ID: 1168471697

View in Genome Browser
Species Human (GRCh38)
Location 19:56645572-56645594
Sequence CAGGTTCTGAATCTTGTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168471693_1168471697 20 Left 1168471693 19:56645529-56645551 CCTCTGTAATGATTCACTGAATG 0: 1
1: 0
2: 2
3: 13
4: 168
Right 1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 206
1168471690_1168471697 30 Left 1168471690 19:56645519-56645541 CCCTGCTGGCCCTCTGTAATGAT 0: 1
1: 0
2: 0
3: 11
4: 182
Right 1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 206
1168471692_1168471697 21 Left 1168471692 19:56645528-56645550 CCCTCTGTAATGATTCACTGAAT 0: 1
1: 0
2: 2
3: 18
4: 224
Right 1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 206
1168471691_1168471697 29 Left 1168471691 19:56645520-56645542 CCTGCTGGCCCTCTGTAATGATT 0: 1
1: 0
2: 1
3: 17
4: 223
Right 1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168471697 Original CRISPR CAGGTTCTGAATCTTGTGCC TGG Exonic
900865618 1:5266704-5266726 CAAGCTTTGAAGCTTGTGCCTGG - Intergenic
903439376 1:23376027-23376049 CAGGGTCTGACTCTGTTGCCTGG - Intergenic
903594179 1:24481364-24481386 CAGGCAGTGTATCTTGTGCCTGG + Intergenic
903755586 1:25658279-25658301 CAGGTTGTGAACCTGGAGCCAGG + Intronic
904275724 1:29383021-29383043 CAGGGGCTGCATCTTGTCCCTGG + Intergenic
905338892 1:37264837-37264859 AAAATTCTGAATCTAGTGCCTGG + Intergenic
905602944 1:39269615-39269637 CAGGTTCTGTATCTTTAGGCTGG - Intronic
906323742 1:44831783-44831805 CAGCTTCTCAATCATCTGCCAGG + Exonic
908832417 1:68192550-68192572 CAGGTTCTTTCTCTTTTGCCTGG - Intronic
909450369 1:75791546-75791568 CAGGTTCTGAATCCCATGCTGGG + Exonic
911145652 1:94550104-94550126 CAGGCTCTGAAGCTGGTACCAGG - Intergenic
911608549 1:99935863-99935885 CAGGTTCTCAATCTGGTCCATGG - Intergenic
911924549 1:103812129-103812151 CAGGTTCTGCATTTTGGGCATGG + Intergenic
912184688 1:107261158-107261180 CAGGTCCTGGGTCCTGTGCCAGG + Intronic
916873586 1:168943972-168943994 CAGGTTTTGTATCTTTTGCAGGG - Intergenic
919722816 1:200857777-200857799 CAACTTCTTAATCTTGTTCCGGG + Exonic
924483390 1:244456393-244456415 CAGGTGCTGAATCTTCTCTCTGG + Intronic
924951194 1:248885157-248885179 CAGGATCTCACTCTTTTGCCTGG + Intergenic
1065007704 10:21395082-21395104 GAGGTTCGGAATCTTGTGGCTGG - Intergenic
1065507091 10:26439455-26439477 CAAATTATGAAACTTGTGCCTGG - Intronic
1065698638 10:28403417-28403439 CAGGTTCTCATTCTATTGCCAGG - Intergenic
1066262684 10:33744528-33744550 CAGGGTCTCAATCTTGTCCCAGG + Intergenic
1067731663 10:48817252-48817274 CAGGTTCTGAGGATGGTGCCTGG + Exonic
1068102244 10:52569860-52569882 TAGGTTCTTAACCTTGTGGCAGG + Intergenic
1070591328 10:77803912-77803934 CAGGTTCTCACTCTGTTGCCTGG + Intronic
1072627662 10:97123838-97123860 CAGCTGTTGAATCTTGTGACTGG - Intronic
1074774912 10:116760400-116760422 CAGTTTCTGACTCTTGATCCTGG - Intergenic
1075887296 10:125912153-125912175 AAGGATCTGAATCAGGTGCCAGG - Intronic
1076003749 10:126931839-126931861 AAAGTGCTTAATCTTGTGCCTGG + Intronic
1076617998 10:131769575-131769597 CAGGTTCCGGAGCATGTGCCAGG - Intergenic
1076633903 10:131870362-131870384 AAGGTTTTGAAGCTTTTGCCTGG - Intergenic
1081650911 11:44823624-44823646 CAGGTTCTCAATCTGGTCCATGG + Intronic
1082767948 11:57183571-57183593 CAGGTTCTGACTCTTCCGGCAGG - Intronic
1084607972 11:70183667-70183689 CAGGTTGTGCAACTTCTGCCTGG + Intronic
1085152234 11:74261428-74261450 CAGGTTCTTAATCTGGTCCATGG + Intronic
1085848800 11:80096693-80096715 CATGTGCTGATTCTTCTGCCTGG - Intergenic
1086381248 11:86257060-86257082 CAGATTCTGACTCCTTTGCCCGG + Intronic
1087937986 11:104057566-104057588 CAGGTACTGAGCCTAGTGCCGGG - Intronic
1088798616 11:113285888-113285910 CAGGTGCTGTATGTGGTGCCGGG - Intergenic
1088857349 11:113768042-113768064 CAAGGTGTGAATCTCGTGCCTGG - Intronic
1088894153 11:114065076-114065098 CAGGTTCTGAACCTTATTCCTGG + Intronic
1089531773 11:119134527-119134549 CAGGTCCTGAAGTTTGAGCCAGG + Exonic
1089598762 11:119600049-119600071 GTGGTTATGAATCATGTGCCTGG + Intergenic
1090258182 11:125300312-125300334 CAGTTTTTGAATACTGTGCCTGG + Intronic
1090590837 11:128265956-128265978 CAGTTTCAGAATTTTGTGCCAGG - Intergenic
1094125164 12:27015511-27015533 CGGCTTCTGAATCTTCTGCTAGG - Intergenic
1095307146 12:40651739-40651761 CAGGTTCTCAATCTTTTCCCTGG + Intergenic
1097441656 12:59615160-59615182 CAGGTTCAGAATCTGGTGAGAGG - Intronic
1100479695 12:94966033-94966055 CAGGTTCTTACTCTGTTGCCCGG - Intronic
1101497766 12:105272017-105272039 CAGGATCTCAATCTGTTGCCTGG + Intronic
1105936191 13:25101772-25101794 CAGATTCAGTATCTGGTGCCTGG + Intergenic
1106565155 13:30878327-30878349 CAGGTTCTCACTCTGTTGCCTGG + Intergenic
1108710355 13:53027197-53027219 CAGTTTCTGAATAGTGTACCAGG + Intergenic
1110718065 13:78730658-78730680 CAGGTTCTCACTCTTTTGCCTGG + Intergenic
1111668688 13:91301497-91301519 CAGGGTCTCAATCTCTTGCCCGG - Intergenic
1112626253 13:101107512-101107534 CAGGTTCAGAAACTTTTGCCGGG - Exonic
1113303527 13:109050342-109050364 CAGGTTATGAATTTTTGGCCAGG + Intronic
1118187486 14:63550580-63550602 CAGGGTCTAATTCTTTTGCCCGG - Intergenic
1118440694 14:65808928-65808950 CAGGTTCTTAATCTGGTCCATGG + Intergenic
1121199121 14:92102831-92102853 CAGGTTTTGAAACCTCTGCCTGG - Intronic
1121589265 14:95088876-95088898 CAAGTTCAGAATCATGTGCTGGG + Exonic
1121594069 14:95146240-95146262 CAGGTTCTCAATCCGGTCCCTGG - Intronic
1122035988 14:98949810-98949832 CAGGTTCTGTCTCTTCAGCCTGG - Intergenic
1123018938 14:105388597-105388619 CATGTTCTGCACCTGGTGCCGGG + Intronic
1123139200 14:106058813-106058835 CAGGTGCTCAGTCCTGTGCCTGG + Intergenic
1124455665 15:29840553-29840575 CAGGAGCTGAATCTTGGGCATGG + Intronic
1125479540 15:40070530-40070552 CAGGTGCAGAAGCTGGTGCCGGG - Intergenic
1130161062 15:81400712-81400734 CAGGTTCTTCATCTTGTACGTGG + Intergenic
1130847933 15:87764930-87764952 TAGGCTCTGACTCTTGTGCCAGG - Intergenic
1132817577 16:1839856-1839878 CAGGAACTGTGTCTTGTGCCTGG + Exonic
1133500436 16:6361305-6361327 CACCTTCTCAATCTTGTTCCTGG - Intronic
1136113620 16:28080571-28080593 CAGTTTCTGAATCTTGTCTGGGG + Intergenic
1136655811 16:31708533-31708555 CAGGTTCTGTCGCTTGTGCCAGG + Intergenic
1140453543 16:75090728-75090750 CAGGCCCTGAATTTTCTGCCTGG + Intronic
1143614922 17:8044042-8044064 CAGGGTCTGACTCTCTTGCCCGG - Intronic
1144593440 17:16544709-16544731 CAGGTTAGGAATCTTGTGCAGGG - Intergenic
1144745674 17:17612566-17612588 CAGGTACTGAATGGAGTGCCTGG + Intergenic
1145760511 17:27422827-27422849 CAGGTTCTAAGCCCTGTGCCAGG + Intergenic
1145847225 17:28051053-28051075 CAGGTTCTGACTCTGTCGCCCGG - Intronic
1146019281 17:29262686-29262708 CAGGTTCAGAAACTTGTGGTAGG - Exonic
1146796999 17:35788773-35788795 CAGGTCCTGAAACTCCTGCCTGG + Intronic
1147531454 17:41282012-41282034 GATGTTCTGAATCTTGATCCAGG + Intergenic
1147676476 17:42209681-42209703 CAGGGTCTCACTCTTTTGCCCGG - Intronic
1147693979 17:42337799-42337821 CAGCTGCTGCATCTTCTGCCTGG + Exonic
1152221500 17:79070875-79070897 CAGGGTCTCAATCTGTTGCCCGG + Intergenic
1152570224 17:81118423-81118445 CAGGACCTGAAGCTGGTGCCGGG - Exonic
1158009893 18:52716509-52716531 GAGGTTCTGACTCTTGTACTTGG + Intronic
1159896430 18:74001286-74001308 TAGTTTCTGACTCTTGTCCCTGG - Intergenic
1163654655 19:18538670-18538692 CAGGTTCTCACTCTGTTGCCCGG + Intronic
1163953518 19:20613002-20613024 TAGCTCCTGAATCTTGTTCCTGG - Intronic
1164089043 19:21931474-21931496 GAGGTCCTGAATCTTGTACACGG + Intergenic
1164193306 19:22931275-22931297 GAGGTCCTGAATCTTGTACACGG + Intergenic
1164281711 19:23774836-23774858 CAGGTTTTAACTCTTCTGCCTGG + Intronic
1164312315 19:24056846-24056868 CAGGTTTTAATTCTTCTGCCTGG + Intronic
1165580679 19:36860618-36860640 CAGGCTATGAATTTTGTGGCAGG + Intronic
1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG + Intergenic
1166822569 19:45589537-45589559 CAGTGTCTGAATTTTGGGCCGGG - Intronic
1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG + Exonic
1168500175 19:56886180-56886202 AGGCTTCTGAATCTTGTGCTAGG - Intergenic
926173176 2:10566617-10566639 CAGGTTCTCACTCTGTTGCCCGG - Intergenic
929652196 2:43691535-43691557 CAGGTTCTCAATCTGGTTCAAGG + Intronic
930060838 2:47287088-47287110 CATGTTCTGAAACTTGCCCCTGG + Intergenic
930643737 2:53881550-53881572 CAAGTTCAGAAGCTTGTGCAAGG + Intronic
930863005 2:56093891-56093913 CAGCTACTGAAGCTTGTGCATGG - Intergenic
932099793 2:68888292-68888314 CAGGTTCTGCACTTTGTGCTGGG + Intergenic
932302711 2:70678438-70678460 CTGGTTCTGGGTCATGTGCCTGG + Intronic
933032561 2:77349941-77349963 AAGATTCTGAACCTAGTGCCAGG - Intronic
935377325 2:102412775-102412797 CAGGTTAGGAATCCTGTGCAGGG - Intergenic
937198471 2:120180924-120180946 CTGATTCTTAATCTTGTTCCAGG + Intergenic
937683521 2:124669870-124669892 CAGGTGATGCATCTTGGGCCTGG - Intronic
939553068 2:143639363-143639385 CAGGTACTCATTCTTGTGCCTGG + Intronic
942097499 2:172547689-172547711 CAGGTTCTTAATCTGGTTCATGG - Intergenic
943483719 2:188454497-188454519 CAGGTTCTCAATCTGGTCCAAGG + Intronic
944777906 2:202987765-202987787 CAGGGTGTGAATCATGTACCAGG + Intronic
945127813 2:206532203-206532225 CAGATGCTGAATCATGAGCCTGG + Intronic
945370168 2:209006406-209006428 CAAGTTCTCAATCTTGTCCGAGG - Intergenic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
947003011 2:225478876-225478898 CATGATCTGAATATTGTGCAAGG + Intronic
1169026049 20:2372367-2372389 GAGGTTCTGGATCTTATTCCTGG - Intergenic
1169385184 20:5142877-5142899 CAGGTTCTCACTCTGTTGCCCGG + Intronic
1171128435 20:22625531-22625553 CAGGTTCTTGCTCTTTTGCCTGG + Intergenic
1172137089 20:32694124-32694146 CAGGTTCTCACTCTGTTGCCAGG - Intergenic
1172380320 20:34484323-34484345 CAGGTTCTGCATTTCTTGCCTGG + Intronic
1172459708 20:35108120-35108142 CAGGTTCTCACTCTGTTGCCCGG - Intergenic
1174895100 20:54440135-54440157 CAGGGTCTCACTCTGGTGCCCGG + Intergenic
1175551262 20:59819509-59819531 CAGGGTCTCAATCTGTTGCCCGG - Intronic
1180555986 22:16575192-16575214 CAGGGTCTGGCTCTTTTGCCCGG + Intergenic
1181768225 22:25107497-25107519 CAGGTTCTCACTCTGTTGCCCGG + Intronic
1183316193 22:37138105-37138127 CAGCTACTGAATCAAGTGCCAGG - Intronic
1185279454 22:49963736-49963758 CAGGCCCTGATTCCTGTGCCTGG + Exonic
1185373950 22:50473742-50473764 CAGGGGCTGGATCTTGAGCCTGG - Intronic
950522960 3:13507248-13507270 CAGGTTCTGGAGCTGGGGCCTGG - Intergenic
950673666 3:14541594-14541616 CAGGTTCTAAATCTGGGGCAGGG + Intronic
951125045 3:18974661-18974683 CAGGTTCTCACTCTGTTGCCCGG + Intergenic
951255806 3:20448005-20448027 CAGTTTCTCAATCTGGTGCAAGG + Intergenic
953380049 3:42463159-42463181 TTGGATCTGAATCTTGTGTCTGG - Intergenic
955409864 3:58648600-58648622 GAAGTTCTGAATCCAGTGCCTGG + Intronic
955474726 3:59324860-59324882 CATGTTCTGTATCTTGTTTCGGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956557281 3:70538022-70538044 CAGGTTCTCAATCTGGTCCATGG - Intergenic
958918877 3:100080493-100080515 CAGGATCTGAATTTAGTACCTGG + Intronic
959002462 3:100980555-100980577 CAGGTTCTAATTCTTGTGCTTGG - Intronic
959341718 3:105139756-105139778 CAGGGTCTGACTCTGTTGCCCGG + Intergenic
960112472 3:113858418-113858440 CAGGGTCTTAATCTGTTGCCAGG + Intronic
961137791 3:124528021-124528043 CAGATTCTGAATAGTGTGACAGG + Intronic
962315487 3:134356954-134356976 CAGTTTCTGAAACTTCTGACTGG - Exonic
962441078 3:135416617-135416639 CAGGTTCTGTACCATGTGTCAGG + Intergenic
963232833 3:142926226-142926248 CAGTTTCTTAACCTAGTGCCTGG - Intergenic
963476159 3:145807455-145807477 TAGATTCTGAATTTTGTGACAGG + Intergenic
966368665 3:179221730-179221752 CAGGGTCTGGCTCTTTTGCCTGG + Intronic
966885824 3:184377687-184377709 AAGGTTCTGAATCTGGTGCTGGG - Intronic
967741739 3:193010509-193010531 CATGTTCTCAATCTGGTGCCTGG - Intergenic
970915090 4:21322779-21322801 CAGATTTTTAATCTTGTGACAGG - Intronic
971302261 4:25451350-25451372 CAGGGTCTCACTCTAGTGCCCGG - Intergenic
975730325 4:77331547-77331569 CAGGTTACGAATCCTGTGCGGGG + Intronic
975912237 4:79280624-79280646 CAGTTTCTGTTTCTTGTGCCTGG + Intronic
976266977 4:83193969-83193991 CAGCTCCTGAATCTGGTGTCAGG + Intergenic
981559063 4:146027090-146027112 ATGGGTCTGAATCTGGTGCCAGG + Intergenic
981582827 4:146267650-146267672 GAGGTTCTGATGCTTGTGCTGGG - Intronic
983333351 4:166359640-166359662 GAGGTTCTCAATCTGGTGCATGG + Intergenic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
986999827 5:13648867-13648889 CAGGTTTTGAATATTGTGAGAGG - Intergenic
987652950 5:20767861-20767883 CAGGTTCTCAATCTTGTTCGAGG + Intergenic
988742615 5:34093623-34093645 CAGGTTCTCAATCTTGTTCGAGG - Intronic
989247160 5:39267021-39267043 CAGCTACTGAATATTGGGCCTGG - Intronic
990649164 5:57878742-57878764 CAGGGTCTCACTCTTTTGCCCGG + Intergenic
992218031 5:74544830-74544852 CAGGCTCTGCAGCATGTGCCTGG - Intergenic
993938003 5:94026690-94026712 CAAGTTCTCAATCTGGTCCCTGG + Intronic
998208858 5:140178623-140178645 CAGGTTCTGGCTCTGTTGCCTGG + Intronic
999083765 5:148868700-148868722 CAGGGTCTGAATCTGCAGCCAGG + Intergenic
999248079 5:150166308-150166330 CAGGTCCTTAATCTTTTGGCGGG - Intergenic
1003280444 6:4686448-4686470 GAGTTTTTGAATCTTCTGCCTGG - Intergenic
1003374675 6:5564862-5564884 CAGGTTAGGAATCCTGTGCGGGG + Intronic
1004694648 6:18022175-18022197 CAGGTTCTGAATGCTGGGCTTGG - Intergenic
1004707980 6:18142269-18142291 CAGGTTCGTCGTCTTGTGCCAGG - Intronic
1005077097 6:21919120-21919142 CCTGTTCTGGATCATGTGCCAGG - Intergenic
1005860113 6:29893891-29893913 TAGGTTCTGTTTCTTATGCCAGG + Intergenic
1005868052 6:29951515-29951537 TAGGTTCTGTTTCTTATGCCAGG + Intergenic
1006239748 6:32666799-32666821 AAGGTTCTCAATCCAGTGCCTGG + Intronic
1007572214 6:42901100-42901122 CAGGTCCTGAATTTTTTCCCAGG + Intergenic
1009438346 6:63644909-63644931 CAGGTTCTGGCTCTTTTGCCAGG + Intronic
1011748664 6:90433666-90433688 CAGGTTCTCAATCTGGTCCATGG - Intergenic
1015335089 6:132027766-132027788 GAGGTGCAGAACCTTGTGCCAGG + Intergenic
1015746250 6:136513033-136513055 CAGGTTCTCACTCTGTTGCCCGG + Intronic
1016321109 6:142846684-142846706 GAGGTTCTGATTCTTCTACCAGG + Intronic
1016948985 6:149562160-149562182 CAGGGTCTGCATCTTGGCCCTGG + Intergenic
1024242891 7:47448908-47448930 CAGCTGCAGAATCTTGGGCCAGG + Intronic
1027616764 7:80433582-80433604 CAAGTTCTCAATCTAGTCCCAGG - Intronic
1028394081 7:90348191-90348213 CAGGGTCTGGTTCTGGTGCCTGG - Intronic
1029691546 7:102185447-102185469 CAGGGTCTCACTCTTTTGCCTGG + Intronic
1030611896 7:111698738-111698760 TAGGTTCTGTATCTTCTCCCAGG - Intergenic
1031606823 7:123778600-123778622 CAGGTTATGAATCTTTTGGCAGG + Intergenic
1033448162 7:141439846-141439868 CAGGATCTGAACCTTGTGCCTGG - Intronic
1033475961 7:141692818-141692840 CAGGGTCTCACTCTTTTGCCTGG - Intronic
1033539830 7:142346089-142346111 GATGTTCTGAATCTTCTGCCGGG - Intergenic
1034427783 7:151023705-151023727 CAGGTTCTGGATGTGATGCCAGG + Exonic
1034627514 7:152504728-152504750 CAGGGTCTGCATCTGGTGCCAGG - Intergenic
1035083644 7:156238029-156238051 CATGGTCTGAGTCATGTGCCTGG + Intergenic
1037621206 8:20565018-20565040 CAAGTGCTGAATCTTTTTCCAGG + Intergenic
1041036392 8:53795270-53795292 CAGGTTCTGGATCTACTGACTGG - Intronic
1041419269 8:57648267-57648289 CAGGTTTTGCATCTTGCTCCAGG + Intergenic
1042013516 8:64279393-64279415 CATCTTCTGAAACTTGTGACTGG - Intergenic
1042926820 8:73975632-73975654 GAGGTACTGAATCTATTGCCAGG - Intronic
1044244039 8:89920152-89920174 CAGGTTCTGAACCTGGTATCAGG + Intronic
1047151100 8:122264035-122264057 CAGGCACTGCATCTTCTGCCGGG + Intergenic
1048274618 8:133056932-133056954 CAGGTTCTGATTCGTGGGCCTGG + Intronic
1048876825 8:138843191-138843213 CAGCATCTGCATCTTGTGCCTGG - Intronic
1049730343 8:144174239-144174261 CAGGCTCTCAATCTGGTCCCAGG + Intronic
1051338138 9:16085556-16085578 CTGGTTCCAAATCTTGTGCAAGG + Intergenic
1051699736 9:19809011-19809033 GAGGTTCTGAATCTTATTTCTGG + Intergenic
1051801980 9:20945122-20945144 CAGTTTCTGAAGCTTATTCCTGG - Intronic
1052258808 9:26491192-26491214 CAGGTGATGAATGCTGTGCCAGG + Intergenic
1052715071 9:32105801-32105823 CAGCTTGTGAATCTGGGGCCTGG - Intergenic
1053357895 9:37462411-37462433 CAGGTTCTCAATCTGGTCCGTGG - Intronic
1055420235 9:76132693-76132715 CAAGTACTTAACCTTGTGCCTGG - Intronic
1055592324 9:77829973-77829995 CAGGGTCTTACTCTTTTGCCAGG + Intronic
1056093897 9:83231642-83231664 CAGCCTCAGAATCTTGTCCCTGG - Intergenic
1057167984 9:92943250-92943272 CAGATGCTGAAGCTTGTTCCTGG + Intergenic
1061642040 9:131966357-131966379 CAGGGTCTGGCTCTTTTGCCTGG - Intronic
1062139729 9:134949271-134949293 CAGGTTGGGAAAGTTGTGCCAGG - Intergenic
1187228012 X:17392808-17392830 AATGTTCTGTATCTTGTCCCAGG - Intronic
1187730189 X:22244758-22244780 CAGGTTTTAAAGCTTCTGCCAGG + Intronic
1187878746 X:23826739-23826761 CATTTTCTGAATCTTTTGTCAGG - Intergenic
1188649269 X:32611572-32611594 CAGGATCTTAATATTCTGCCAGG - Intronic
1190947951 X:55114186-55114208 CATGTTCTGAGACTTATGCCTGG + Intronic
1191595278 X:62936666-62936688 CAGGTTCTCAATCTGGTCCATGG + Intergenic
1191881159 X:65844856-65844878 CATGTTCTGAATAGTGTACCAGG + Intergenic
1197396361 X:125932350-125932372 CAGGTTCTCAATCTGGTCCATGG + Intergenic
1197827457 X:130605447-130605469 CAGGTTCAGACTATTCTGCCTGG + Intergenic
1198167224 X:134069983-134070005 CAGCTTCTGAATTTCTTGCCTGG - Intergenic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1201269076 Y:12236954-12236976 CAGGTTCTGAACTTAATGCCTGG - Intergenic
1202071031 Y:20991693-20991715 CAAGTTCTGAAATTTATGCCTGG - Intergenic