ID: 1168475735

View in Genome Browser
Species Human (GRCh38)
Location 19:56673703-56673725
Sequence CCTACCCAGGGACCCCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168475735_1168475751 23 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475751 19:56673749-56673771 GCTTTGGTGCTTTCTGGTGATGG 0: 1
1: 0
2: 1
3: 32
4: 260
1168475735_1168475748 7 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475748 19:56673733-56673755 GGGTGGGGTGCCAGGGGCTTTGG No data
1168475735_1168475747 1 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475747 19:56673727-56673749 TGGAGTGGGTGGGGTGCCAGGGG No data
1168475735_1168475746 0 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475746 19:56673726-56673748 ATGGAGTGGGTGGGGTGCCAGGG No data
1168475735_1168475742 -10 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475742 19:56673716-56673738 CCTGGGTAGGATGGAGTGGGTGG No data
1168475735_1168475750 17 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475750 19:56673743-56673765 CCAGGGGCTTTGGTGCTTTCTGG No data
1168475735_1168475745 -1 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475745 19:56673725-56673747 GATGGAGTGGGTGGGGTGCCAGG No data
1168475735_1168475743 -9 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475743 19:56673717-56673739 CTGGGTAGGATGGAGTGGGTGGG No data
1168475735_1168475744 -8 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475744 19:56673718-56673740 TGGGTAGGATGGAGTGGGTGGGG No data
1168475735_1168475752 24 Left 1168475735 19:56673703-56673725 CCTACTTGGGGTCCCTGGGTAGG No data
Right 1168475752 19:56673750-56673772 CTTTGGTGCTTTCTGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168475735 Original CRISPR CCTACCCAGGGACCCCAAGT AGG (reversed) Intergenic
No off target data available for this crispr