ID: 1168476615

View in Genome Browser
Species Human (GRCh38)
Location 19:56680420-56680442
Sequence CCTGCTAACGGTGAGTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168476615_1168476622 -5 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476622 19:56680438-56680460 GCAGGAGTGTTGTGGGGAGTGGG No data
1168476615_1168476626 5 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476626 19:56680448-56680470 TGTGGGGAGTGGGCAGGAAGGGG No data
1168476615_1168476621 -6 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476621 19:56680437-56680459 AGCAGGAGTGTTGTGGGGAGTGG No data
1168476615_1168476627 28 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476627 19:56680471-56680493 TATGTAGAAAGAAATGACTGAGG No data
1168476615_1168476623 -1 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data
1168476615_1168476625 4 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476625 19:56680447-56680469 TTGTGGGGAGTGGGCAGGAAGGG No data
1168476615_1168476624 3 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476624 19:56680446-56680468 GTTGTGGGGAGTGGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168476615 Original CRISPR CCTGCTAACGGTGAGTTTTA TGG (reversed) Intergenic
No off target data available for this crispr