ID: 1168471725

View in Genome Browser
Species Human (GRCh38)
Location 19:56645726-56645748
Sequence CTCTGCTGCCTCGGGAGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168471721_1168471725 -7 Left 1168471721 19:56645710-56645732 CCTGAGAGGACCAAGACTCTGCT 0: 1
1: 0
2: 2
3: 22
4: 171
Right 1168471725 19:56645726-56645748 CTCTGCTGCCTCGGGAGAGCCGG 0: 1
1: 0
2: 1
3: 17
4: 205
1168471718_1168471725 20 Left 1168471718 19:56645683-56645705 CCTGAGCAGACACGGGGGCTGCT 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1168471725 19:56645726-56645748 CTCTGCTGCCTCGGGAGAGCCGG 0: 1
1: 0
2: 1
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168471725 Original CRISPR CTCTGCTGCCTCGGGAGAGC CGG Exonic
900389640 1:2428361-2428383 CTCTGCGGCTCCTGGAGAGCTGG - Intronic
900488142 1:2933191-2933213 CTCTGGGGCCTCGGGGGTGCAGG + Intergenic
900599185 1:3495907-3495929 CTCTGCCCCCCGGGGAGAGCCGG - Exonic
901085242 1:6607361-6607383 TTCTCCTGCCTCAGGAGAGTAGG + Intronic
901152013 1:7109980-7110002 CTCTGCTGCCTATGGTGAGCCGG + Intronic
901728115 1:11258185-11258207 CTCTGCTTCCTCAGTAGAGCAGG - Intronic
901890344 1:12258279-12258301 TTCTGCTGCCCGAGGAGAGCCGG + Intronic
902511793 1:16970623-16970645 CTCTCCTGCCTAGGTGGAGCGGG + Exonic
904322480 1:29706895-29706917 CTCTGCTGTCCTGGGAGGGCGGG - Intergenic
904376740 1:30086402-30086424 CTCTGCTGTCCTGGGAGGGCGGG + Intergenic
904942842 1:34177153-34177175 CTCTGCTGCCCCCGGAAAGAAGG - Intronic
906777989 1:48547320-48547342 CTCTACTGCCTCTGTACAGCTGG - Intronic
909849626 1:80444271-80444293 CTCTACTGTCTCAGGAGAGAAGG - Intergenic
911177096 1:94827723-94827745 CTCTGCTTTCTCTGGAAAGCTGG + Intronic
912255956 1:108058462-108058484 TTTTGCTGCCTAGGGAGAGGTGG - Intergenic
912972753 1:114299527-114299549 CTCTGCTGCCGCAAGAGGGCTGG - Intergenic
919149756 1:193680782-193680804 CTCTACTGCCTCCCCAGAGCAGG - Intergenic
919401363 1:197121568-197121590 CTAACCTGCCTCTGGAGAGCAGG - Intronic
919794069 1:201310703-201310725 CTGTGCTGCCTGAGGACAGCTGG - Intronic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
920515850 1:206584249-206584271 CTCTGCTGACGTGGGAGAGCTGG - Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921214962 1:212928855-212928877 CTCAGATGCCTTGGGACAGCAGG - Intergenic
921300219 1:213744880-213744902 CTCAGCTGCCTGGGGGGAACAGG + Intergenic
922698734 1:227745625-227745647 CTCAGCTGTCTCGGCACAGCGGG + Intronic
923965993 1:239139884-239139906 TTCTGCTGCCCTTGGAGAGCTGG - Intergenic
1065740131 10:28790205-28790227 CTCAGCTGCCTGGTGGGAGCGGG + Intergenic
1066292001 10:34022790-34022812 CTCTGCTGCCTTCAGGGAGCTGG - Intergenic
1066649129 10:37639026-37639048 GTCTGCTTACACGGGAGAGCTGG + Intergenic
1069409245 10:68135486-68135508 CTCTGATGCTTGGAGAGAGCTGG + Intronic
1069550807 10:69362721-69362743 TCCTGCAGCCTCGGGAGAGAAGG - Intronic
1069994587 10:72334757-72334779 CTGTGCTGCCGCAGGAGGGCAGG - Exonic
1070571612 10:77643944-77643966 CTCCAGTGCCTCGGGAGAGCAGG + Intergenic
1070646247 10:78204280-78204302 CTCTGTAGCCTTGGGAGAGTTGG - Intergenic
1073064600 10:100750584-100750606 CTCCGCTGCCTCGGCCGGGCAGG + Intronic
1073474582 10:103744505-103744527 CTCTGCAGCCTGGGGACTGCAGG + Intronic
1073490849 10:103852379-103852401 CTCTGCTGGCTCCAGAGTGCTGG - Intronic
1075711998 10:124535890-124535912 CTCTGCTCCCTCAGGGGAACTGG + Intronic
1077324045 11:1956043-1956065 CTCTGCTGCAGCGTGACAGCCGG + Intronic
1077409094 11:2395245-2395267 CTCAGCTGCCCCGGGAGTGCTGG - Intronic
1078650258 11:13184686-13184708 CTCGGCTGCCAAAGGAGAGCAGG + Intergenic
1078855794 11:15205811-15205833 CTCTGCTACCTGGGGATAGCTGG + Intronic
1079182905 11:18209326-18209348 CTCTGCTCCCTCCGGAGCTCAGG - Exonic
1082172272 11:49019776-49019798 CTATGCTGCCTGGGGAAACCTGG - Intergenic
1085279163 11:75319183-75319205 CTCTGCTCCCCTGGGCGAGCAGG - Intronic
1088933062 11:114371765-114371787 TTCTCCTTCCTGGGGAGAGCTGG - Intergenic
1089630208 11:119779671-119779693 CTCGGGTGCCTCGGGTGAGAGGG - Intergenic
1090332648 11:125943763-125943785 CCCTGCTGCCTCGGGAGGTGAGG - Intergenic
1202807031 11_KI270721v1_random:11238-11260 CTCTGCTGCAGCGTGACAGCCGG + Intergenic
1091803751 12:3341811-3341833 CTCTGCTGCCTCCGGGGAAGGGG + Intergenic
1093347493 12:18056962-18056984 CTATGCTGACTCGGGGGAGGAGG - Intergenic
1093517714 12:20010035-20010057 CTCTGCTGGCTCGGGTGGCCAGG + Intergenic
1102584262 12:113912153-113912175 CACTGCTGCCTCGGGCTAGGAGG + Intronic
1103240630 12:119410518-119410540 CTCTCCTGCCTCGTGACATCAGG + Intronic
1104404479 12:128506192-128506214 TTCTCCTGCATCTGGAGAGCTGG - Intronic
1104584372 12:130036196-130036218 CTCTGCTTCCACTGGAGATCAGG + Intergenic
1105417813 13:20228198-20228220 CTCTCCTGCTTCTGGAGGGCTGG + Intronic
1106136745 13:26979316-26979338 TTCTGCTGCCTCCAGAGGGCTGG + Intergenic
1110707720 13:78613808-78613830 CACTGCAGCCTCGGGTGGGCTGG - Intergenic
1111549176 13:89784515-89784537 CTTTGCTGTCCCGGGAGAGCTGG + Intergenic
1112261190 13:97879873-97879895 CAGGGCTGCCTCGAGAGAGCAGG - Intergenic
1112643727 13:101306167-101306189 GTCTGCAGCCTCGGGAGCTCTGG - Intronic
1112650313 13:101389555-101389577 CTCTGCTGCCTCTGGACTGCTGG - Intronic
1113201225 13:107868339-107868361 CTCCGCAGCCGCGGGCGAGCTGG + Intergenic
1114296795 14:21337104-21337126 CTCTTCTGCCTGGGGTCAGCTGG + Intronic
1121175713 14:91889329-91889351 CTCAGCTGCTTCTGAAGAGCAGG + Intronic
1122149261 14:99715974-99715996 CTCTGCGGACTGGGGAGGGCGGG + Intronic
1122276147 14:100591793-100591815 CTGTCCTGCCTCGGCAGAGGGGG - Intergenic
1122769881 14:104093201-104093223 CTCTCCTGCCTGGGGATGGCTGG + Intronic
1123068337 14:105629130-105629152 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123072111 14:105646977-105646999 CTCAGGTGCCTCAGGTGAGCAGG - Intergenic
1123092356 14:105747454-105747476 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123097932 14:105775155-105775177 CTCTGCTGCCTCCTGAGCTCAGG + Intergenic
1123110632 14:105865380-105865402 GTCTGCTGTCTGGGGATAGCGGG - Intergenic
1124380870 15:29163693-29163715 CTCTTCTTCCTCGGGAAAACTGG - Intronic
1127531321 15:59846257-59846279 CTGGGCTGCCTCAGCAGAGCCGG - Intergenic
1127734778 15:61830543-61830565 CTCTGCTGCTTCAGGACGGCTGG - Intergenic
1127819626 15:62643690-62643712 CTCTGCTGCCTTCAGAGAGCAGG - Intronic
1129111145 15:73338023-73338045 CTGAGCTGCCTGGGAAGAGCTGG + Intronic
1129188191 15:73923109-73923131 AGCTGCTGCCTCTGGAAAGCGGG - Intergenic
1129333546 15:74839677-74839699 CCCGGCAGTCTCGGGAGAGCAGG + Exonic
1129606480 15:77027734-77027756 CTCTCCTGGCTCTGGAGAGAGGG - Intronic
1131362711 15:91807607-91807629 CTCTTCTTCCTGGGCAGAGCTGG - Intergenic
1131812622 15:96188348-96188370 CTCTGCAGCCTGGGCAGAGGTGG + Intergenic
1134136451 16:11679572-11679594 CTCTGCGGGCACTGGAGAGCTGG + Exonic
1136221697 16:28833495-28833517 CTCTGCTGTCTGTGGTGAGCTGG + Exonic
1136246453 16:28979066-28979088 CCCTGCTGCCTCTTGGGAGCGGG + Intronic
1137876169 16:51998593-51998615 CTCTCCTACCTCAGGAGGGCAGG - Intergenic
1139297921 16:65919112-65919134 CTCTCCTGCCTCCTGTGAGCCGG + Intergenic
1139593743 16:67946806-67946828 CACTGCTGCCACCTGAGAGCTGG - Intronic
1139671851 16:68497554-68497576 CCCTGTGGCCTGGGGAGAGCGGG - Intergenic
1139747151 16:69083737-69083759 CCCTGCTGCCTCTTGAGTGCTGG + Exonic
1139907819 16:70378888-70378910 TTCTTCTGCCTCAGGAGAGTAGG - Exonic
1141649540 16:85385700-85385722 GCCGGCTGCCTCGCGAGAGCGGG - Intergenic
1142602514 17:1061151-1061173 CTGTGCTGCCTGGGGTGTGCCGG - Intronic
1142850508 17:2702419-2702441 TGAGGCTGCCTCGGGAGAGCAGG - Intronic
1143029660 17:3960732-3960754 CTCTGCTGCCTCGCCAGCACAGG - Intronic
1144649968 17:17001307-17001329 TCCTGCTGGCTTGGGAGAGCAGG - Intergenic
1144833639 17:18145243-18145265 CTCTGCGGCCTAGATAGAGCAGG + Intronic
1147450213 17:40499705-40499727 CTCAGCTGTCCCGGGAGGGCGGG - Intronic
1149452604 17:56761502-56761524 CCCTGCTTCCTCAGAAGAGCTGG + Intergenic
1150060514 17:62065129-62065151 CTCTTCTGCCTGGTGAGTGCCGG - Exonic
1150228938 17:63539336-63539358 CTCTGCTTCCTCTGGACTGCTGG + Intronic
1151551317 17:74824083-74824105 CTCAGCTACCTCAAGAGAGCAGG + Intronic
1152821545 17:82440113-82440135 CGCTGCTCCCTCAGGAGACCTGG - Intronic
1153949571 18:10046662-10046684 CACTGCTGCCTGGGGAGACAAGG - Intergenic
1154947952 18:21180943-21180965 AACTGCTGCCTCGGGCAAGCAGG + Intergenic
1160459392 18:79026531-79026553 CTCTGCTGCCACGGCAGGGTGGG - Intergenic
1161462950 19:4409697-4409719 CTGTGCTGCTTTGGGGGAGCAGG - Exonic
1163517945 19:17776088-17776110 CGCTGCTGCCTCGGGGCTGCAGG - Exonic
1163727059 19:18928842-18928864 CACAGCTGCCTCTGGAGAGCAGG - Intronic
1163828095 19:19535046-19535068 CTCTGCTTCCGGGAGAGAGCGGG - Exonic
1164021809 19:21314040-21314062 TTCTGCTGCCTCTCTAGAGCTGG - Intronic
1164690643 19:30208515-30208537 CTCTGCTGGCCCCGGGGAGCTGG + Intergenic
1164877427 19:31701259-31701281 CTCGGCTCCCTGGGGAGAGGTGG + Intergenic
1164937331 19:32224527-32224549 TTCTGCATCCTCGGGCGAGCAGG - Intergenic
1164941128 19:32252917-32252939 CTCAGCTCCCAGGGGAGAGCAGG + Intergenic
1165756891 19:38298720-38298742 CTGTGCTGCTTCGTGCGAGCAGG + Intronic
1166956391 19:46468302-46468324 CTCTCCTGCCTCCGAAGAGAAGG + Exonic
1167320744 19:48796049-48796071 CTCTGCTGCCCCGGGTGCCCTGG - Intronic
1167723178 19:51192856-51192878 CTCTGTGGCCTGGGTAGAGCCGG - Intergenic
1168471725 19:56645726-56645748 CTCTGCTGCCTCGGGAGAGCCGG + Exonic
925143749 2:1567674-1567696 GTCTGCTGCTTTGGAAGAGCTGG - Intergenic
925223886 2:2165081-2165103 TTCTGGTGCCCCTGGAGAGCTGG - Intronic
926139967 2:10362654-10362676 TTCTGCTGCTTTGGGAGAGAAGG + Intronic
927520157 2:23693628-23693650 CTCTGCCACTTAGGGAGAGCAGG - Intronic
927873069 2:26635985-26636007 AACTGCTGCCTTTGGAGAGCAGG - Intronic
929924051 2:46194908-46194930 CACGGCTGCCTGGGGAAAGCTGG + Intergenic
930229518 2:48828447-48828469 CTCTTCTGCCTCTTGAGTGCCGG - Intergenic
931517552 2:63058961-63058983 CTCTGCTGAGTCGGGAAAGATGG - Intergenic
934677031 2:96256886-96256908 CTCAGCAGACTCGGCAGAGCTGG + Intronic
936271070 2:111049457-111049479 CACTGCTGCCTGCGGAGTGCGGG + Intronic
939930896 2:148231413-148231435 CTCTGCTGCTGCGGGAGAGGTGG + Intronic
940711722 2:157170082-157170104 TGCTTCTGCCTCTGGAGAGCTGG - Intergenic
941035483 2:160564095-160564117 CTCAACTGCCTTGGGAGAGTTGG + Intergenic
943029439 2:182668853-182668875 CTCTCCTGCCTCGTGCGAGCCGG + Intergenic
944123492 2:196267119-196267141 CACTGGTGCCTGGGGAGAGCTGG + Intronic
946179758 2:217942332-217942354 CTCTGCTGCCCATGGAGGGCAGG - Intronic
946199644 2:218064375-218064397 CTCTGCTGCCCATGGAGGGCAGG - Intronic
948091977 2:235302302-235302324 TTCTGCTTCCAGGGGAGAGCTGG - Intergenic
948859000 2:240743854-240743876 CTCTGCAGCCTCAAGACAGCTGG + Intronic
1169547464 20:6665350-6665372 CTCTGCTGACTCTGCAGAGTGGG + Intergenic
1173162395 20:40662632-40662654 ATCTGCTCCCTGGGAAGAGCTGG + Intergenic
1174296638 20:49550035-49550057 CTCTTGTGCCTCGGGAGGGATGG - Intronic
1175374781 20:58516411-58516433 CCCTGTTGCCTCTGGAGAGGAGG - Intergenic
1175895841 20:62335261-62335283 AGCTGCAGCCTGGGGAGAGCAGG + Exonic
1175921565 20:62452766-62452788 CTCTGGGGCCTCGGGCGGGCGGG + Intergenic
1176011524 20:62899132-62899154 GTCTGCCGCCTCTGGAGACCGGG - Intronic
1176127373 20:63482075-63482097 CTCAGCTGCCTGGGGGGAGGGGG - Intergenic
1176243550 20:64086048-64086070 CACTGCTGCTTCTGGAGACCAGG - Intronic
1177656682 21:24025745-24025767 CTCTGTGGCCTCTGGAAAGCAGG - Intergenic
1179192769 21:39137332-39137354 CTCTGCTGACTCAGGAGTGTGGG - Intergenic
1179564241 21:42236438-42236460 CTTTGCTGTCTCTGGAGACCAGG + Intronic
1181043744 22:20204951-20204973 CTGTGCTGGCTCGGGAAACCGGG + Intergenic
1181500694 22:23314079-23314101 CTGGGCTGCCATGGGAGAGCTGG - Intronic
1182689585 22:32149250-32149272 ATCTGCTGCATCTGAAGAGCTGG - Exonic
1183472505 22:38017055-38017077 CACAGCTGCCTCAGGAGGGCTGG - Intronic
1184036287 22:41919860-41919882 CTCTGCGCCCTCGGGAGTCCGGG - Intergenic
1184664319 22:45979150-45979172 CTCGGTTTCCCCGGGAGAGCGGG + Intergenic
1184779071 22:46637192-46637214 CTCTGCAGCCTGAGGAGATCAGG + Intronic
952341409 3:32450652-32450674 CTCTGCTGTCTCTGAAGAGAGGG + Intronic
954124228 3:48519240-48519262 TTCTGCTGCCTCTGGTGAGAGGG - Exonic
956635101 3:71356035-71356057 CTGTGCTGACTCGGCAAAGCAGG - Intronic
961628097 3:128277582-128277604 CTATGCTGCCCCAGGAGGGCAGG - Intronic
962273344 3:133994347-133994369 CCATGCTGCCTGGGGTGAGCGGG + Intronic
966038689 3:175452890-175452912 CTCTGTTTCCTGGGGAGTGCAGG + Intronic
967228941 3:187319416-187319438 CTCAGCTGCCTTGGGAAAGACGG + Intergenic
967566540 3:190979852-190979874 CTATGCTGCCTCGGGACATAGGG + Intergenic
971351835 4:25862664-25862686 CTCTGCTACCTGGTGAGCGCCGG - Exonic
973980596 4:56305415-56305437 CCCTGCAGCCTTGGGAGAGGGGG - Intronic
977941197 4:102861184-102861206 CTCTGCTGCCTTGGAGGAGAAGG + Intronic
978335553 4:107664561-107664583 CTCTGCTTCCTCTGAAGAGATGG + Intronic
982026650 4:151258630-151258652 CCCTGCTGTCCTGGGAGAGCAGG - Intronic
982028583 4:151276932-151276954 CCCTGCTGTCCTGGGAGAGCAGG - Intronic
982438618 4:155406929-155406951 CTATGCTGCCTTGGGAAAGAGGG - Intergenic
984940975 4:184932279-184932301 CTCTGCTGCCTTGGGAGAAGGGG + Intergenic
987657441 5:20824157-20824179 CACTGTTGCCTCAGGAGTGCAGG + Intergenic
988766103 5:34379789-34379811 CACTGTTGCCTCAGGAGTGCAGG - Intergenic
997597940 5:135119573-135119595 CTCTGCTGCCTCTACAGACCTGG - Intronic
998189306 5:140009217-140009239 CTCTGCTGCTGCTGCAGAGCTGG + Intronic
999529316 5:152444885-152444907 CTCTGCTGGCTTGGCTGAGCTGG + Intergenic
1001693865 5:173654667-173654689 CTCTCCTGCCTCCGGACATCAGG + Intergenic
1002062855 5:176636618-176636640 CTCTGAGGCCTCTGGACAGCAGG - Intronic
1002455310 5:179342880-179342902 CTCTGCTTCCTGGAGAGGGCAGG - Intronic
1003121342 6:3321295-3321317 CTCTGCAGTCTGGGTAGAGCTGG - Intronic
1007685528 6:43665251-43665273 CTCTGCTGTCTCGGGTAAGGTGG + Intronic
1011745497 6:90403901-90403923 GTCTGCAGCCTCCGGGGAGCTGG - Intergenic
1018061487 6:160093124-160093146 ATCTGATTCCACGGGAGAGCTGG - Intronic
1019898122 7:3998821-3998843 CTCCACTGCCTAGGGAGTGCTGG + Intronic
1020720576 7:11739790-11739812 CTCTGCTTTCTGGGGAAAGCAGG - Intronic
1021233352 7:18111939-18111961 TTATGCTGCCTTGAGAGAGCTGG + Intronic
1021998521 7:26202230-26202252 CGCCGCAGCCTCGGGACAGCCGG - Intronic
1022095741 7:27139900-27139922 CTCTGCTGCCTCCGCAGAGTTGG + Intronic
1022501646 7:30885719-30885741 CCCTGCTGCCTTGTGAGAGTTGG + Intronic
1023761847 7:43471554-43471576 CTCTGCTGCTTCAGGAGGACCGG + Intronic
1031317514 7:120274714-120274736 CTCTCCTGCCTCGGGGGAGCCGG - Exonic
1032194096 7:129779930-129779952 CTCCGCTGCCCCGCGAGAGGGGG + Intergenic
1035441253 7:158902890-158902912 CTCAGCTCCCTCTGGAGAACAGG - Intronic
1036490476 8:9220668-9220690 CTCTGCTGTATCTGGAGAGCAGG + Intergenic
1036669680 8:10774041-10774063 TTGTCCTGCCTCTGGAGAGCAGG - Intronic
1037805175 8:22054864-22054886 CCCTGCTGCCGCGGCTGAGCCGG + Intronic
1039895521 8:41714115-41714137 CCCAGCTGCCCCTGGAGAGCAGG - Intronic
1042151339 8:65789021-65789043 CTCTTTTGCCTCGGGACAGCTGG - Intronic
1043448987 8:80348027-80348049 CTCTGCTGCCCCAGCAGTGCAGG - Intergenic
1045922219 8:107544771-107544793 CTCTGGTGCCGTGGGAGAGAAGG + Intergenic
1047013235 8:120695130-120695152 CACTGCTGCCTCAGGAGATTGGG + Intronic
1047527511 8:125646152-125646174 CTCTTCTGCCTCTGCAGGGCAGG + Intergenic
1047929501 8:129712820-129712842 CTCTCCTGCCTTGGGGCAGCAGG + Intergenic
1048816605 8:138340096-138340118 CTCAGCTGTCTATGGAGAGCAGG + Intronic
1049273870 8:141709943-141709965 CCCGGCTGGCTCTGGAGAGCCGG - Intergenic
1049403922 8:142443252-142443274 CTCTGCTCCCCCGGAAGGGCAGG - Intergenic
1049442844 8:142617125-142617147 CACTGCAGCCTCGGGAAAGGAGG + Intergenic
1049724174 8:144137856-144137878 CGCTGGCGCCTCGGGAGGGCCGG + Exonic
1053055243 9:34989930-34989952 CTCTGCTGCCTTGGGGATGCGGG + Intronic
1054706393 9:68466921-68466943 CTCTTCTGCCTCTGGGGAGAGGG - Intronic
1054785081 9:69202730-69202752 CTCTGCCGCCTGGGCACAGCAGG - Intronic
1056249441 9:84732986-84733008 CTGTGCTGCCTCTGGACTGCAGG + Intronic
1060945955 9:127569279-127569301 CTCCGCTGCCTCCGGCGGGCGGG + Intronic
1061797702 9:133098033-133098055 CTCTGCTCCCAGGGGAGGGCTGG + Exonic
1062358688 9:136177320-136177342 CGCAGCTTCCTCGGCAGAGCTGG - Intergenic
1185623126 X:1465489-1465511 CTCTCCTGCCTCTGGAGGCCGGG + Exonic
1185761074 X:2690608-2690630 CTCTGCTCCCACTGCAGAGCAGG + Intergenic
1189310331 X:40013723-40013745 CTCCGCTGCCAGGGGAGAACAGG + Intergenic
1198601513 X:138289053-138289075 CTCTGCTGGCTGGGGAGAAGAGG + Intergenic