ID: 1168475704

View in Genome Browser
Species Human (GRCh38)
Location 19:56673573-56673595
Sequence CTAGGGGAACAGATGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168475694_1168475704 4 Left 1168475694 19:56673546-56673568 CCCAGACTGGGCTGGCCCCTGAG No data
Right 1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG No data
1168475690_1168475704 26 Left 1168475690 19:56673524-56673546 CCGAGGATGAGGGAAAGGGTGGC 0: 1
1: 1
2: 2
3: 27
4: 250
Right 1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG No data
1168475695_1168475704 3 Left 1168475695 19:56673547-56673569 CCAGACTGGGCTGGCCCCTGAGA No data
Right 1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168475704 Original CRISPR CTAGGGGAACAGATGGTGCT GGG Intergenic
No off target data available for this crispr