ID: 1168476627

View in Genome Browser
Species Human (GRCh38)
Location 19:56680471-56680493
Sequence TATGTAGAAAGAAATGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168476615_1168476627 28 Left 1168476615 19:56680420-56680442 CCATAAAACTCACCGTTAGCAGG No data
Right 1168476627 19:56680471-56680493 TATGTAGAAAGAAATGACTGAGG No data
1168476614_1168476627 29 Left 1168476614 19:56680419-56680441 CCCATAAAACTCACCGTTAGCAG No data
Right 1168476627 19:56680471-56680493 TATGTAGAAAGAAATGACTGAGG No data
1168476619_1168476627 16 Left 1168476619 19:56680432-56680454 CCGTTAGCAGGAGTGTTGTGGGG No data
Right 1168476627 19:56680471-56680493 TATGTAGAAAGAAATGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168476627 Original CRISPR TATGTAGAAAGAAATGACTG AGG Intergenic
No off target data available for this crispr