ID: 1168476623

View in Genome Browser
Species Human (GRCh38)
Location 19:56680442-56680464
Sequence GAGTGTTGTGGGGAGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168476615_1168476623 -1 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data
1168476607_1168476623 27 Left 1168476607 19:56680392-56680414 CCAGGCACTGGACCCCAACCAGG No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data
1168476610_1168476623 15 Left 1168476610 19:56680404-56680426 CCCCAACCAGGTTGGCCCATAAA No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data
1168476612_1168476623 13 Left 1168476612 19:56680406-56680428 CCAACCAGGTTGGCCCATAAAAC No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data
1168476614_1168476623 0 Left 1168476614 19:56680419-56680441 CCCATAAAACTCACCGTTAGCAG No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data
1168476613_1168476623 9 Left 1168476613 19:56680410-56680432 CCAGGTTGGCCCATAAAACTCAC No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data
1168476611_1168476623 14 Left 1168476611 19:56680405-56680427 CCCAACCAGGTTGGCCCATAAAA No data
Right 1168476623 19:56680442-56680464 GAGTGTTGTGGGGAGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168476623 Original CRISPR GAGTGTTGTGGGGAGTGGGC AGG Intergenic
No off target data available for this crispr