984729 7:74547559-74547581 CTGTAGTCTCAGCTACTCAAGGG - Intronic
1027169914 7:75864284-75864306 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1027177542 7:75914514-75914536 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1027506874 7:79026749-79026771 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1027587369 7:80075242-80075264 CTGTAGTCCCAGCTACTAGAGGG + Intergenic
1027753899 7:82186032-82186054 CTGTAATCTCAGCTACTGGGAGG + Intronic
1028350278 7:89838447-89838469 CTGTAGTCTCAGATACTTGGGGG - Intergenic
1028601187 7:92602059-92602081 CTGTAGTCCCAGATACTTGGGGG + Intergenic
1028625214 7:92870092-92870114 CTGTAATCCCAGATTTTGGGAGG + Intergenic
1028662432 7:93295289-93295311 CTGTATCCTCAAATAGTGGAAGG + Intronic
1028763443 7:94521960-94521982 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1028794263 7:94886222-94886244 CTGTAGTCCCAGTTATTTGGAGG + Intergenic
1029091676 7:98053255-98053277 CTGTAGTCTCAGTTATCGGGAGG - Intergenic
1029132617 7:98344053-98344075 CTGTAGTCCCAGCTATAGGGAGG + Intronic
1029238991 7:99144962-99144984 CTGTAGTCCCAGGTACTGGGAGG + Intergenic
1029304263 7:99607249-99607271 CTGTAATCTCAGCAATTGGGAGG - Intronic
1029340257 7:99937153-99937175 CTGTAGTCTCAGCTGTTTGGGGG - Intergenic
1029344622 7:99969456-99969478 CTGTAGTCCCAGTTATCGGGAGG + Intronic
1029369443 7:100138985-100139007 CTGTAATCTCAGCTACTGGGGGG - Intergenic
1029411540 7:100415203-100415225 CTGTAGTCTCAGTTACTTGGAGG - Intronic
1029526689 7:101099050-101099072 CTGTAATCTCAGCTACTTGAGGG - Intergenic
1029574328 7:101393122-101393144 CTGTAATCTCAGCTACTGGGAGG - Intronic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1029620129 7:101685089-101685111 CTGTAGGCTCACACATAGGAAGG + Intergenic
1029660609 7:101958601-101958623 CTGTAATCTCAGCTACTTGAGGG - Intronic
1029679033 7:102095120-102095142 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1029686550 7:102152512-102152534 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1029819550 7:103132674-103132696 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1029834367 7:103294008-103294030 CTGTAGTCCCAGGTATTGAGAGG - Intergenic
1029972431 7:104802369-104802391 CTGTAATCCCAGATACTGGTGGG + Intronic
1030073406 7:105716755-105716777 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1030186841 7:106771088-106771110 CTGTAGTCTTAGCTATCGGGAGG - Intergenic
1030190769 7:106808116-106808138 CTGTAATCCCAGATACTTGAGGG - Intergenic
1030241148 7:107326917-107326939 CTGTAGTCTCAGCTACTTGGAGG + Intronic
1030574498 7:111268854-111268876 CTGTAATCCCAGGTATTGGAAGG - Intronic
1030579525 7:111336167-111336189 CTGTAGTCTCAGCTAGTTGGGGG - Intronic
1030903621 7:115155016-115155038 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
1031012847 7:116541627-116541649 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1031476394 7:122227829-122227851 CTGTAGTCCCATATTTAGGAGGG - Intergenic
1031695716 7:124850607-124850629 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1031725514 7:125233147-125233169 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1031975546 7:128091338-128091360 CTGTAGTCTCAGTACTTGGCAGG - Intronic
1032106330 7:129034368-129034390 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1032211342 7:129917080-129917102 CTGTAGTCCCAGCTACTGGCAGG + Intronic
1032488711 7:132307708-132307730 CTTTAGTCTCAGGGCTTGGAAGG + Intronic
1033171426 7:139087907-139087929 CTGTAGTCCCAGATACTTGGGGG + Intronic
1033227623 7:139573723-139573745 CTGTAGTCCCAGCTATTCGGTGG + Intronic
1033797470 7:144864146-144864168 CTGTTGTCCCAGCTATGGGATGG - Intergenic
1033823798 7:145164805-145164827 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1033927642 7:146483151-146483173 CTGTAGTCTCAGCTACTCGGGGG + Intronic
1033987383 7:147243117-147243139 CTGTAGTCCCAGCTCTTGGGAGG - Intronic
1034142534 7:148835298-148835320 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1034187233 7:149187690-149187712 CTGTAGTCTCAGCTACTTGGAGG + Intergenic
1034380982 7:150692101-150692123 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1034511321 7:151537318-151537340 CTGTAGTCTCAGCTGATGGGGGG - Intergenic
1034611828 7:152377610-152377632 CTGTAGTCCCAGATACTCGGGGG + Intronic
1034620226 7:152451158-152451180 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1034826370 7:154268423-154268445 CTGTATTCTCATATGGTGGATGG + Intronic
1034870596 7:154679829-154679851 CTGTACCCTCAGATAATGGATGG + Intronic
1034947918 7:155275730-155275752 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1035190153 7:157160195-157160217 CTGTAGTCTCAGCTACTTGGAGG - Intronic
1035240894 7:157528458-157528480 CTGTAGTCCCAGCTACTGGGTGG - Intergenic
1035276403 7:157750542-157750564 CTGTTCACTCAGATATTGGCAGG - Intronic
1035414572 7:158672463-158672485 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1035604043 8:917359-917381 CTGTAGTCTCAGCTACTTGAGGG - Intergenic
1036163358 8:6408679-6408701 CTGTAGTCCCAGCTACTGGGTGG - Intronic
1036731501 8:11269745-11269767 CTGTAGTCTCAGCTATTTAGGGG - Intergenic
1036772013 8:11585608-11585630 CTGTAGTCCCAGGTATTTGGAGG + Intergenic
1036819284 8:11926791-11926813 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
1036902632 8:12682398-12682420 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
1036948529 8:13119104-13119126 CTGTTGTCTCAGCTACTTGAGGG + Intronic
1037048713 8:14342436-14342458 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1037107477 8:15127019-15127041 CTGTAGTTTTAGAAATTGGCTGG + Intronic
1037132183 8:15420374-15420396 CTGTAGTCTCAGCTACTTGGAGG + Intronic
1037575074 8:20194810-20194832 CTGTAACCTCAGATATGGAATGG - Intergenic
1037801600 8:22038911-22038933 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1037867194 8:22454758-22454780 CTTTAGTCTTAGATATTGAAAGG + Intronic
1037908691 8:22730416-22730438 CTGTAGTCTCAGCTATTCAGGGG + Intronic
1037953095 8:23031508-23031530 CTGTAGTCCCAGCTATTTGTGGG - Intronic
1038154425 8:24974867-24974889 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1038194670 8:25356075-25356097 CTGTAGTCCGAGCTATTGGGAGG + Intronic
1038299164 8:26325956-26325978 CTGTAGTCTCAGTTACTTGTGGG - Intronic
1038403688 8:27305957-27305979 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1038595922 8:28886368-28886390 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1038736070 8:30170761-30170783 CTGTAATCCCAGCTATTGGGAGG - Intronic
1038763534 8:30406634-30406656 CTGTAGTCTCAGCTATCAGGAGG + Intronic
1038786211 8:30619062-30619084 CTGTAGTCTCAGCTACTCGGAGG - Intronic
1038795202 8:30703622-30703644 CTGTAGTCCCAGCTCTTTGAGGG + Intronic
1038819936 8:30943031-30943053 TTGTAGTCCCAGCTATTGGGAGG - Intergenic
1038822396 8:30964768-30964790 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1038948642 8:32389880-32389902 CTGTAACCCCAGTTATTGGAAGG - Intronic
1038953263 8:32439897-32439919 CTGTGGTCTCAGCTACTGGAGGG - Intronic
1038959769 8:32506125-32506147 CTGTAGTCTCAGCTACATGAAGG + Intronic
1038963156 8:32544623-32544645 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1039217414 8:35287683-35287705 CTGTAGTCCCAGATATTCAGAGG + Intronic
1039638988 8:39198498-39198520 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1039902762 8:41765367-41765389 CTGTAGTTTCAGCTATTCGGGGG - Intronic
1039944471 8:42117795-42117817 CTGTAGTCTCAGCTGCTTGAGGG - Intergenic
1039995263 8:42526844-42526866 CTGTAGTCTCAGCACTTTGAGGG + Intronic
1040037593 8:42885878-42885900 CTGTAGTCTCAGCTACTTGGAGG - Intronic
1040662227 8:49587289-49587311 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1040927553 8:52700398-52700420 CTGTAGTCCCAGTTATGGGGGGG + Intronic
1040995523 8:53397227-53397249 CTGTAGTCTCAGCTATCGGGAGG + Intergenic
1041126614 8:54647290-54647312 CTGTAATCTCAGCTATTGAGAGG + Intergenic
1041241947 8:55855590-55855612 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1041590118 8:59569695-59569717 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1041689310 8:60673607-60673629 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1041908573 8:63062070-63062092 CTGTAGTCCCAGATACTTGGTGG + Intronic
1041910170 8:63080597-63080619 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1042231303 8:66557755-66557777 CTGTAGTCTCAGCTACTTGTAGG + Intergenic
1042362991 8:67903536-67903558 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1042379448 8:68095762-68095784 ATGTAGTCCCAGCTACTGGAAGG - Intronic
1042561288 8:70073508-70073530 CTGTAGTCCCAGCTAGTTGAGGG - Intergenic
1042884047 8:73527929-73527951 TTCAAGTCCCAGATATTGGAGGG - Intronic
1042899860 8:73714242-73714264 CTCTATTCTCTGCTATTGGAGGG + Intronic
1042918955 8:73902752-73902774 CTGTAGTCTCAGCTACTTGGAGG + Intergenic
1042967880 8:74375068-74375090 CTGTAATCCCAGATCTTGGGAGG + Intronic
1043409266 8:79975172-79975194 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1043439519 8:80264965-80264987 CTGTGGTCTCAGCTACTTGAAGG - Intergenic
1043527335 8:81111559-81111581 CTGTAGTTTCTGAAGTTGGAGGG - Intronic
1043641304 8:82453320-82453342 CTGTAGTCTCAGCTACTAGTGGG - Intergenic
1043765813 8:84130854-84130876 CTGTAGACTCAAAAATAGGATGG + Intergenic
1043851798 8:85224565-85224587 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1043884519 8:85583237-85583259 CTGTAGTCTCGGTTACTTGAAGG - Intergenic
1044116028 8:88335195-88335217 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1044155621 8:88842563-88842585 CTGTATTCTCAGAGTTTGAAAGG - Intergenic
1044637596 8:94342056-94342078 CTGTAGTCCCAGCTACTGGGTGG - Intergenic
1044975192 8:97657624-97657646 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1044991041 8:97796060-97796082 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1045453470 8:102352183-102352205 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1045468962 8:102494146-102494168 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1045527085 8:102950270-102950292 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1045541705 8:103092726-103092748 CTGTAGTCCCAGCTATTTGTGGG - Intergenic
1045573659 8:103395664-103395686 CTGTAGTCTCAGCTATGAGGTGG + Intergenic
1045791103 8:105985655-105985677 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1045837060 8:106535083-106535105 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1046740318 8:117820564-117820586 CTGTAGTCCCAGTTATCGGGAGG + Intronic
1047094955 8:121614981-121615003 CAGCAGTGTAAGATATTGGATGG - Exonic
1047302638 8:123627144-123627166 CTGTAATCCCAAAGATTGGAAGG + Intergenic
1047484572 8:125317317-125317339 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1047668503 8:127118994-127119016 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1047712703 8:127568084-127568106 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1047947077 8:129891109-129891131 CTGGAGTCTCAGACCTTTGAAGG - Intronic
1048184484 8:132227182-132227204 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1048479280 8:134772967-134772989 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1048632163 8:136256157-136256179 CTGTACTCACAGGAATTGGAAGG - Intergenic
1048730228 8:137431879-137431901 CTGAAGTCTCAGTTCTTGGAAGG + Intergenic
1048814066 8:138314755-138314777 CTGTAGTCTCAGTTACTTGAAGG + Intronic
1049635362 8:143685265-143685287 CTGTAATCTCAGCTCTTGGGAGG + Intronic
1049696899 8:143988586-143988608 CTGTAATCCCAGCTATTGGGGGG - Intronic
1049932218 9:468372-468394 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1049958992 9:720464-720486 CTGTAGTCCTAGCTATTGGGAGG - Intronic
1049967183 9:790399-790421 CTGTAGACTCAGCTATTCAAGGG - Intergenic
1050104519 9:2151609-2151631 CTGTAATCCCAGCTATTGGGAGG + Intronic
1050373560 9:4947464-4947486 CTGTAATCTCAGAAACTGGAAGG - Intergenic
1050377442 9:4987288-4987310 CAGGTGTCTCAGATATGGGAAGG + Intronic
1050407320 9:5323228-5323250 CTGGAGTCTCATATTTTGGTGGG + Intergenic
1050414319 9:5399177-5399199 CTGGAGTCTCATATTTTGGTGGG + Intronic
1050985295 9:12075075-12075097 CTGTAGTCTCTGTTCTTTGAAGG - Intergenic
1051144384 9:14010877-14010899 CTGTAGTCCCAGCTACTGGTTGG - Intergenic
1051234764 9:14987610-14987632 CTGTAATCTCAGCATTTGGAAGG + Intergenic
1051493408 9:17692521-17692543 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1051508238 9:17848384-17848406 CTGAATTCTCAGATTGTGGAAGG - Intergenic
1051647538 9:19283716-19283738 CTGTAGTCCCAGCTACTGGCGGG - Intronic
1051718199 9:20008016-20008038 CTGTAGTCTCAGCTACTCGGGGG - Intergenic
1051732579 9:20162130-20162152 CTGTAGTCTCAGGTATTCCAGGG + Intergenic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1051963563 9:22798587-22798609 CAGCAGTCGTAGATATTGGATGG - Intergenic
1052304489 9:26991341-26991363 CTGTAGTCTCAGCTACTTGGAGG - Intronic
1052629845 9:31023303-31023325 CTGTAGTCCCAGATACTAGGGGG - Intergenic
1052677811 9:31649545-31649567 ATATAGACTCAGAAATTGGATGG - Intergenic
1052934956 9:34085377-34085399 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1052936252 9:34095508-34095530 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1052937336 9:34103730-34103752 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1052957018 9:34260846-34260868 CTGTAGTCCCAGATACTCCAGGG + Intronic
1053079053 9:35159543-35159565 CTGTAATCCCAGCTATTCGAAGG - Intergenic
1053330296 9:37199825-37199847 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1053331085 9:37208205-37208227 CTGTAATCTCAGCTATTCGAGGG - Intronic
1053401994 9:37833008-37833030 CTGTAGTCCCAGCTATTGAGAGG - Intronic
1054384240 9:64530825-64530847 CTGTAATCTCAGCTACTTGAGGG - Intergenic
1055013472 9:71591857-71591879 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1055026887 9:71731606-71731628 CTGTAGTCCCAGCTATTTGGCGG + Intronic
1055177197 9:73334707-73334729 CTGAAGTCTCAGCTACTTGAGGG - Intergenic
1055390359 9:75815271-75815293 CTGTAGCCTTACATAGTGGAAGG + Intergenic
1055499554 9:76889441-76889463 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1055533360 9:77210364-77210386 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1055607421 9:77985185-77985207 CTGTAGTCCCAGCTATAGGCTGG + Intronic
1055650533 9:78402848-78402870 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1055780113 9:79811765-79811787 CTGTAATCTCAGCTACTGGCAGG - Intergenic
1055953180 9:81749790-81749812 CTGTAGTCTCAGCTACTTGAGGG - Intergenic
1056052888 9:82788562-82788584 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1056134093 9:83614226-83614248 CTGTAGTCCCAGCTACTGGATGG - Intergenic
1056179845 9:84071867-84071889 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1056405368 9:86268915-86268937 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1056541430 9:87574797-87574819 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1056728823 9:89146232-89146254 CTGTAGTCTCAGCTACTTGGTGG + Intronic
1056866843 9:90234869-90234891 CTGTAGTCTCAGCTACTCGGAGG + Intergenic
1056916319 9:90749471-90749493 CTGTAGTCTCAGCTACTCGGAGG - Intergenic
1057180608 9:93027840-93027862 CTGTAGTCCCAGATATTTGGGGG - Intronic
1057401765 9:94729445-94729467 CTGTAGTCTCAGGTACTTGGGGG + Intronic
1057733500 9:97632503-97632525 CTGTAGTCCCAGTTACTCGAGGG - Intronic
1058197929 9:102001534-102001556 CTGTAGTCTCAGCTATCAGGAGG - Intergenic
1058488878 9:105473182-105473204 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1058683909 9:107464425-107464447 CTGTAGTCCCAGCTATCAGAAGG + Intergenic
1058690545 9:107516833-107516855 CTGTAGTCTCAGCTACTGGGAGG + Intergenic
1058858377 9:109089136-109089158 CTGTAGTCTCAGCTATCTGAGGG + Intronic
1058954189 9:109930346-109930368 CTGTAGTCCCAGCTACTAGAGGG - Intronic
1059061889 9:111041654-111041676 CTGTAGTCCCAGCTGTTGGGAGG + Intergenic
1059096169 9:111417115-111417137 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1059129323 9:111729222-111729244 CTGTAGTCTCAGCTGGTGGGAGG - Intronic
1059177112 9:112177170-112177192 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1059359439 9:113729356-113729378 CTGTAGTCCCAGCTATTTGCGGG - Intergenic
1059370816 9:113832937-113832959 CTGTAGTCTCAGCTACTAGGAGG - Intergenic
1059663219 9:116421849-116421871 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1059825552 9:118024468-118024490 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
1059936301 9:119314486-119314508 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1060079044 9:120624348-120624370 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1060145675 9:121250458-121250480 CTGTAATCTCAGAATTTGGGAGG - Intronic
1060161224 9:121366962-121366984 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1060193138 9:121605621-121605643 CTGTAGTCCCAGATACTCTAGGG - Intronic
1060196232 9:121625359-121625381 CTGTAGTCTCAGCTACTCGGGGG - Intronic
1060362523 9:122973357-122973379 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1060457556 9:123813217-123813239 CTGTAATCCCACATATTGGGAGG - Intronic
1060670405 9:125464104-125464126 CTGTAGTCCCAGCTATTTGGTGG + Intronic
1060837264 9:126765827-126765849 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1060860986 9:126954677-126954699 CTGTAATCCCAGCTATTCGAGGG + Intronic
1060997120 9:127880867-127880889 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1061220909 9:129251340-129251362 CTGTAGTCCCAGCTATTTGGAGG - Intergenic
1061446933 9:130644154-130644176 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1061471268 9:130827770-130827792 CTGTAATCCCAGCTATTGGGAGG + Intronic
1061528889 9:131194289-131194311 CTGTAGTCCCAGTTATTCGGGGG - Intronic
1061978520 9:134086220-134086242 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1062260706 9:135661735-135661757 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1062372362 9:136246603-136246625 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1062555401 9:137111531-137111553 CTGTAGTCCCAGTTACTGGGAGG + Intronic
1062659632 9:137622782-137622804 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1203747719 Un_GL000218v1:52701-52723 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1203562024 Un_KI270744v1:65285-65307 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1185450728 X:279969-279991 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1185476734 X:419993-420015 CTGTCGTCTCAGCTATTGGGAGG - Intergenic
1185883662 X:3762422-3762444 CTGTAGTCTCAGCTACTTGTAGG + Intergenic
1185938036 X:4281302-4281324 CTGTAGGATCAAATATTAGATGG - Intergenic
1186006865 X:5081782-5081804 CTGTAGTCTCAGCTACCGGGAGG - Intergenic
1186099510 X:6140698-6140720 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1186473835 X:9841935-9841957 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1186621091 X:11240920-11240942 CTGTAGTCCCAGCTACTGGGTGG + Intronic
1186785901 X:12955776-12955798 CTATGGTCTCAAATATTGCATGG + Intergenic
1186987125 X:15029171-15029193 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1187092161 X:16107905-16107927 CTGTAATTTCACATAATGGAAGG - Intergenic
1187186563 X:16992230-16992252 CTGTATCCTCACATACTGGAAGG - Intronic
1187368663 X:18685560-18685582 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1187395164 X:18912954-18912976 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1188409024 X:29848887-29848909 CTGTAGTCCCAGCTATTCGGGGG - Intronic
1189016116 X:37097873-37097895 CTGTAGTCTCAGCTATCAGGAGG + Intergenic
1189087377 X:38040050-38040072 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1189294525 X:39909287-39909309 CTGTAATCCCAGTTATTGGGAGG - Intergenic
1189360358 X:40345157-40345179 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1189558699 X:42171206-42171228 CTGTAGTCTCAGCTACTTGGGGG - Intergenic
1189761884 X:44330132-44330154 CTGTTGTCCCAGCTATTGGGGGG + Intronic
1189804492 X:44721622-44721644 CTGTAATCTCAGCTATTTGCAGG + Intergenic
1189809553 X:44768548-44768570 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
1189828882 X:44950136-44950158 CTGTAGTCCCAGCTACTCGAAGG - Intronic
1190021062 X:46876240-46876262 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1190037135 X:47036019-47036041 CTGTAGTCCCAGATATTCAGGGG + Intronic
1190103382 X:47540463-47540485 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1190121454 X:47663121-47663143 CTATAGTCTCAGCTACTTGAGGG - Intergenic
1190225071 X:48539147-48539169 CTGTAGTCCCAGCTCTTGGGAGG + Intergenic
1190240144 X:48651733-48651755 CTGTAGTCTCAGCTACTTGGGGG + Intergenic
1190309077 X:49103668-49103690 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1190312683 X:49128225-49128247 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1190574652 X:51821511-51821533 CTGTAGTCTCAGCTACTTGGGGG - Intronic
1190827944 X:54034874-54034896 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1191702146 X:64054506-64054528 CTGTAGTCCCAGTTACTTGAGGG + Intergenic
1191764145 X:64678628-64678650 CTGTAGTCCCAGCTATTTCATGG - Intergenic
1192135517 X:68595622-68595644 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1192465831 X:71355169-71355191 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1192467149 X:71365589-71365611 CTGTAGTCCCAGCTGTTGGGGGG - Intergenic
1192490331 X:71570914-71570936 CTGTAGTCCCAGCTACTGGAAGG - Intronic
1192492124 X:71585189-71585211 CTGTAGTCTCAGCTACTTGGGGG + Intronic
1192541558 X:71977541-71977563 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1192577346 X:72253501-72253523 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1192595352 X:72401355-72401377 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1192606096 X:72519710-72519732 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1193554540 X:82936210-82936232 CTTTAGTTTCAGTTATAGGAAGG - Intergenic
1194053270 X:89099841-89099863 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1194062427 X:89221109-89221131 CTGTAGTCTCAGCTACTTGGAGG - Intergenic
1194998844 X:100622257-100622279 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1195280302 X:103326835-103326857 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1195563063 X:106307020-106307042 CTGTAGTCCCAGCCATTGGGAGG - Intergenic
1195662917 X:107398887-107398909 CTGTAGTCACAGCTACTTGAGGG - Intergenic
1195773396 X:108376480-108376502 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1196686880 X:118518447-118518469 CTGTAGTCTCAGCTACTTTAGGG + Intronic
1196759629 X:119189874-119189896 CTGTAAGCTCAGAGCTTGGAAGG - Intergenic
1196826895 X:119748171-119748193 CTGTAGTCCCAGATACTTGGGGG + Intergenic
1197164385 X:123360571-123360593 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1197207079 X:123799588-123799610 CTGTAGTCTCAGCTACTTGTGGG - Intergenic
1197938168 X:131761856-131761878 CTGTAGTCTCAGCTGTTCGGGGG + Intergenic
1198105973 X:133461804-133461826 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1198180118 X:134199262-134199284 CTGTAGTCCCAGATGGTGGCGGG - Intergenic
1198495754 X:137191141-137191163 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1198978819 X:142369580-142369602 CTGTAGTCCCAAATACTGGGAGG + Intergenic
1199313916 X:146354635-146354657 CTATAGTTTCAAATTTTGGATGG - Intergenic
1199327839 X:146522248-146522270 CTCTAGTCCCAGATATTCGGGGG + Intergenic
1199585255 X:149408248-149408270 CTGTATCCTCACATAGTGGAAGG - Intergenic
1199734960 X:150677332-150677354 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1199816722 X:151404020-151404042 CTTTAGTGTCAGATAACGGAAGG + Intronic
1200241199 X:154494980-154495002 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1200716297 Y:6550075-6550097 CTGTAGTCTCAGCTACTTGGAGG - Intergenic
1200764173 Y:7066487-7066509 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1200780434 Y:7210712-7210734 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1200781775 Y:7223150-7223172 CTGTAGTCTCAGCTACTTGGAGG - Intergenic
1200835252 Y:7726099-7726121 CTGCAGTGTCAGATCTGGGAGGG + Intergenic
1201161053 Y:11167686-11167708 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1201637285 Y:16137981-16138003 CTGTAGTCCCAGCTATGGGGAGG + Intergenic