ID: 1168481023

View in Genome Browser
Species Human (GRCh38)
Location 19:56719693-56719715
Sequence CTGCTGGGATGGAGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168481018_1168481023 -7 Left 1168481018 19:56719677-56719699 CCATGTGTTATGGATACTGCTGG No data
Right 1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG No data
1168481014_1168481023 7 Left 1168481014 19:56719663-56719685 CCCCTTAGCATGTGCCATGTGTT No data
Right 1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG No data
1168481016_1168481023 5 Left 1168481016 19:56719665-56719687 CCTTAGCATGTGCCATGTGTTAT No data
Right 1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG No data
1168481015_1168481023 6 Left 1168481015 19:56719664-56719686 CCCTTAGCATGTGCCATGTGTTA No data
Right 1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168481023 Original CRISPR CTGCTGGGATGGAGGAAAGA TGG Intergenic
No off target data available for this crispr