ID: 1168489214

View in Genome Browser
Species Human (GRCh38)
Location 19:56794036-56794058
Sequence CAAAATATACATATGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1136
Summary {0: 1, 1: 0, 2: 8, 3: 90, 4: 1037}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168489214_1168489217 10 Left 1168489214 19:56794036-56794058 CCCTTTTCCATATGTATATTTTG 0: 1
1: 0
2: 8
3: 90
4: 1037
Right 1168489217 19:56794069-56794091 ATTAGCTGTATTATAGTTGTAGG 0: 1
1: 0
2: 2
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168489214 Original CRISPR CAAAATATACATATGGAAAA GGG (reversed) Intronic
902720248 1:18299473-18299495 GAAAATATACAGAGGGAGAAGGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904222380 1:28982935-28982957 AAAAATATAATTCTGGAAAAAGG - Intronic
904225807 1:29018158-29018180 CAAAATATAAAGAGAGAAAAAGG - Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904570108 1:31457545-31457567 TAAAATATACTTTTGGTAAAAGG - Intergenic
904713063 1:32445950-32445972 TAAAATATACTTTTGGTAAAAGG - Intergenic
904876277 1:33656966-33656988 CAAAATAGACATGTGGAAGTGGG + Intronic
905053111 1:35069487-35069509 CAAACTATACATCTGACAAAAGG - Intronic
905061910 1:35147265-35147287 TAAAATATACCTTTGGTAAAAGG - Intergenic
905104830 1:35558041-35558063 AAAAAGATATATATTGAAAAGGG - Exonic
905499270 1:38423796-38423818 AAAAAAATATATATGCAAAAAGG + Intergenic
906387369 1:45382235-45382257 CAAAAAATATATAGTGAAAACGG - Intronic
906950120 1:50327916-50327938 CAAAATCCAAATGTGGAAAATGG + Intergenic
907265269 1:53255571-53255593 CAACAGATACTGATGGAAAAAGG - Intronic
907764265 1:57393017-57393039 TAAAAAATACATTTTGAAAAAGG - Intronic
907852807 1:58272762-58272784 CAAAAGAGACAAATGGTAAAGGG - Intronic
908133963 1:61109126-61109148 CAAAAATTACATGAGGAAAAAGG - Intronic
908999222 1:70198090-70198112 CAAACTATACATATTGAATAGGG + Intronic
909298203 1:73978657-73978679 AAAAACAGACATATAGAAAAAGG - Intergenic
909504427 1:76372133-76372155 CAAAGTACACTTATGGAACAAGG - Intronic
909587363 1:77305113-77305135 GACAATATACAAATGGCAAACGG - Intronic
910044486 1:82895015-82895037 CAAGATATACATTTTGGAAATGG - Intergenic
910248377 1:85167380-85167402 CAAAATCTAAATATACAAAAGGG + Intronic
910807216 1:91200761-91200783 AAAAATATACATGTCGACAATGG - Intergenic
910808188 1:91209559-91209581 CAAAATATACTTTTGGTAAAAGG - Intergenic
910863894 1:91769683-91769705 TAAAATACACACATGGAAACAGG - Intronic
910900734 1:92117891-92117913 CAAAATATGACCATGGAAAAAGG - Intronic
911592491 1:99764240-99764262 CAAAATATACATAACTTAAAAGG + Intronic
911665823 1:100550157-100550179 AAAAACATACATTGGGAAAAGGG - Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
912047834 1:105482812-105482834 CAATATATACATTTTAAAAATGG + Intergenic
912171497 1:107106030-107106052 GAAAGAATACAAATGGAAAAAGG - Intergenic
912610458 1:111037380-111037402 GAAAATGTACATATGCATAATGG + Intergenic
912789116 1:112633986-112634008 CAAACTATACATCTGATAAAGGG - Intronic
912950899 1:114119517-114119539 CACAATAACCTTATGGAAAAGGG + Intronic
912971056 1:114283501-114283523 CAAAATATACACATATGAAATGG + Intergenic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
913269161 1:117075990-117076012 GAAAATATAAATAGGGGAAAAGG - Intronic
914387488 1:147184797-147184819 CAAAAATTACATATGGAAAGGGG - Intronic
915264119 1:154703281-154703303 CAAAATAAACATTAGGGAAATGG - Exonic
915873212 1:159584331-159584353 AAAAATATATATATAGAATATGG - Intergenic
916028021 1:160852004-160852026 CAATACATACATTTGAAAAAGGG + Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917093787 1:171380435-171380457 GAATATATACATCTGGCAAATGG - Intergenic
917311870 1:173687179-173687201 TAAAATATACTTTTGGTAAAAGG - Intergenic
917552648 1:176050578-176050600 CAAAATATACGTTTAGAAACTGG + Intronic
917616172 1:176746824-176746846 ATAAATATCCATATGGAAACTGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918283788 1:183031938-183031960 AAAAAAACACATATGTAAAAGGG + Intronic
918572877 1:186019275-186019297 CCAAATATACATGTGGATTACGG + Intronic
918637162 1:186791573-186791595 CAACACATACATTTGAAAAAAGG + Intergenic
918798793 1:188943127-188943149 ATAAATATACATATGTAAATAGG - Intergenic
919102431 1:193111001-193111023 GACAATATACAAATGGGAAATGG - Intergenic
919444925 1:197691196-197691218 CAAACCATACATATGATAAAGGG + Intronic
919555088 1:199042141-199042163 CTAATTATAGATATTGAAAAAGG + Intergenic
919624354 1:199896613-199896635 CAAAATATAAATATCCCAAAAGG - Intergenic
919706736 1:200683512-200683534 CCATATGTACATATGGAGAATGG - Intergenic
920579502 1:207092372-207092394 ATAAATATACCTATAGAAAAGGG + Intronic
921052278 1:211519272-211519294 CAAAAAATACATATCCAGAATGG + Intergenic
921457248 1:215386833-215386855 GAAAATATACATATACACAATGG + Intergenic
921611698 1:217219733-217219755 CATACCATACATAAGGAAAAGGG - Intergenic
921760483 1:218908177-218908199 TAAAATATACATATACACAATGG - Intergenic
921816753 1:219572643-219572665 CAAACCATACATCTGGATAAGGG + Intergenic
921860461 1:220037521-220037543 AAAAATAGAAAGATGGAAAATGG + Intronic
921927142 1:220720471-220720493 TAAAATATACCTTTGGTAAAAGG + Intergenic
923800402 1:237203727-237203749 GAAAATATACATATATTAAATGG + Intronic
924735438 1:246751504-246751526 TAAAATATACTTTTGGTAAAAGG - Intronic
1063239330 10:4152126-4152148 CAAAATATACAAATCCAACATGG - Intergenic
1063302263 10:4860989-4861011 AAAATTATACAAATGGCAAAGGG - Intergenic
1063772256 10:9216956-9216978 CAAATTATACATATAGAAAATGG + Intergenic
1065281088 10:24139228-24139250 CCAAATATATATATTAAAAATGG - Intronic
1065405758 10:25361879-25361901 CAAATCATATATATGAAAAAGGG - Intronic
1065410845 10:25425816-25425838 CACAATAAAAATATAGAAAAAGG - Intronic
1065484303 10:26222142-26222164 CAAAATATATATAGGGAGGAAGG + Intronic
1065582755 10:27188096-27188118 CAAAATGTACAAATTTAAAATGG + Intergenic
1065757243 10:28942730-28942752 TAAAATATTCAGTTGGAAAATGG - Intergenic
1066035615 10:31479776-31479798 TAAAAGAATCATATGGAAAAAGG + Intronic
1066798471 10:39154401-39154423 CAAAATATCCATTTGCAGAATGG - Intergenic
1066931276 10:41762771-41762793 CAAAATATCCATTTGCAGAATGG - Intergenic
1067496552 10:46765818-46765840 ACAAACATACATATGGAAAAAGG + Intergenic
1067598103 10:47574584-47574606 ACAAACATACATATGGAAAAAGG - Intergenic
1067956770 10:50800024-50800046 TAAAATTTACATTTGTAAAAAGG + Exonic
1068107630 10:52638848-52638870 CAAAAAATGAAGATGGAAAATGG - Intergenic
1068110946 10:52680425-52680447 GACAGTATCCATATGGAAAATGG - Intergenic
1068438948 10:57026789-57026811 CATAATTTACAAATGGCAAAGGG + Intergenic
1068671891 10:59731704-59731726 TAAAATATACCTTTGGTAAAAGG - Intronic
1068750110 10:60582716-60582738 CAAACTATACATCTGAAAATGGG - Intronic
1068832454 10:61512055-61512077 CAAAAAATCCATATGGATCAGGG + Intergenic
1068832502 10:61512766-61512788 CAAAATATACATGTTACAAAAGG - Intergenic
1069356358 10:67590707-67590729 CAAAATGAACAAAAGGAAAATGG - Intronic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1069991326 10:72318264-72318286 CAATAAATATATATGGAAAGGGG - Intergenic
1070074130 10:73118654-73118676 CAAAATGAAAATGTGGAAAAAGG - Intronic
1071074298 10:81732688-81732710 CAAAAGAAACACATGGAAGAAGG + Intergenic
1071238340 10:83675878-83675900 AAACATATTCATATGGAAGAGGG - Intergenic
1071283227 10:84121913-84121935 TAAAATATACCTTTGGTAAAAGG - Intergenic
1071351115 10:84746318-84746340 CAAATTATACAGAGAGAAAATGG - Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1071952982 10:90726184-90726206 CAAAATATACATGTGGTCTATGG + Intergenic
1072126795 10:92452994-92453016 CAAAATTGAGATTTGGAAAATGG + Exonic
1072334654 10:94387052-94387074 TAAAATATACCTTTGGTAAAAGG + Intergenic
1072381063 10:94870938-94870960 CAAACTATTCATCTGAAAAAGGG + Intergenic
1073530618 10:104228837-104228859 AAAAATATAGCTATGGGAAAGGG - Intronic
1073804255 10:107079384-107079406 CAAACTACACATATTTAAAATGG + Intronic
1073843406 10:107524761-107524783 CAAATTATACACATGGCAATAGG - Intergenic
1073846393 10:107560466-107560488 TAAAATATATATATGTATAATGG + Intergenic
1074315569 10:112358354-112358376 GAAAGTATACATATGGAAGGTGG - Intergenic
1074583293 10:114741712-114741734 CAAAATAAGTATATGGATAAAGG + Intergenic
1074928404 10:118097778-118097800 TAAAACATACATATTAAAAAAGG + Intergenic
1075116827 10:119633862-119633884 CCAAACATAAATAAGGAAAATGG + Intergenic
1075217326 10:120547647-120547669 CGATAAATACAGATGGAAAAAGG - Intronic
1076146005 10:128122541-128122563 CAAAATATACACAGAGAAAAAGG - Intronic
1077762741 11:5121284-5121306 CAAAATATATCTCTGGCAAATGG + Intergenic
1077917386 11:6620203-6620225 CCAAAAATCCATATGGAAGATGG + Intergenic
1077997934 11:7469881-7469903 CAAAGGATAGGTATGGAAAATGG + Intergenic
1078113588 11:8422796-8422818 AAAATCTTACATATGGAAAAGGG - Intronic
1078263566 11:9735119-9735141 AAAAATATACAAATATAAAAAGG + Intronic
1078700938 11:13682073-13682095 AAAAATATATATCTTGAAAAAGG + Intronic
1078817366 11:14839183-14839205 CAAACTATACATTCAGAAAATGG - Intronic
1079169843 11:18082560-18082582 GAAAATACAAATATGGAAAAGGG + Intronic
1079682678 11:23318278-23318300 CAAAATATACACAAGCAAACTGG - Intergenic
1079841842 11:25412385-25412407 CAGTATATACATTTGAAAAAGGG - Intergenic
1079903272 11:26214683-26214705 CAATATGTTAATATGGAAAATGG - Intergenic
1080140891 11:28918687-28918709 AAAAAAATATATATGGAAGAAGG + Intergenic
1080143169 11:28946896-28946918 CAAAACATAAATAAGCAAAAGGG - Intergenic
1080184307 11:29461839-29461861 CAAAATCTGAATATGGAAACAGG - Intergenic
1080900657 11:36487186-36487208 CAAAAGATAAATATGGTAAAAGG + Exonic
1080993107 11:37565386-37565408 TAAAATATACATATATATAAGGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081514669 11:43815151-43815173 CAGAATATACATATCCCAAAGGG + Intronic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082096507 11:48135034-48135056 TATAATATACATACCGAAAAGGG + Intronic
1082144641 11:48652100-48652122 CAAAATGTCCATTTGCAAAATGG - Intergenic
1082196098 11:49308068-49308090 CAAAAATTACATAAGGATAAAGG - Intergenic
1082301845 11:50515501-50515523 CCGAATATCCATTTGGAAAATGG + Intergenic
1082311805 11:50658991-50659013 CAAAATATACATTCGTAGAAGGG - Intergenic
1082569000 11:54714810-54714832 AAAAATATACATAAGTAAATTGG - Intergenic
1082594901 11:55065706-55065728 CAAAATATCCATTTGCAGAACGG + Intergenic
1082596969 11:55094270-55094292 CAAAATATCCATTTGCAGAATGG - Intergenic
1082669654 11:56018878-56018900 CAAATTATATATATGGAGAGGGG + Intergenic
1083701569 11:64482500-64482522 TTAAATATGCATATGAAAAAGGG - Intergenic
1083740537 11:64708734-64708756 TAAAATATACATTAGAAAAATGG - Intronic
1085059920 11:73436042-73436064 CAAAAAATACAAATACAAAAGGG - Intronic
1085239684 11:75042567-75042589 TAAAATATACCTCTGGTAAAAGG + Intergenic
1085242788 11:75072445-75072467 CAAAATAATCATATGGAACATGG - Intergenic
1085487494 11:76879066-76879088 CAAAACATCCATTTGGCAAATGG - Intronic
1085998739 11:81953494-81953516 TAAAATATACCTTTGGTAAAAGG + Intergenic
1086171292 11:83839316-83839338 CAAAAAATAAATTTGTAAAATGG + Intronic
1086182416 11:83969434-83969456 CAAAAAATAAATAAGTAAAATGG + Intronic
1086259177 11:84916889-84916911 CAAAATATACATGTTGGAAAAGG - Intronic
1086344014 11:85876910-85876932 CACATTATAAAAATGGAAAAAGG - Intronic
1086470436 11:87103603-87103625 CAAATTATACATCTGATAAAGGG - Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086499783 11:87440535-87440557 TAAAACAAACATCTGGAAAAAGG - Intergenic
1086659718 11:89400161-89400183 CAAAAATTACATAAGGATAAAGG + Intronic
1086951456 11:92894652-92894674 CAAAATATTCATAGAGGAAAGGG - Exonic
1086973565 11:93108747-93108769 TAAAATATACCTTTGGTAAAAGG - Intergenic
1087013438 11:93534396-93534418 ATACATATATATATGGAAAAGGG + Intronic
1087273680 11:96139091-96139113 ACCAATATATATATGGAAAAAGG - Intronic
1087456716 11:98395979-98396001 CAGAATATAGATATGGGCAAAGG + Intergenic
1087844452 11:102956502-102956524 CAGATTATTCATATGTAAAATGG - Intergenic
1088003085 11:104906380-104906402 AAAAATATACAAATTAAAAATGG + Intergenic
1088019139 11:105098105-105098127 CTATGTATACATATGGAAGAAGG + Intronic
1088119342 11:106349823-106349845 CAAAGTATACATGAGTAAAATGG + Intergenic
1088500212 11:110475383-110475405 CAATATATAGATAAGGAAACTGG - Intergenic
1088525893 11:110754297-110754319 CAAACTGTACATGTGGCAAAGGG - Intergenic
1088565787 11:111171382-111171404 TTAAATATAGATATAGAAAAAGG + Intergenic
1089803531 11:121060501-121060523 CAAAATATGAATATGAGAAAAGG + Intronic
1089906282 11:122043014-122043036 CCAAATAAAAATAAGGAAAAAGG - Intergenic
1090575024 11:128092805-128092827 CAAAATATAGATATAAAAATTGG - Intergenic
1090622788 11:128576252-128576274 CACAATCTACAAGTGGAAAAAGG - Intronic
1090867637 11:130715894-130715916 CAAAATAGAAATATTGAAGAGGG - Exonic
1091876576 12:3939469-3939491 TAAAAAATACATATGTAAGAGGG - Intergenic
1091927342 12:4364891-4364913 CAAAATACCAATATGAAAAATGG - Intergenic
1092460708 12:8683532-8683554 AAAGATATACAGATGGCAAATGG - Intronic
1092695246 12:11164440-11164462 CATAATAAACATGTGTAAAAAGG - Intronic
1093047008 12:14458383-14458405 ACAAATATATAGATGGAAAAGGG + Intronic
1093252046 12:16818718-16818740 CAAAACATATATCTGGATAAAGG + Intergenic
1093356638 12:18175173-18175195 TAAAATATGCTTTTGGAAAAAGG + Intronic
1093369560 12:18351236-18351258 TATAATAAACATATGGAATATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093738832 12:22657278-22657300 CAAAGTACACATATATAAAAAGG + Intronic
1093785924 12:23192293-23192315 CAAACTATTTTTATGGAAAAAGG - Intergenic
1094408462 12:30144654-30144676 CAAAATAAATATATGCCAAATGG + Intergenic
1094860179 12:34456191-34456213 CAAAATGTCCATATGCAGAATGG + Intergenic
1094860735 12:34463114-34463136 CAAAATGTCCATTTGCAAAATGG + Intergenic
1095039933 12:37429634-37429656 CTCTATATATATATGGAAAAGGG - Intergenic
1095039953 12:37430097-37430119 CTCTATATATATATGGAAAAGGG - Intergenic
1095240830 12:39856883-39856905 GAAAATATAAATATGAAACAAGG - Intronic
1095527384 12:43143511-43143533 CATAATATAAAAATAGAAAAAGG + Intergenic
1095597370 12:43974666-43974688 AAAAATGTACATCTGGAACAAGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096093767 12:48920792-48920814 CAATAAATACATATAGCAAATGG - Intronic
1096588987 12:52644709-52644731 CAGAATACACATCTGGAAAATGG + Exonic
1097322189 12:58238201-58238223 ATATATATACATATGGAAAGAGG - Intergenic
1097414533 12:59298194-59298216 TAAATAATTCATATGGAAAATGG + Intergenic
1097578739 12:61427641-61427663 CAAGATATACTTTTGGAAATGGG + Intergenic
1097580248 12:61447031-61447053 CAAAATATATATACAGATAAGGG - Intergenic
1098424707 12:70348583-70348605 CCAAACTTACATATGTAAAAAGG + Intronic
1098674519 12:73272011-73272033 CAAACTATGCATGTGAAAAAAGG + Intergenic
1098690067 12:73475982-73476004 CACACTATATATATGAAAAAAGG - Intergenic
1099054490 12:77822003-77822025 AAAAATACACATCTGGAAAAAGG - Intergenic
1099092842 12:78335530-78335552 AAAAACAAAAATATGGAAAAAGG - Intergenic
1099239120 12:80117263-80117285 AAAAATATATATATATAAAATGG + Intergenic
1099314911 12:81072208-81072230 CAAACTATGCATCTGAAAAAAGG + Intronic
1099556661 12:84117253-84117275 CAGAATATGTTTATGGAAAAAGG - Intergenic
1099581643 12:84455273-84455295 CAATATTTACATATTTAAAATGG + Intergenic
1099662200 12:85578304-85578326 CAATATAAAAATATGCAAAAAGG - Intergenic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100228093 12:92579393-92579415 CAAACTATATATATGATAAAGGG + Intergenic
1100785954 12:98078637-98078659 CAAACTATACATCTGATAAAGGG + Intergenic
1100935791 12:99664326-99664348 CAAAAAATAAATATATAAAATGG - Intronic
1101702945 12:107192364-107192386 CAAAACATGCATACAGAAAAGGG - Intergenic
1101767235 12:107713442-107713464 CAAAATTTTCAAATGGTAAATGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102742484 12:115220502-115220524 CATTATATACATATATAAAAAGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104120120 12:125790952-125790974 CCAAATACAAATATGCAAAATGG - Intergenic
1105271462 13:18879821-18879843 CAAAATATGTAGTTGGAAAAGGG - Intergenic
1105714900 13:23053338-23053360 CAAACAATAAATAAGGAAAAAGG + Intergenic
1105796069 13:23854325-23854347 CAAAATAAACAAATAGGAAATGG - Intronic
1105901721 13:24760713-24760735 CAAACTATACATCTGGTAAGGGG + Intergenic
1106000132 13:25714422-25714444 CAAAATAAAGCTATGGAAAGTGG - Intronic
1106167390 13:27260619-27260641 CTACATATTCATATGCAAAATGG - Intergenic
1106175157 13:27323843-27323865 CAAAACATACATCTGATAAAAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106958941 13:34975039-34975061 CACAATTTACATATGGGGAAAGG + Intronic
1106963633 13:35032781-35032803 GAAGATATACAAATGGCAAATGG - Intronic
1107374790 13:39791165-39791187 CTAGATATACATATAGAAAGTGG - Intronic
1107705830 13:43103786-43103808 CAAAATATACAAAGGAAAAAAGG - Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108514894 13:51191753-51191775 CAAAATATCCAGTTGGAAAGGGG - Intergenic
1108801080 13:54095372-54095394 AAAAATGTACATATGTACAACGG - Intergenic
1108877794 13:55069555-55069577 CAAAATAGGCATATTGATAAGGG + Intergenic
1109050652 13:57477047-57477069 AAAAATATATATATATAAAATGG + Intergenic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109529950 13:63629629-63629651 CAAATTATTCATAAGGAAGAGGG - Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109609353 13:64743022-64743044 CAAAATATACATCTGGTAATAGG + Intergenic
1109615076 13:64823154-64823176 CAACAAATCCATTTGGAAAATGG + Intergenic
1109676587 13:65683868-65683890 CAAAAGATCCATTTGAAAAAAGG - Intergenic
1109919603 13:69038768-69038790 GAAATTATAAATATGGACAATGG + Intergenic
1109969634 13:69750884-69750906 GAAAAAATACATCTGGAATATGG + Intronic
1109981221 13:69910769-69910791 TAAAATAGACATAAGTAAAATGG + Intronic
1109986201 13:69988865-69988887 CAAATTATACATCTGACAAAAGG - Intronic
1109991220 13:70060134-70060156 GAAGATATACAAATGGAAACAGG + Intronic
1110678599 13:78280773-78280795 AGAAACATACATATGGAATATGG - Intergenic
1111019882 13:82435873-82435895 CAAAATTTCCAAATGGAAAGAGG + Intergenic
1111033365 13:82636949-82636971 CAAAGTATAGTTATGAAAAATGG + Intergenic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1111250047 13:85590372-85590394 AAAAATGTTCATCTGGAAAATGG + Intergenic
1111279832 13:86007266-86007288 CATAATATAAATAGGGTAAAAGG + Intergenic
1112124854 13:96453880-96453902 CAAAACATTGATATGGAAAAGGG + Intronic
1112157665 13:96835117-96835139 CACCATATCCATATGGAATAAGG + Exonic
1112392687 13:98999630-98999652 AAAATTATAAAAATGGAAAAGGG + Intronic
1112702342 13:102024947-102024969 ATATATATACATATGTAAAATGG + Intronic
1112798128 13:103079772-103079794 CATTCTATACAAATGGAAAATGG + Intergenic
1112846634 13:103651210-103651232 CAAAAGCTAAATATGGTAAATGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113658243 13:112084053-112084075 AAAAACATGGATATGGAAAATGG - Intergenic
1114650762 14:24283242-24283264 CAAGAGATACATATGTACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114784031 14:25573405-25573427 CAAAATAAACTTATTGATAATGG + Intergenic
1114820016 14:26007321-26007343 CAAAAGATACATATTGAAGGTGG - Intergenic
1114906516 14:27134830-27134852 CAAACTATACATCTGACAAAAGG + Intergenic
1114970205 14:28017086-28017108 CAAAATTTACATAGGGTAACAGG - Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115122575 14:29955171-29955193 CAAAATATAAAAATGCAAAGTGG - Intronic
1115243003 14:31267859-31267881 CAAAGAATACATATGGAAAGGGG - Intergenic
1115370653 14:32610337-32610359 GGAAAAATACATTTGGAAAAGGG - Intronic
1115381893 14:32749270-32749292 AAAAATTTACCAATGGAAAAAGG - Intronic
1115728060 14:36238735-36238757 CAAAAGATAAACGTGGAAAACGG + Intergenic
1115881673 14:37926437-37926459 CAAATAATACATATGTATAAAGG + Intronic
1116113736 14:40621393-40621415 TAAAATAAAAATATGGAATAGGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116986630 14:51226835-51226857 CAAACAATACATAGGGAGAAGGG - Intergenic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117587481 14:57225138-57225160 CAATATATAAATATGACAAAAGG + Intronic
1118235034 14:63995080-63995102 CTAAAAATAGATATTGAAAAAGG + Exonic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118530369 14:66698176-66698198 TAAAAAATACATTTTGAAAAGGG + Intronic
1119873847 14:78039530-78039552 CAATACATACATCTGTAAAAAGG - Intergenic
1120393456 14:83938012-83938034 CAACAAATACTTAAGGAAAATGG + Intergenic
1120600847 14:86506302-86506324 AAAAATATATATATTAAAAATGG + Intergenic
1121402779 14:93695486-93695508 AATAATATACATATGGCAAATGG + Intronic
1121477387 14:94223177-94223199 CAAAATATAAACATGCCAAAAGG - Intronic
1121572263 14:94955504-94955526 CAAGATATATAATTGGAAAAGGG + Intergenic
1121803000 14:96791044-96791066 CAAATTATCCAAATTGAAAAAGG - Intergenic
1202875686 14_GL000225v1_random:207553-207575 CCAGATGTACATATGGAAAATGG - Intergenic
1123779469 15:23611677-23611699 CCAAGTATACATATTGGAAAAGG + Intronic
1124217626 15:27821173-27821195 CAAAACAAACAAATGGAAACTGG - Intronic
1126222791 15:46233906-46233928 CAAAATATGTAGTTGGAAAAGGG + Intergenic
1126491583 15:49242967-49242989 CAAAATACAAAGATGGAAAGTGG + Intronic
1126606510 15:50482765-50482787 CCATTTATACATATGTAAAAAGG - Intronic
1126620394 15:50633598-50633620 CAAAATATGTACATGCAAAAAGG - Intronic
1126671777 15:51122052-51122074 CAAAATCTCCATATGTCAAATGG - Intergenic
1126730593 15:51678080-51678102 GAAAATACAGATAAGGAAAAAGG - Intergenic
1126941248 15:53768127-53768149 CAAAGTCTACATATGGAACAGGG + Intergenic
1126961804 15:54004783-54004805 GAATATATACAAACGGAAAATGG - Intergenic
1127013711 15:54659309-54659331 CAAAATATCCAAATAGAAATTGG + Intergenic
1127173737 15:56330946-56330968 GAAAATAAAGAAATGGAAAAAGG + Intronic
1127196990 15:56597961-56597983 CTCAATATAAATATTGAAAAAGG + Intergenic
1127467492 15:59258365-59258387 AAAAATATATATCTAGAAAATGG + Intronic
1128057177 15:64708879-64708901 AAAAATGTACATATAGACAACGG - Intergenic
1128226349 15:66003979-66004001 CAAATTTCTCATATGGAAAAGGG + Intronic
1129092279 15:73163984-73164006 CAAAATACAAATACGGGAAAAGG - Intronic
1129243854 15:74268139-74268161 TGAAATATTCAAATGGAAAAGGG + Intronic
1130339867 15:82991235-82991257 AAAAATATATATATTTAAAAAGG + Intronic
1130759223 15:86800491-86800513 CCAAATAGACTTATGGAAGAAGG - Intronic
1131012158 15:89027198-89027220 CAAAATATACATATCATAAGGGG + Intergenic
1131742438 15:95408808-95408830 CAGAATATATTTATGGAAATTGG - Intergenic
1132024614 15:98394435-98394457 CAACATCTTCATCTGGAAAATGG + Intergenic
1132785266 16:1653514-1653536 TAAAATGTACAAATGAAAAAGGG - Intronic
1133960721 16:10490914-10490936 TAAAATATACTTTTGGTAAAAGG + Intergenic
1134420363 16:14081943-14081965 CAAACTATACATCTGGTAAGGGG - Intronic
1135357054 16:21778006-21778028 CCAAATATAAATCTGCAAAATGG - Intergenic
1135455558 16:22594120-22594142 CCAAATATAAATCTGCAAAATGG - Intergenic
1136296021 16:29302441-29302463 GACAATAAACATAAGGAAAAAGG - Intergenic
1136641985 16:31574110-31574132 CAAACTATGCATATGACAAAGGG + Intergenic
1136658848 16:31735817-31735839 CAAACTATACATATGACAAGAGG - Intronic
1136663398 16:31785544-31785566 CAAACTATGCATATGACAAAGGG - Intronic
1136741328 16:32531365-32531387 CAAAATATCCATTTGCAGAATGG + Intergenic
1137041698 16:35618846-35618868 TAAAATATACCTCTGGTAAAAGG - Intergenic
1137242409 16:46667360-46667382 CAAACTATACATCTGAAAAGTGG - Intronic
1137316813 16:47333985-47334007 CAAAATACCAATATGGTAAATGG - Intronic
1137482359 16:48863223-48863245 AAAAATATAGTGATGGAAAACGG + Intergenic
1137763491 16:50959697-50959719 TATAATATACATACGGAAATGGG + Intergenic
1137991664 16:53163187-53163209 AAAAATATGTATATGGGAAATGG - Intronic
1138033843 16:53582552-53582574 CAAAATGTATAAATGGAAAGTGG + Intergenic
1138614598 16:58154919-58154941 AAAAACATAAATATGAAAAATGG - Intergenic
1138968960 16:62121505-62121527 TCAAATATACACATGGTAAAAGG - Intergenic
1139159785 16:64490547-64490569 AAAAATATACAGATATAAAAAGG + Intergenic
1140180366 16:72710570-72710592 CAGGATATCCATATGCAAAAGGG - Intergenic
1140798386 16:78462039-78462061 CATAATGTGCATATGTAAAAAGG - Intronic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1141059775 16:80855176-80855198 TAAATATTACATATGGAAAATGG + Intergenic
1141110994 16:81270588-81270610 GAAAATATAGATAAGTAAAAAGG + Intronic
1141314018 16:82943254-82943276 TAACACATAAATATGGAAAAAGG - Intronic
1142101940 16:88276628-88276650 GACAATAAACATAAGGAAAAAGG - Intergenic
1203028275 16_KI270728v1_random:543869-543891 CAAAATATCCATTTGCAGAATGG - Intergenic
1203043446 16_KI270728v1_random:790562-790584 CAAAATATCCATTTGCAGAATGG + Intergenic
1142649367 17:1337221-1337243 GAAAATATAGAGATGGCAAATGG + Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144409958 17:14991236-14991258 CAAAATGTGCTTATGCAAAAGGG - Intergenic
1144647108 17:16982557-16982579 CAATATATTCAGATGGAATAAGG + Intergenic
1145043462 17:19594067-19594089 CAAAATATAAAGATGCCAAATGG - Intergenic
1145118493 17:20234028-20234050 CAGAATATACATAAGAAACATGG - Intronic
1146087443 17:29842981-29843003 CAACATACACAAATAGAAAAAGG - Intronic
1146135251 17:30314436-30314458 TAGAAAAGACATATGGAAAAAGG + Intergenic
1146782848 17:35690971-35690993 CAAAAACTATATATGGGAAAGGG - Intronic
1147754419 17:42759100-42759122 CAAGATTTTCATATGTAAAATGG - Intronic
1148011620 17:44486641-44486663 CAAATAATACAAATGTAAAATGG + Intronic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148829069 17:50417946-50417968 TAAAATATACCTTTGGTAAAAGG - Intergenic
1149027321 17:52042503-52042525 CAAATTATACATCTGATAAATGG - Intronic
1149101814 17:52915902-52915924 CAAACTATACATCTGACAAAGGG - Intergenic
1149139513 17:53413784-53413806 AAAATTATAAATATTGAAAAGGG + Intergenic
1149190210 17:54051853-54051875 AAAAATATACAAATACAAAATGG + Intergenic
1149675366 17:58455563-58455585 CAAACTATACATTTGACAAAAGG + Intronic
1149786379 17:59438917-59438939 CAAACCACACATATGGAAAGTGG - Intergenic
1150178458 17:63088347-63088369 CAACCTATGCCTATGGAAAAAGG - Intronic
1150734990 17:67729269-67729291 CAAAAAATACAAAAAGAAAAAGG - Intronic
1150867877 17:68873452-68873474 CAAATTATATATATGACAAAGGG - Intronic
1151032475 17:70757414-70757436 AAAAATATATATATAGATAATGG + Intergenic
1151204798 17:72498413-72498435 CTAAATAAACATTTGTAAAACGG + Intergenic
1151580977 17:74978584-74978606 CAAAAGATGCATATGAAAATAGG + Intergenic
1153123602 18:1762786-1762808 CAAAATATATATTTAGTAAATGG - Intergenic
1153126120 18:1792903-1792925 CAAAATACAAATTTGGAAAGAGG - Intergenic
1153436516 18:5073673-5073695 AAAAATATATATGTTGAAAATGG + Intergenic
1153535054 18:6093116-6093138 CAATATGTACATTTAGAAAAAGG + Intronic
1153731025 18:8011916-8011938 CAAATTATACGTATAGAAATAGG + Intronic
1153826484 18:8879956-8879978 TAAAATATACCTTTGGTAAAAGG - Intergenic
1153830284 18:8916166-8916188 TAAAATATACCTTTGGTAAAAGG + Intergenic
1154179881 18:12126478-12126500 CAAAATATATACATGATAAACGG + Intronic
1155275916 18:24187385-24187407 CAAAATATATATAACAAAAAAGG - Intronic
1155925882 18:31654471-31654493 TAAAATATACATATTAAAATAGG + Intronic
1156124635 18:33888767-33888789 CAAAACAGATATATGGACAAAGG - Intronic
1156149687 18:34226354-34226376 GAAAATATAAATAAGGTAAAAGG - Intergenic
1156409508 18:36814393-36814415 AAATATATAAACATGGAAAAAGG + Intronic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1156942372 18:42784160-42784182 CACAATTTAGATATGCAAAAGGG - Intronic
1157051081 18:44165985-44166007 CTAAATATAGATATGGATATAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158730939 18:60021824-60021846 CAAAATCTACAGAAGTAAAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158885448 18:61822906-61822928 CAAAATATAAATATTTGAAATGG + Intronic
1159366303 18:67469680-67469702 AAAAAGATAAATATGTAAAATGG - Intergenic
1159489957 18:69119433-69119455 CAAACTATCCATCTGAAAAAAGG - Intergenic
1159564439 18:70032466-70032488 CAAAATAAAGGGATGGAAAAAGG + Intronic
1159616692 18:70588404-70588426 CAAAATCAACATATAGAAATTGG - Intergenic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1159680170 18:71340168-71340190 TAAAATATATATAAGAAAAATGG + Intergenic
1159710827 18:71757485-71757507 GAAGATATACAAATGGCAAAAGG + Intronic
1159771747 18:72554356-72554378 CAAAAAAAGCATATGAAAAAGGG + Intronic
1163073724 19:14868970-14868992 CAAACTAAACATCTGAAAAATGG - Intergenic
1163867192 19:19783723-19783745 TAAAATATACCTTTGGTAAAAGG - Intergenic
1163929222 19:20372825-20372847 TAAAATATACTTTTGGTAAAAGG + Intergenic
1164190048 19:22906153-22906175 CAGAATAAAAATGTGGAAAATGG - Intergenic
1164217060 19:23160115-23160137 TAAAATATACCTTTGGTAAAAGG - Intergenic
1164891992 19:31831887-31831909 CAAACTAAACATTTGTAAAAAGG - Intergenic
1166020190 19:40021272-40021294 CAAGAAATACATTTGAAAAATGG - Intergenic
1166238222 19:41471873-41471895 CACAATATTCAGAGGGAAAAAGG - Intergenic
1166430750 19:42724875-42724897 ATATATATATATATGGAAAAAGG + Intronic
1166463459 19:43010901-43010923 ATATATATATATATGGAAAAAGG + Intronic
1166469604 19:43067450-43067472 ATATATATATATATGGAAAAAGG + Intronic
1167906790 19:52667507-52667529 TAAAATATACTTTTGGTAAAAGG + Intronic
1168486808 19:56770015-56770037 GAAATTTTACATTTGGAAAAAGG + Intergenic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
925080669 2:1061985-1062007 CAAATTATACATCAGAAAAATGG + Intronic
925322301 2:2982749-2982771 CAAACTATGCATCTGGCAAAGGG + Intergenic
925608427 2:5682959-5682981 CACAATATAAAAATGGGAAATGG - Intergenic
926355861 2:12040082-12040104 CGAGATATTCATATGGGAAAGGG - Intergenic
926453079 2:13029778-13029800 GAATATATACATATAGAAATGGG - Intergenic
926491557 2:13531211-13531233 TAAAATATACCTTTGGTAAAAGG - Intergenic
926503257 2:13680517-13680539 TAAAATATACTTTTGGTAAAAGG + Intergenic
926628007 2:15109946-15109968 CAAAATATATTTCTGGGAAATGG + Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926882434 2:17561595-17561617 CAAAAGATACTTTTGGAGAATGG + Intronic
927589570 2:24341853-24341875 CAAAAAATACATAGGAAAAAAGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928491134 2:31784524-31784546 CAAACTATGCATATGACAAAGGG + Intergenic
928671516 2:33607909-33607931 CAAAATCTAGTTATGAAAAAAGG - Intergenic
928706922 2:33959816-33959838 CACAAAAAACATATTGAAAATGG + Intergenic
928747165 2:34428601-34428623 CAAAAGGTACATATGGGGAAAGG + Intergenic
928825679 2:35418379-35418401 CAAAATATGCATCTGACAAAGGG + Intergenic
929039301 2:37727922-37727944 CAAAATAGAGATATAGACAATGG + Intronic
929068271 2:38002590-38002612 TAAATTATATATATGTAAAATGG + Intronic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
929252169 2:39770272-39770294 CACAATATTCTTATGGTAAATGG - Intronic
929333089 2:40708394-40708416 CAAACTATACATTTGACAAAGGG - Intergenic
929352383 2:40973343-40973365 AAAAATATACATATGCATTATGG - Intergenic
930353260 2:50284521-50284543 TATAATCTTCATATGGAAAAAGG + Intronic
930458195 2:51633626-51633648 CAAAATATACTCGTGTAAAATGG - Intergenic
930579879 2:53197641-53197663 CAAACTATTCATCTGGACAAAGG + Intergenic
930626459 2:53703767-53703789 GAAAATATACAAATGAGAAAAGG + Intronic
931235544 2:60409758-60409780 TAAAATGTACATTTGGCAAAGGG - Intergenic
931785534 2:65615425-65615447 CAAAAAATATATATAAAAAAGGG - Intergenic
932240620 2:70153684-70153706 AAAAAACTACATAAGGAAAAGGG + Intronic
932855076 2:75225191-75225213 TTAAAATTACATATGGAAAAGGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932897613 2:75657298-75657320 CAAAATATTCATGTGGAGGAGGG - Exonic
932946922 2:76245569-76245591 GATAATCTACATAAGGAAAAAGG - Intergenic
933049349 2:77583382-77583404 TAAAATATATATATATAAAAGGG + Intronic
933096456 2:78189229-78189251 AAAAAGAAACATATGGAAGAAGG + Intergenic
933346701 2:81095655-81095677 GAAAATATTCAAATGGGAAAGGG + Intergenic
933463305 2:82617277-82617299 CTAGACATTCATATGGAAAAGGG + Intergenic
933566298 2:83954489-83954511 CAAAATCAACACATGGCAAATGG - Intergenic
933909422 2:86926362-86926384 TGAAATATACAAATGGTAAAAGG + Intronic
934023304 2:87977017-87977039 TGAAATATACAAATGGTAAAAGG - Intergenic
934952524 2:98587317-98587339 CAACAAATACATATGTAAGATGG - Intronic
935020881 2:99230165-99230187 CAAAATAAAGGAATGGAAAAAGG + Intronic
935048249 2:99501116-99501138 TAAAATATACTTTTGGTAAAAGG + Intergenic
935542753 2:104368942-104368964 GAAAAGAAACATAAGGAAAAGGG - Intergenic
935547009 2:104411063-104411085 CAACATATACATAAGCAAGATGG - Intergenic
935575579 2:104706596-104706618 TAAGATATATCTATGGAAAATGG - Intergenic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935721584 2:105984332-105984354 TAAAATATACCTTTGGCAAAGGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936665843 2:114594448-114594470 GAACACATACATATGTAAAAGGG + Intronic
936672421 2:114672856-114672878 GAAAATCTGCATATGGAAGAAGG - Intronic
936707569 2:115092582-115092604 CAATATATATATATGAAAAGAGG + Intronic
936716516 2:115193035-115193057 TAAAATATACTTTTGGTAAAAGG - Intronic
936743313 2:115542269-115542291 AAAATTATAGAAATGGAAAACGG - Intronic
936834948 2:116698168-116698190 GAAAAAATACATCTTGAAAATGG - Intergenic
936851724 2:116907296-116907318 CATGAGAGACATATGGAAAATGG - Intergenic
937057352 2:118950514-118950536 CAAAATAAACTTTTGGTAAAAGG - Intronic
937356899 2:121203376-121203398 TGTAATACACATATGGAAAAGGG + Intergenic
937655690 2:124372415-124372437 CAATATATGTATATGTAAAAAGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938484065 2:131685597-131685619 CTAGATATCCATATGCAAAAGGG - Intergenic
938872875 2:135499464-135499486 CAGAGTATACATATGACAAAAGG + Intronic
939137835 2:138317845-138317867 CATAGTATATATATGGAAACTGG + Intergenic
939430262 2:142095688-142095710 AAAAAAATACATGTTGAAAAAGG - Intronic
939820014 2:146946099-146946121 AAAAATAAACGTAGGGAAAATGG + Intergenic
940101542 2:150045498-150045520 CAAAATTTTTATTTGGAAAAAGG - Intergenic
940108030 2:150120025-150120047 GAAAATTTACATTTGAAAAAGGG + Intergenic
940196974 2:151105637-151105659 CCAAATATGGATTTGGAAAAAGG - Intergenic
940447848 2:153798530-153798552 CAAAATATTTATATGCAAACTGG + Intergenic
940570161 2:155421615-155421637 TAAAATATAAATATTCAAAAAGG + Intergenic
941177995 2:162223035-162223057 GTATATATATATATGGAAAATGG + Intronic
941185913 2:162321153-162321175 CAAAAAATATAGATGAAAAAAGG - Intronic
941210167 2:162628216-162628238 TAAAATGAACACATGGAAAAAGG + Intronic
941254747 2:163214724-163214746 CAAAATACACCTTTGGTAAATGG + Intergenic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941332089 2:164191125-164191147 GATAATATACATCTGGAAAATGG + Intergenic
941338182 2:164270406-164270428 CAAAATATGCATCTGACAAAAGG - Intergenic
941410964 2:165156701-165156723 CAATATATCAATATTGAAAATGG - Intronic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
941557987 2:167007478-167007500 CAAATTATACTTATGGAATTTGG + Intronic
942041049 2:172063250-172063272 CAAAATGAACATATGTAAAAAGG - Intronic
942507155 2:176655262-176655284 CAAAAGCTACATATGAAAACTGG - Intergenic
942651996 2:178178977-178178999 AAAATTATACATAGTGAAAATGG - Intergenic
942705428 2:178766220-178766242 CACATTATATCTATGGAAAAGGG - Intronic
942768092 2:179481258-179481280 CAAAATATACTCATTGAAATTGG + Intronic
942785389 2:179695509-179695531 CAAAAAGTACAATTGGAAAATGG + Intronic
942927605 2:181452589-181452611 GAAGATATACAAATGGCAAACGG - Intergenic
943151455 2:184118591-184118613 CAAAATAATAATGTGGAAAATGG - Intergenic
943230773 2:185248246-185248268 AAAAATCTACATATGGAAGTTGG - Intergenic
943407997 2:187513044-187513066 TAAAATATACCTTTGGTAAAGGG + Intronic
943736897 2:191366166-191366188 CAAAATATACATATTCCTAAAGG - Intronic
943763486 2:191635062-191635084 CAAATAATACTTATTGAAAATGG - Intergenic
943818129 2:192282277-192282299 CAAAATATGCATCTGACAAAAGG + Intergenic
943935651 2:193912327-193912349 AAAAATATACATATGGACATAGG + Intergenic
944139687 2:196441993-196442015 CCAAATGTAAATTTGGAAAAGGG + Intronic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944360464 2:198849310-198849332 CAAATTATATATATATAAAATGG - Intergenic
944424396 2:199564250-199564272 CAAAGTATACATCTGATAAAAGG - Intergenic
944664016 2:201944617-201944639 AAATATATACATATAGTAAATGG - Intergenic
944737150 2:202577461-202577483 CAAACTATACATCTGACAAAGGG - Intergenic
945174952 2:207034423-207034445 CCAAATAAACATATGGAAGGTGG + Intergenic
945392628 2:209283126-209283148 CAAAAGATACATCTGATAAAGGG + Intergenic
945483618 2:210369631-210369653 TAAAATATACTTTTGGTAAAAGG - Intergenic
945501474 2:210580870-210580892 AAAAAAGTACATATGGGAAAAGG + Intronic
945502532 2:210593743-210593765 CAAAATATAAATATCTAAAACGG - Intronic
945601545 2:211872149-211872171 GAAAAAATACATATATAAAAAGG + Intronic
945701282 2:213173964-213173986 AAGAATATACATTTTGAAAAGGG - Intergenic
946591616 2:221255640-221255662 GAAATTATATATATGGAAAATGG + Intergenic
947365146 2:229386561-229386583 CAATCTATCCATCTGGAAAAGGG + Intronic
948490788 2:238311569-238311591 CAAATTATACATCTGATAAAGGG + Intergenic
1168742218 20:201472-201494 CAAAAATTATTTATGGAAAAAGG - Intergenic
1168822964 20:788649-788671 TAAAATATACTTTTGGTAAAAGG - Intergenic
1169134161 20:3186636-3186658 CAAAATCTAACTATGAAAAAGGG + Intergenic
1169310610 20:4535540-4535562 CAAATTATACATATAATAAAGGG - Intergenic
1169575196 20:6952062-6952084 CAAAATACACACAAGGAAAGAGG + Intergenic
1169613170 20:7407049-7407071 AAACATATACATATAGAATATGG + Intergenic
1169658932 20:7957061-7957083 CAAAATATAGAGAAAGAAAAAGG - Intergenic
1170295164 20:14816517-14816539 CAATTTATACAGATGAAAAATGG - Intronic
1170355628 20:15489272-15489294 CATAATATAAAAAGGGAAAAGGG - Intronic
1170527812 20:17258672-17258694 CAAAATAAAAATTTGAAAAAAGG + Intronic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1171094058 20:22314803-22314825 TATAATACAAATATGGAAAAGGG + Intergenic
1171491486 20:25521858-25521880 CAAAATATTCTCAGGGAAAATGG + Intronic
1171534520 20:25874852-25874874 AAATGTATATATATGGAAAAGGG - Intergenic
1171792617 20:29542014-29542036 ATATATATATATATGGAAAAGGG + Intergenic
1171806546 20:29685951-29685973 ATATATATATATATGGAAAAGGG + Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173335228 20:42107049-42107071 CAAACTATACATATTAAGAAAGG - Intronic
1174209499 20:48866315-48866337 CAAAAAATCCATCTGGAAAATGG - Intergenic
1174333856 20:49843527-49843549 GAAAATATTCATATGAAAAAGGG + Intronic
1174764311 20:53237979-53238001 AAAAATATACATCTGGATAGAGG + Intronic
1175287679 20:57848392-57848414 CAAAATATTGACATGGAGAATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176639471 21:9286236-9286258 CCAGATGTACATATGGAACATGG - Intergenic
1176948823 21:15018978-15019000 CAAACTACACATAGGGAAGAGGG - Intronic
1177098868 21:16874430-16874452 AAAAATAAACGTATGTAAAATGG - Intergenic
1177221957 21:18206490-18206512 AAAAATAAAGAAATGGAAAAAGG - Intronic
1177349669 21:19920731-19920753 CAAAATATATATATTGAGTATGG - Intergenic
1177441215 21:21128017-21128039 AAAAAAATACAAAGGGAAAATGG - Intronic
1177719694 21:24889731-24889753 AAAAATATAAATGTGTAAAAGGG - Intergenic
1177830081 21:26128670-26128692 CATAAAACACATATGGGAAATGG + Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178717303 21:34977607-34977629 CAACATATACACATGGAAGTGGG + Intronic
1178749600 21:35288127-35288149 CAAACTATACATATGACAAGGGG - Intronic
1179085165 21:38209899-38209921 CAAAATTTAAATATGGACAATGG + Intronic
1179107305 21:38413893-38413915 CCAAAGATACATATGGAGAGAGG - Intronic
1180212558 21:46303424-46303446 CAAAATGCACATATCAAAAAAGG + Intronic
1180348485 22:11775611-11775633 CCAGATGTACATATGGAACATGG - Intergenic
1180372773 22:12059066-12059088 CCAGATGTACATATGGAACATGG - Intergenic
1180389707 22:12216602-12216624 CCAGATGTACACATGGAAAATGG + Intergenic
1180416228 22:12717880-12717902 CCAGATGTACATATGGAAAATGG - Intergenic
1180423517 22:12893725-12893747 CCAGATGTACATATGGAACATGG - Intergenic
1180566756 22:16675006-16675028 CAAAATATATACATGATAAACGG - Intergenic
1180849994 22:19013107-19013129 TAAAATATAAATATTGCAAATGG + Intergenic
1181780274 22:25187420-25187442 GAAAACATTCATATGGAACATGG - Intronic
1182640941 22:31767122-31767144 CAATGAATACATGTGGAAAACGG - Intronic
1182950667 22:34372647-34372669 TAAAATCTACTTATGGAAGAGGG + Intergenic
949096742 3:95389-95411 CAAAATCTAGAGATTGAAAAAGG - Intergenic
949440813 3:4078231-4078253 CAAACTATGCAGATGGAAATGGG + Intronic
949610077 3:5695082-5695104 TAAAATATACTTTTGGTAAAAGG - Intergenic
949647980 3:6119935-6119957 CAAAAAATACATTTGCACAATGG - Intergenic
949827991 3:8183333-8183355 CAACTTATAAATATGTAAAATGG - Intergenic
950364576 3:12474044-12474066 AAAAAAATACATATTAAAAAAGG - Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950971065 3:17188387-17188409 CAATATAAACACATGGAAAAAGG + Intronic
950999384 3:17540118-17540140 GAAAATATACAAATGGCAATTGG - Intronic
951242455 3:20302998-20303020 AAAAATAAACATATGGTATAGGG - Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
953098876 3:39806850-39806872 CAAAATAAACTTATGTTAAATGG - Intergenic
953250316 3:41240176-41240198 TAAAATAGACAAATAGAAAATGG + Exonic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953544192 3:43850919-43850941 CAAAAGATATATGGGGAAAATGG - Intergenic
953762569 3:45701633-45701655 TAAACTACACACATGGAAAAGGG + Intronic
954345715 3:49996430-49996452 TAAAATGTATATAGGGAAAAAGG - Intronic
954496252 3:50966614-50966636 AAAGATATACATATGGCAACAGG - Intronic
954604625 3:51899466-51899488 TAAAATATACCTTTGGTAAAAGG + Intronic
954966714 3:54617927-54617949 CAAACTCTACATACAGAAAAAGG - Intronic
955153974 3:56397463-56397485 TACAATTTACATAAGGAAAAGGG - Intronic
955723066 3:61903913-61903935 CAGAACAGACATATGTAAAAAGG - Intronic
955992897 3:64647185-64647207 AAAAAAATACACATGGAAATTGG - Intronic
956333186 3:68133863-68133885 CATAATATCCATATGAGAAAAGG + Intronic
957043268 3:75353587-75353609 CAAATCATACATCTGGAAAGGGG - Intergenic
957458332 3:80482772-80482794 CAAACTATACATTTGACAAAGGG + Intergenic
957697559 3:83661046-83661068 CAACATATATATATGAGAAAAGG + Intergenic
957808878 3:85190947-85190969 CAAAATACAGATATGTAAAGAGG + Intronic
958004751 3:87796549-87796571 CAAAATATGGATATTGAAGAGGG + Intergenic
958455912 3:94330675-94330697 CATAACATACATATAGAAGAAGG - Intergenic
958501645 3:94918280-94918302 GAAGATATACCAATGGAAAAAGG - Intergenic
958519562 3:95166906-95166928 AAAAACAGACATATAGAAAATGG + Intergenic
958543974 3:95516502-95516524 CATAATATACATATAAGAAATGG - Intergenic
958672499 3:97222455-97222477 CAAAAAATACATATATAAATTGG - Intronic
958672818 3:97227190-97227212 CAATATATAAATTTAGAAAAAGG + Intronic
958764369 3:98347246-98347268 AAGAACATACATTTGGAAAAGGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959213174 3:103415148-103415170 CAAAAGAGATATAAGGAAAATGG - Intergenic
959426514 3:106196486-106196508 AATAATAAACTTATGGAAAATGG + Intergenic
959537676 3:107505324-107505346 AAATATATACATTTAGAAAATGG - Intergenic
959900635 3:111657671-111657693 GAACATATAAATATGGAATAAGG + Intronic
959956319 3:112242311-112242333 GAAAATATACATATACACAATGG + Intronic
960250451 3:115445963-115445985 CATAAAATACATCTGCAAAAAGG - Intergenic
960720467 3:120620364-120620386 TAAAATATACCTTTGGTAAAAGG - Intergenic
960730205 3:120718956-120718978 CAAAGTATATAAATGAAAAATGG + Intronic
961071299 3:123930134-123930156 TGAAATATAAATGTGGAAAAAGG + Intronic
961073755 3:123962562-123962584 GAAAATATAGATAAGCAAAAAGG + Intergenic
961231511 3:125316208-125316230 GAAAATGTACATATGCACAATGG - Intronic
961585960 3:127925135-127925157 CAAAGTATGAATGTGGAAAAGGG - Intronic
962086064 3:132193052-132193074 AAAAATATATATATATAAAATGG - Intronic
962097269 3:132305157-132305179 CAAAATATACCTTTGGTAAAAGG + Intergenic
962118619 3:132538398-132538420 AAAAATATATTTATAGAAAAAGG - Exonic
962779109 3:138694460-138694482 CAAAATTTAAAGAGGGAAAAAGG - Intronic
962779513 3:138698817-138698839 GAAAATATACCTATGAGAAAAGG + Intronic
962890806 3:139671179-139671201 CAAGAGTTACATATGAAAAAGGG - Intronic
963013117 3:140794074-140794096 CAAATTATAAAGATGGAGAACGG + Intergenic
963446291 3:145413155-145413177 CAAACTATACATCTGATAAAGGG - Intergenic
963912243 3:150824729-150824751 CAGAATATACATGTGTAGAAAGG + Intergenic
964221643 3:154353559-154353581 CAAATTAATCATATGCAAAATGG - Intronic
964228204 3:154431647-154431669 TTAAATATAAATTTGGAAAAGGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
964919744 3:161882423-161882445 CAAATGATACACATGGATAATGG + Intergenic
965027498 3:163320904-163320926 AAAAATAGACATATAGAAAACGG - Intergenic
965187526 3:165483987-165484009 CAAATTATACATCTGGTAAGAGG + Intergenic
965284684 3:166803726-166803748 TAAAATATAAATTTAGAAAAGGG - Intergenic
965315568 3:167185821-167185843 ATTAATGTACATATGGAAAATGG - Intergenic
965444291 3:168755487-168755509 CAAATTATACTTATGATAAAAGG - Intergenic
965663002 3:171062085-171062107 CGAAATACACATTAGGAAAATGG - Exonic
965859872 3:173135901-173135923 CATAACATACATTTGGTAAAAGG - Intronic
966032951 3:175373133-175373155 CAAAAAATTAATATGGAACAGGG - Intronic
966052896 3:175642853-175642875 CAAAGTACACAAATGTAAAATGG + Intronic
966113761 3:176435460-176435482 TAATATATTAATATGGAAAACGG + Intergenic
966132253 3:176654342-176654364 GAAAATATACATTTGGGAATAGG - Intergenic
966156041 3:176917723-176917745 CCAAATATACATTTGAAAAGAGG - Intergenic
966195213 3:177306815-177306837 TAAAATATGCATATTTAAAATGG - Intergenic
966238003 3:177724343-177724365 CTAAATAAACATTTGGAATAGGG - Intergenic
966304704 3:178518290-178518312 CCAAGTAGACATAAGGAAAAGGG + Intronic
966403583 3:179571573-179571595 CAAAATCGACAAAGGGAAAAGGG + Intronic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
966619356 3:181946979-181947001 AAAAATATGGATATGGAAAAGGG + Intergenic
966678988 3:182620081-182620103 AAAAGTATACATATTAAAAAGGG + Intergenic
967102511 3:186227882-186227904 CAAAATACCCTTATGCAAAAGGG + Intronic
967659330 3:192086300-192086322 AAAAATATATATATGGTAATTGG - Intergenic
968315750 3:197723607-197723629 CAATATAAAAATATGTAAAATGG - Intronic
1202747423 3_GL000221v1_random:118791-118813 CCAGATGTACATATGGAACATGG + Intergenic
968399181 4:275003-275025 TAAAATATTCATAAGGAAACAGG + Intronic
968417088 4:448012-448034 TAAAATATTCATAAGGAAACAGG + Intronic
970092716 4:12428361-12428383 TAAAATATACCTTTGGTAAAAGG - Intergenic
970639844 4:18051755-18051777 GGATATATACATATGGAAATTGG - Intergenic
970834740 4:20388972-20388994 CAAAATATATATATGTATATAGG + Intronic
970962799 4:21892495-21892517 CATAATATACATACAGAAAATGG - Intronic
971004125 4:22355238-22355260 TAAAATAAAAAGATGGAAAAAGG + Intronic
971114192 4:23624693-23624715 CAAAATAAACATATGAAAATCGG + Intergenic
971541657 4:27824972-27824994 AAAAATGTTCATAGGGAAAATGG + Intergenic
971583355 4:28372179-28372201 CAAAACAAACATATTAAAAAAGG + Intronic
971721658 4:30252984-30253006 CTAAACATATATATGGAAATTGG - Intergenic
971831053 4:31695193-31695215 CAAAATATACAGAATGAAAGTGG - Intergenic
971875839 4:32307492-32307514 TAAAATACATATATGGAGAAGGG + Intergenic
972116363 4:35639866-35639888 CAAACTATACAAATGGGAGAAGG + Intergenic
972196933 4:36665061-36665083 CAAAATATTAATATAGAACAGGG - Intergenic
972216403 4:36902173-36902195 AAAAATATACATAGAGATAATGG + Intergenic
972426760 4:38940642-38940664 CAAAATTTACATAGTGAAAAAGG + Intronic
972753931 4:42024392-42024414 CTATATGTAGATATGGAAAACGG - Intronic
972920573 4:43936312-43936334 CAAACTCTGCATTTGGAAAAAGG + Intergenic
972991435 4:44826131-44826153 TAAAATATACCTCTGGTAAAAGG - Intergenic
973180593 4:47262283-47262305 CAAACTACACATCTGGCAAAGGG + Intronic
973231074 4:47838981-47839003 AAAAATATGCATTTGTAAAATGG + Intergenic
973268074 4:48231332-48231354 CAAAATTTTAATATGGAATAAGG - Intronic
973329541 4:48898205-48898227 CAAAATATACACATAGCTAAAGG - Intronic
974229888 4:59097198-59097220 CAAAATATAAAGATGCTAAAAGG - Intergenic
974313625 4:60247350-60247372 CAGAATATACATATAGACCAGGG + Intergenic
974393037 4:61298010-61298032 CATTATATACATAAGGAAACTGG + Intronic
974397253 4:61353471-61353493 AAAAATACATATATGTAAAAAGG + Intronic
974552686 4:63398749-63398771 AAAAATATAAATAAGGAAAATGG + Intergenic
974590380 4:63941291-63941313 AAAAATATACATAAGTGAAATGG - Intergenic
974624990 4:64414269-64414291 AGAAAGATACATATAGAAAATGG + Intergenic
974826390 4:67136202-67136224 CAAACTATTCATCTGAAAAAGGG - Intergenic
974967537 4:68780354-68780376 CAAAATACACCTATAGAACAAGG - Intergenic
975205548 4:71640757-71640779 TAAAATATACCTTTGGTAAAAGG + Intergenic
975248752 4:72152246-72152268 CAAAAAATACACAGGGAAAATGG - Intergenic
975856621 4:78631415-78631437 TAAAACATATATATGGAGAAAGG + Intergenic
976066322 4:81191716-81191738 GAAAATATACACATCGAAAAGGG + Intronic
976801842 4:89001441-89001463 CAAAAGATACACACTGAAAATGG + Intronic
977135594 4:93299701-93299723 AAAAATATATATATAAAAAAAGG + Intronic
977219077 4:94317510-94317532 CAGAAAATACATATGGCATATGG - Intronic
977515352 4:98015297-98015319 CAATATATCCATCTGAAAAAGGG + Intronic
977967737 4:103173623-103173645 CAAAATATACATCTGACACATGG + Intronic
977972272 4:103226196-103226218 TAAAATATACCTTTGGTAAAAGG + Intergenic
978307697 4:107349829-107349851 CAAGATGTATAGATGGAAAAAGG + Intergenic
978314064 4:107416533-107416555 TAAAATATACCTTTGGTAAAAGG + Intergenic
978486460 4:109260130-109260152 CAAAATATTGATGTAGAAAATGG - Intronic
978662607 4:111146904-111146926 CACAATTTAGAAATGGAAAAAGG - Intergenic
978756722 4:112310744-112310766 CAAAAAAAACTTAAGGAAAATGG - Intronic
978990295 4:115072916-115072938 CAAACTATACATCTGGTAAGAGG + Intronic
978999017 4:115194658-115194680 CAATCTATACATCTGGACAAAGG - Intergenic
979521129 4:121668204-121668226 AAATATATATAAATGGAAAATGG + Exonic
979585727 4:122414251-122414273 AAAAAAAGACATTTGGAAAAAGG - Intronic
979738881 4:124125556-124125578 AAAAATATATATATGAATAATGG - Intergenic
980072886 4:128262419-128262441 TAAAATATACCTTTGGTAAAGGG + Intergenic
980299479 4:130969194-130969216 CAAGATGTAAAAATGGAAAAAGG - Intergenic
980302728 4:131014785-131014807 AAATATATATATATTGAAAAAGG + Intergenic
980438910 4:132815961-132815983 TAAAATATACTTTTGGTAAAAGG - Intergenic
980501268 4:133657306-133657328 CAATAAATACATATGAATAAAGG + Intergenic
981038141 4:140193630-140193652 CAAAATATACACAATGAAATGGG + Intergenic
981248387 4:142567662-142567684 AGATATATACATATGGGAAAAGG + Intronic
981270259 4:142838464-142838486 CAAAATATAAAATAGGAAAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981643257 4:146969183-146969205 CAATATATACAAATGCCAAAGGG + Intergenic
981705285 4:147652896-147652918 AAGAATATAAATATGAAAAAAGG + Intronic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982449573 4:155536359-155536381 CAATATATACATAGGGAGAATGG + Intergenic
982540736 4:156667099-156667121 CAAAATATATAAAGGAAAAATGG - Intergenic
982548198 4:156760777-156760799 CAAAAAATAAATATTAAAAAAGG + Exonic
982642288 4:157978150-157978172 CTAAATATACATTTAGAAACTGG + Intergenic
982687192 4:158505022-158505044 GAAAATATACATATGTAAAATGG + Intronic
982896750 4:160939469-160939491 CAAAACCCACATATGTAAAATGG + Intergenic
982971170 4:161989112-161989134 TAAAATAGACATCTGGAAAAGGG + Intronic
983249965 4:165332138-165332160 AAAAATGTACATATGGATAAAGG - Intronic
983423037 4:167545172-167545194 CAAACTATGCATATGACAAAGGG - Intergenic
984134752 4:175922093-175922115 TAAAATATGCTTATGTAAAATGG + Intronic
984546372 4:181109042-181109064 CCAAATACACATAGGGAAAAGGG + Intergenic
984596404 4:181673781-181673803 CAAAATCTCCCTATGGAAATTGG - Intergenic
984615619 4:181893871-181893893 TAAAATATACATATTTTAAATGG - Intergenic
984680054 4:182597037-182597059 CAAAATGGACACAAGGAAAAAGG - Intronic
984684707 4:182653936-182653958 AAAAATAAATTTATGGAAAAGGG - Intronic
984900096 4:184578679-184578701 ATATATATATATATGGAAAAGGG + Intergenic
985011318 4:185584986-185585008 TAAGAGATAGATATGGAAAAGGG + Intergenic
985082844 4:186283919-186283941 CAAAACATGCACATGAAAAATGG - Intronic
1202754362 4_GL000008v2_random:44627-44649 CCAGATGTACATATGGAACATGG - Intergenic
986039756 5:3981382-3981404 CAAAATATAGATCAGCAAAAAGG + Intergenic
986476358 5:8137743-8137765 TGAAATATACATATGAAAATTGG - Intergenic
986623283 5:9698946-9698968 TAAAGTATATATATTGAAAATGG + Intronic
986657144 5:10025337-10025359 TAAGACATACAAATGGAAAACGG - Intergenic
986859549 5:11910973-11910995 GAAAATGTACCTAGGGAAAAAGG - Intergenic
986906230 5:12496319-12496341 TAAACTATACATCTGGCAAAGGG + Intergenic
987249903 5:16088755-16088777 CAAAATATACAAATAGATCATGG + Intronic
987460634 5:18205133-18205155 CAATATATACATCTGACAAAGGG - Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987554447 5:19428798-19428820 CAAAAGATGCATATGGGAAATGG + Intergenic
987798091 5:22655528-22655550 CAACATATACAAATGCAAAATGG - Intronic
987930643 5:24396083-24396105 TAAAATATACCTTTGGTAAAAGG - Intergenic
987947451 5:24630120-24630142 AAAAATATACAAAAGGAATAAGG + Intronic
987984613 5:25130124-25130146 TAATATATATATATGAAAAAAGG - Intergenic
988112233 5:26836865-26836887 CAAAAATAACAAATGGAAAATGG + Intergenic
988214976 5:28260287-28260309 AAAACAATACATATGGAAAAAGG - Intergenic
988675292 5:33427303-33427325 CAGAATATACATAGGAATAAAGG - Intergenic
988793819 5:34633900-34633922 CAACATATAAATTTGGGAAAAGG + Intergenic
989096149 5:37783320-37783342 TAAAATATACCTTTGGTAAAAGG - Intergenic
989111589 5:37912028-37912050 GAAAATATACTTATGCACAATGG + Intergenic
989673148 5:43943410-43943432 CAAAATGTGCATCAGGAAAAGGG + Intergenic
989846023 5:46142547-46142569 CCAAATGTCCATTTGGAAAATGG - Intergenic
989849530 5:46192022-46192044 CAAAATGTCCATTTGCAAAATGG - Intergenic
989850679 5:46205950-46205972 CCAAATGTCCATATGCAAAATGG - Intergenic
989852482 5:46231854-46231876 CCAAATATCCATAGGAAAAATGG - Intergenic
990003388 5:50921001-50921023 GAACATATACATATGGAATGAGG - Intergenic
990465839 5:56070478-56070500 GAAAATAAATATATGGAAAGAGG + Intergenic
990497767 5:56365993-56366015 GAAAATATAAATATGGTATAGGG + Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991305967 5:65176386-65176408 TAAAATATACCTTTGGTAAAAGG + Intronic
991481684 5:67087959-67087981 CAAAATCTGAATATGGGAAATGG + Intronic
991864538 5:71046546-71046568 AAAAATATACATATTAAATAAGG + Intronic
992568480 5:78026530-78026552 CAAAACCTACATATGTAATAGGG + Intronic
993041013 5:82814765-82814787 CAAAATTTCCATTTGGAAATGGG + Intergenic
993205892 5:84877922-84877944 GAAGATATACAAATGGCAAACGG + Intergenic
993289744 5:86051197-86051219 CAAAAAATACATATAGCTAAGGG - Intergenic
993290010 5:86054929-86054951 CTAAATATACCTATGGAAGATGG - Intergenic
993434588 5:87876118-87876140 CACAAAATAAATATGCAAAAAGG + Intergenic
993511915 5:88781296-88781318 CTAAATTTACATATGCAAAAAGG + Intronic
993740674 5:91534782-91534804 CAAAATGTTCATATGGAAAGGGG - Intergenic
993825026 5:92673226-92673248 TAAAACATACATACTGAAAAAGG + Intergenic
994103285 5:95917479-95917501 GAAAAGATCCATAAGGAAAATGG + Intronic
994452473 5:99959815-99959837 CAATATATCCATATGACAAAGGG - Intergenic
994559153 5:101345864-101345886 CAAAATATAAATAAACAAAACGG + Intergenic
994865722 5:105267175-105267197 GAAAATATATATAAGGAAGATGG - Intergenic
995069746 5:107906103-107906125 CAAAATATACATTTGGATCCAGG - Intronic
995285296 5:110381678-110381700 CAAAAGACATATTTGGAAAAGGG - Intronic
995360373 5:111290023-111290045 CAAATTACACACATGGAAGATGG + Intronic
995701598 5:114941370-114941392 CAAACTATACATCTGATAAAGGG - Intergenic
995904841 5:117111178-117111200 GAAAATATGAATATGCAAAAGGG + Intergenic
996211039 5:120810550-120810572 TAAATTACAAATATGGAAAAGGG - Intergenic
996313529 5:122135159-122135181 CAAATTATACATTTTTAAAATGG + Intronic
996447851 5:123577533-123577555 AAAGATACAAATATGGAAAAGGG - Intronic
996540152 5:124622942-124622964 CAAAATATACCTCAGGCAAACGG - Intergenic
996593552 5:125175850-125175872 CCAATTCTACATCTGGAAAACGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996851969 5:127963243-127963265 CAAATTATACAAATACAAAATGG - Intergenic
997067255 5:130576037-130576059 TAATATATACATATGGAAGTTGG - Intergenic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997865087 5:137454828-137454850 CAAATCATATATATGCAAAAGGG + Intronic
998091643 5:139374459-139374481 CAAAAAAAACAAATGCAAAATGG + Intronic
998783958 5:145689102-145689124 AAAAGTATAAATTTGGAAAAGGG + Intronic
998789688 5:145752717-145752739 CAAAATATAGTTATTGTAAATGG - Intronic
998913260 5:146984978-146985000 CAAACTATACATCTGATAAAGGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999204362 5:149837378-149837400 CAAAAAGTACAAATGGATAAGGG - Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999857788 5:155613937-155613959 CAAACCATACATATCCAAAATGG - Intergenic
1000295587 5:159910860-159910882 CAAAAAATACCTATGGCAATAGG - Intergenic
1000936816 5:167312086-167312108 CAATATATGCATATGGTCAAGGG - Intronic
1000968446 5:167687327-167687349 TAAAATATGCATATGCACAAAGG + Intronic
1001418156 5:171563319-171563341 AAAATCATACATATGGTAAAAGG - Intergenic
1001981229 5:176038189-176038211 CAAACTATACATCAGGCAAAGGG - Intergenic
1002236233 5:177805877-177805899 CAAACTATACATCAGGCAAAGGG + Intergenic
1002855255 6:1030955-1030977 CTAAATATACATATTTAATAAGG + Intergenic
1002987507 6:2205152-2205174 CAAAATTTTCATTTGTAAAATGG - Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004438861 6:15627034-15627056 AAAAGCATACATATAGAAAATGG - Intronic
1004450840 6:15744785-15744807 TAAAATATACAATTGAAAAAAGG + Intergenic
1004821249 6:19370375-19370397 CAACATATACATGAAGAAAATGG + Intergenic
1004944739 6:20598612-20598634 TAAAATATACATATGAAACGAGG + Intronic
1004958762 6:20760997-20761019 CAAAATACACATATGATAAAGGG + Intronic
1005012044 6:21345306-21345328 CAATCTATACATCTGAAAAAGGG + Intergenic
1005034980 6:21547273-21547295 CAAGATAGCCAGATGGAAAAGGG + Intergenic
1005461827 6:26076507-26076529 TAAAATATACCTTTGGTAAAAGG + Intergenic
1005641268 6:27798849-27798871 CAAAAAAGACATATGTAACAGGG - Intergenic
1005795493 6:29356798-29356820 CAACATTTCTATATGGAAAATGG - Intronic
1005813992 6:29535697-29535719 TAAAATTTGCATAAGGAAAAAGG - Intergenic
1006260865 6:32869054-32869076 CAAAAATTAAATATGGACAAAGG + Intergenic
1007849666 6:44791217-44791239 CAAAATATAAAAATTGAACAGGG + Intergenic
1008074887 6:47135059-47135081 CAAAATAGACACATGAAGAAGGG - Intergenic
1008368105 6:50706117-50706139 CAAAATAGACATGTAAAAAAAGG + Intergenic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008779468 6:55085462-55085484 CAAACTATGCATCTGAAAAAAGG + Intergenic
1008855284 6:56078042-56078064 CTAAATATTCATATAAAAAATGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009061929 6:58407153-58407175 CCAAATATCCATTTGCAAAATGG + Intergenic
1009192376 6:60644850-60644872 CTACATATAAATAAGGAAAAGGG - Intergenic
1009249597 6:61281704-61281726 CCAAATATCCATTTGCAAAATGG + Intergenic
1009261810 6:61500280-61500302 CAAAATATCCATTTGCAGAAAGG + Intergenic
1009354858 6:62730444-62730466 CAACAGAAACATATGGAAATTGG - Intergenic
1009409880 6:63353877-63353899 AAGAATATACATTGGGAAAAGGG + Intergenic
1009437902 6:63638480-63638502 CAGAAAAAACATATGTAAAAAGG - Intronic
1009440104 6:63667710-63667732 CAAAATGTATCAATGGAAAAAGG - Intronic
1009537039 6:64900470-64900492 CAATATATCCATCTGGGAAATGG + Intronic
1009551184 6:65093995-65094017 CAAAATATATTTAAGTAAAAAGG + Intronic
1009598596 6:65768541-65768563 CAAAGTTTACATATAGGAAAGGG - Intergenic
1009923662 6:70094399-70094421 CAAAATACACATATGGAAACAGG + Intronic
1010099888 6:72091787-72091809 TAAATTATCCACATGGAAAATGG - Intronic
1010246873 6:73668911-73668933 CAAACTATACATTTGATAAAAGG - Intergenic
1010420377 6:75667305-75667327 CAAAAAGTTCACATGGAAAAAGG + Intronic
1010901967 6:81438481-81438503 AAAAACATACATTGGGAAAATGG - Intergenic
1011023567 6:82841319-82841341 AAAAATATAGATAAGCAAAAAGG - Intergenic
1011136934 6:84110483-84110505 CAATCTATCCATCTGGAAAAAGG - Intergenic
1011147203 6:84231310-84231332 CAAAATACACAATTAGAAAATGG + Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011449952 6:87481970-87481992 TAAAATATACTTTTGGTAAAAGG - Intronic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012215604 6:96579594-96579616 CAAAATACACACATGGTACATGG - Intronic
1012574870 6:100781915-100781937 AAAAATATAGATATGTAAATTGG - Intronic
1012735595 6:102937334-102937356 CAAAACACACATCTGGTAAAGGG - Intergenic
1013207067 6:107954964-107954986 CAAAATATGCATATGGACTAAGG + Intronic
1013507010 6:110810876-110810898 CCAAAAAAAAATATGGAAAAGGG - Intronic
1014045762 6:116884130-116884152 CAACATACATATATGGGAAAAGG - Intronic
1014284563 6:119482254-119482276 CAAAATATACATAGAGACAGTGG + Intergenic
1014385956 6:120802863-120802885 ATATATATATATATGGAAAAGGG + Intergenic
1014396834 6:120934021-120934043 CAAACTATGCATATGACAAAGGG + Intergenic
1014451010 6:121581747-121581769 CAAAATATATATATTAAAACAGG + Intergenic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1015075809 6:129155924-129155946 CTATATACAAATATGGAAAATGG + Intronic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015959037 6:138628383-138628405 CAAAATATGCATATTAAAGATGG - Intronic
1016078629 6:139828814-139828836 TAAAATATTTCTATGGAAAAAGG - Intergenic
1016170660 6:141011324-141011346 CAATATATAAATATAGAAATGGG - Intergenic
1016195379 6:141330234-141330256 CAAAATATGCTCATGAAAAAAGG - Intergenic
1016321299 6:142849034-142849056 CAAATTATAGATATTGAAATAGG - Intronic
1016336971 6:143017491-143017513 AAAAATAAACATATGAAAATGGG - Intergenic
1016500597 6:144716716-144716738 CAAAAGGTAAATATGCAAAAAGG - Intronic
1016542852 6:145185700-145185722 GAAGATATACAAATGGAAAATGG + Intergenic
1016766656 6:147801852-147801874 CTAAATATCCATAGGGAAAAAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017340274 6:153313192-153313214 CAAAATATACATGTGGAAGAAGG - Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1019046328 6:169150498-169150520 CAAAATATGCATAAGAAAACTGG - Intergenic
1019487937 7:1297912-1297934 CAATATATTCATCTGGAAAAGGG - Intergenic
1019544798 7:1568946-1568968 CAAAATATATATATAGAGAGAGG - Intronic
1019880074 7:3851499-3851521 CAAAATATAGCTAAGGAAAAGGG - Intronic
1020043989 7:5026410-5026432 TAAAATATACCTTTGGTAAAAGG - Intronic
1020373588 7:7461089-7461111 CAAACTATAGAAATGGGAAAGGG + Intronic
1020506821 7:9000955-9000977 AAAAATACACAAATGGAGAAAGG + Intergenic
1020566957 7:9809863-9809885 CAAAATATACAAATGCAATGAGG + Intergenic
1020603145 7:10302251-10302273 CATAATTTACATATTGAGAAAGG - Intergenic
1020655618 7:10925333-10925355 TAAAATATACTTTTGGTAAAAGG + Intergenic
1020833417 7:13119603-13119625 CAAAATATAAATATTAACAAGGG + Intergenic
1021102033 7:16595323-16595345 CAAAATAAACATCTGTAAATAGG + Intergenic
1021322025 7:19224069-19224091 CAAAATGTAGATATGGACAACGG - Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022043702 7:26605430-26605452 CAAAATACACATCTGACAAAGGG - Intergenic
1022205839 7:28162828-28162850 CAAAATATGCAAGTGAAAAAAGG + Intronic
1022321326 7:29290674-29290696 CAAAGTATAGATAAGCAAAATGG + Intronic
1022490092 7:30810385-30810407 TAAAATATACCTTTGGTAAAAGG + Intronic
1022578254 7:31520328-31520350 CAAAAAATAAGTATGGAAAGAGG - Intronic
1022714228 7:32883586-32883608 CAAAATGTAATTATTGAAAAGGG - Intronic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1022848630 7:34236852-34236874 CAAAATTTACATGGGGAATATGG + Intergenic
1022885374 7:34638095-34638117 CAAACTATTCATCTGAAAAAGGG + Intergenic
1023134658 7:37039002-37039024 CAAAATATACATTTGGAGGGAGG + Intronic
1023204780 7:37736259-37736281 GAATATATGCAAATGGAAAAAGG + Intronic
1023657876 7:42444187-42444209 CCAAATAAACATATTGAGAAAGG - Intergenic
1023798994 7:43816917-43816939 TAAAATATACCTTTGGTAAAAGG + Intergenic
1024148251 7:46539136-46539158 TCAAATTTACATAAGGAAAATGG + Intergenic
1024620691 7:51154822-51154844 CAAAAGTTACACACGGAAAAAGG - Intronic
1024654911 7:51443865-51443887 TAATATATACATATGTAAAAGGG - Intergenic
1024681486 7:51694023-51694045 AAAAATATATATATTTAAAAAGG - Intergenic
1024793297 7:52992051-52992073 GAAAATATACTCAGGGAAAATGG - Intergenic
1025549331 7:62223376-62223398 CAAAATGTCCATATGCACAATGG + Intergenic
1025578281 7:62676240-62676262 CAAAATGTCCATTTGCAAAATGG - Intergenic
1025578599 7:62680888-62680910 CAAAATGTCCATTTGCAAAATGG - Intergenic
1025586428 7:62794759-62794781 CAAAATATCCATTTGCAGAATGG - Intergenic
1025587689 7:62812904-62812926 CCAAATATCCATATGCAGAATGG + Intergenic
1025589398 7:62837486-62837508 CAAAATGTCCATTTGCAAAATGG - Intergenic
1025593488 7:62894425-62894447 GAAAATATACATTTGCAGAATGG + Intergenic
1025596414 7:62932855-62932877 CAAAATGTCCATATGCAGAATGG + Intergenic
1025771937 7:64516419-64516441 CAAACTGTAAAAATGGAAAATGG + Intergenic
1026264010 7:68780629-68780651 CAGAATAGCCATTTGGAAAAAGG + Intergenic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1027365888 7:77457474-77457496 CAAAATATACATATTACCAAAGG - Intergenic
1027525381 7:79262396-79262418 TAAAATATACATAACTAAAAAGG + Intronic
1027723786 7:81777055-81777077 CAACATGTACATATAGTAAAAGG - Intergenic
1027949445 7:84795653-84795675 CAAATTTTACATCTGAAAAATGG - Intergenic
1028021374 7:85779031-85779053 ATAAATATGCATATGGAAATAGG + Intergenic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028166750 7:87546862-87546884 CAATTTATTCATATGTAAAATGG + Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028333874 7:89627616-89627638 TAAAATATACTTTTGGTAAAAGG + Intergenic
1028770640 7:94616599-94616621 CATAATATACACAGGTAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028793656 7:94880453-94880475 TAAAATATACTTTTGGTAAAAGG + Intergenic
1028895240 7:96033711-96033733 CAAAATGTACATAAGGAGACAGG + Intronic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1029821922 7:103154683-103154705 TAAAATATACCTTTGGTAAAAGG + Intergenic
1029976108 7:104835680-104835702 CAAATTCTTCATATTGAAAATGG + Intronic
1030468561 7:109934335-109934357 AAAAATATAAAGATGGAACATGG - Intergenic
1030868602 7:114730112-114730134 CAAAATATTGATATTAAAAAAGG - Intergenic
1031137739 7:117903303-117903325 CAAAGTCCACATAAGGAAAATGG + Intergenic
1031308998 7:120170173-120170195 CAAAATTTTGACATGGAAAAGGG + Intergenic
1031696001 7:124855141-124855163 CAAAAAATACATAAAGAAAAAGG + Intronic
1032065295 7:128764536-128764558 CAAATTATTCATATGAAAGACGG - Intronic
1032554094 7:132813387-132813409 TAAAATATGCATATCCAAAACGG + Intronic
1032568374 7:132972066-132972088 AAATATATACATATGGGGAAGGG + Intronic
1032732109 7:134653911-134653933 GAACAGGTACATATGGAAAATGG - Intronic
1033530591 7:142258973-142258995 GAATATATACAGATGGTAAATGG + Intergenic
1033622538 7:143075270-143075292 CAAAATATACCTAAGGTATAGGG - Intergenic
1034518097 7:151597515-151597537 CAAACTATACATCTGATAAAGGG + Intronic
1035915277 8:3613624-3613646 CAAAATATACAAACAAAAAATGG + Intronic
1036024153 8:4884385-4884407 CAAAAAATACATATAGATATTGG - Intronic
1036095028 8:5714277-5714299 CAAAATATAAAAATTGAAAATGG - Intergenic
1036112936 8:5925570-5925592 CAGAAAATAAATATAGAAAAAGG + Intergenic
1037082210 8:14801413-14801435 CAAATTATAAATTTGGAAGATGG + Intronic
1037119952 8:15271379-15271401 CAAACCATACATATGTTAAAGGG + Intergenic
1037682581 8:21109898-21109920 CAATATATACATATGGAATGAGG - Intergenic
1038748481 8:30274671-30274693 CATAATATAAATATGTTAAAGGG - Intergenic
1038933204 8:32218346-32218368 GAAAAGTGACATATGGAAAATGG - Intronic
1038997594 8:32942407-32942429 CAACATATACATATCAATAAAGG - Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039674940 8:39652288-39652310 CAAACTATACATCTGATAAAAGG + Intronic
1039783384 8:40810586-40810608 AAAAATATGAATATGAAAAATGG + Intronic
1039876878 8:41594354-41594376 TAAAATATACCTTTGGTAAATGG - Intronic
1040381052 8:46873413-46873435 TAAAAAATATAGATGGAAAATGG + Intergenic
1040698267 8:50028954-50028976 CAAAATATCCAATTTGAAAATGG - Intronic
1040734508 8:50489675-50489697 CAATCTATCCATATGGCAAAGGG - Intronic
1040993495 8:53377304-53377326 TAAAATATACCTTTGGCAAAAGG - Intergenic
1041312569 8:56531555-56531577 CAAAATAAAGATATGACAAAGGG + Intergenic
1041364314 8:57084672-57084694 CAATCTATACATATTGACAAAGG + Intergenic
1041515371 8:58693583-58693605 TAAAATATACGTTTGGTAAAAGG + Intergenic
1041973639 8:63772588-63772610 AAAAATATACATCAGAAAAATGG - Intergenic
1041990668 8:63987015-63987037 CAAGATATAAATATGGTAAAAGG - Intergenic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042153968 8:65821192-65821214 AAAAATACAAATATGAAAAAAGG - Intronic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1042359347 8:67864839-67864861 CAAAATATCCAAAAGGAAAATGG + Intergenic
1042430695 8:68703084-68703106 CAAAATAGACTTAAGGAAGATGG - Intronic
1042491726 8:69407244-69407266 CAAACCATACATATAAAAAAGGG + Intergenic
1042588867 8:70374892-70374914 GAAAATATAGATAAGTAAAAAGG - Intronic
1042958207 8:74274386-74274408 CAAAATTTATATCTGGAAATTGG - Intronic
1043046612 8:75331914-75331936 CAAAACATATATATGTGAAAAGG - Intergenic
1043176821 8:77031745-77031767 AAAAATATATATTTGAAAAAAGG + Intergenic
1043293422 8:78633641-78633663 TTAAATATACATATATAAAATGG + Intergenic
1043405306 8:79926119-79926141 GAATACATACATATGGAAAGGGG + Intronic
1043915995 8:85922548-85922570 CAAAATGTTCATATGTGAAAAGG + Intergenic
1044169973 8:89038292-89038314 CAACACAAACATATAGAAAATGG + Intergenic
1044184770 8:89238263-89238285 TAAAATATACTTTTGGTAAAAGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1045085116 8:98674078-98674100 GAGAAAATACATATGAAAAATGG + Intronic
1045136628 8:99227485-99227507 AAAAATGTTAATATGGAAAAAGG - Intronic
1045400789 8:101815415-101815437 CAAAAAATAAATCTAGAAAAAGG + Intronic
1045598754 8:103689824-103689846 GAAAATAAAGAAATGGAAAAAGG - Intronic
1045733088 8:105264112-105264134 GAAAATATGCATATTGAAGAAGG - Intronic
1045738611 8:105325526-105325548 CAAAATATCAATATAGAAAGTGG + Intronic
1045745392 8:105413405-105413427 CAAAATATACATATAAAAAAGGG - Intronic
1045811650 8:106227956-106227978 CAAAAGATACTTGTGGTAAATGG - Intergenic
1046136144 8:110029890-110029912 TAAAATATTCATATGTTAAAAGG - Intergenic
1046244758 8:111544523-111544545 TAATATATACATATATAAAATGG - Intergenic
1047268623 8:123332837-123332859 GAATATATATATATGGAAATTGG - Intronic
1047771636 8:128034596-128034618 CTAAACATACATGTGCAAAATGG + Intergenic
1048075728 8:131068587-131068609 CAAAATATAAATGTGGTACAAGG - Intergenic
1048088439 8:131210501-131210523 CAAACTATGCATATGAAAAAAGG - Intergenic
1048146354 8:131848192-131848214 CAAATTATACATCTGGTGAAAGG + Intergenic
1048153101 8:131913373-131913395 CAAGAAATACATATGCAAAAGGG - Intronic
1048209566 8:132443511-132443533 CAAAAGATACATGGAGAAAAGGG + Intronic
1048769117 8:137876824-137876846 GAAATTAAAAATATGGAAAAAGG + Intergenic
1048841857 8:138573565-138573587 CAATACATAGATATTGAAAAGGG - Intergenic
1050409560 9:5348765-5348787 CAAAAAATAAAAATGGAAGATGG - Intergenic
1050674895 9:8040835-8040857 CAAACTATACATCTGACAAAGGG + Intergenic
1050951250 9:11598399-11598421 CAAAATTTACACAAGGAAATTGG - Intergenic
1051208059 9:14710833-14710855 CAAAATATATATATGTTAAAGGG + Intergenic
1051653738 9:19356955-19356977 AAAAAGCTACATAAGGAAAAGGG - Exonic
1051753835 9:20373606-20373628 CAAAATAAAAATAGTGAAAAGGG + Intronic
1052051452 9:23852755-23852777 CAAAACATACAATTGTAAAAAGG - Intergenic
1052118719 9:24681613-24681635 CAAAATATCAGTGTGGAAAATGG + Intergenic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1052473883 9:28933427-28933449 CAAAAAATATGTTTGGAAAATGG - Intergenic
1052636176 9:31107611-31107633 ATAAATACACATATGTAAAATGG - Intergenic
1052763034 9:32611944-32611966 ATAAATAGACATATGGAATATGG - Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1053026419 9:34732516-34732538 CAAACTATTCATCTGGACAAGGG - Intergenic
1053597558 9:39578229-39578251 AAAAATATAGATATAGTAAAGGG + Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1054568707 9:66786771-66786793 AAAAATATATATATAGTAAAGGG - Intergenic
1054571083 9:66811520-66811542 CGACATAGATATATGGAAAATGG - Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1054740313 9:68799970-68799992 CAAACTATACATCTGAAAAGGGG + Intronic
1055061942 9:72078053-72078075 CAATCTATCCATCTGGAAAAAGG + Intergenic
1055235381 9:74116110-74116132 CAGCAAATACATATGCAAAAGGG - Intergenic
1055302413 9:74896113-74896135 AAAAATTTACATATGTAGAATGG + Intergenic
1055311576 9:74987733-74987755 CAAACTGTACATTTGTAAAAAGG + Intronic
1055512459 9:77008840-77008862 CAAATTACTCATATGTAAAATGG - Intergenic
1055884289 9:81041139-81041161 CATAATACAGATATGCAAAAGGG - Intergenic
1055897003 9:81188763-81188785 TCAAATAAACATATGAAAAAAGG + Intergenic
1055949429 9:81716895-81716917 CAAAATAGACATATATATAAAGG + Intergenic
1056562680 9:87746134-87746156 GAAAATATACATATACACAATGG - Intergenic
1056662380 9:88553900-88553922 CAACACATACATAAGGAAAGAGG - Intronic
1057966950 9:99513477-99513499 AAAGTTATACAGATGGAAAATGG + Intergenic
1058648945 9:107157092-107157114 CAAAATATACATATCCAACCTGG + Intergenic
1058720987 9:107763592-107763614 CATCATATATATATGGAAAAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059180906 9:112211233-112211255 GAACATATACAGAAGGAAAATGG - Intergenic
1059280486 9:113129243-113129265 CAAAATGTATTTATAGAAAATGG - Intergenic
1059509602 9:114832145-114832167 CAAAATATACATCTGGCAAGTGG - Intergenic
1059594945 9:115709608-115709630 CAAAATATGCATCCGAAAAAGGG - Intergenic
1059595505 9:115715836-115715858 CAAAATGTACATGTCTAAAACGG - Intergenic
1059988793 9:119844938-119844960 GAAAATGTTCATATGAAAAATGG + Intergenic
1060659523 9:125396119-125396141 GAAAAGATACACATAGAAAAAGG + Intergenic
1061600098 9:131663087-131663109 CAAAATATAACTTTGGAAAGCGG - Intronic
1061938849 9:133873363-133873385 CAAGACATACAGATGGCAAAGGG + Intronic
1203716059 Un_KI270742v1:148882-148904 CCAGATGTACATATGGAACATGG + Intergenic
1203535155 Un_KI270743v1:29354-29376 CCAGATGTACATATGGAACATGG - Intergenic
1203650296 Un_KI270751v1:112452-112474 CCAGATGTACATATGGAACATGG + Intergenic
1185512202 X:671928-671950 CAATATATACATTTAGAAAGGGG - Intergenic
1186272615 X:7905529-7905551 CAAAATATACCTTAAGAAAATGG - Intronic
1186558727 X:10588217-10588239 TAAAATATACCTTTGGTAAAAGG - Intronic
1186991300 X:15071632-15071654 CAAAATACAGTTATGTAAAAAGG + Intergenic
1187566699 X:20457445-20457467 GAAAATATAAATTTGGAAAGGGG - Intergenic
1187864650 X:23713226-23713248 GAAAATGTACATATGAGAAATGG + Intronic
1187948255 X:24447418-24447440 CAAACTATACATGTCCAAAATGG - Intergenic
1188089304 X:25943113-25943135 CAAAGTTTATATTTGGAAAATGG + Intergenic
1188220050 X:27530410-27530432 CAATATATACTTGTGGAACAGGG - Intergenic
1188437755 X:30181668-30181690 TAACAAATACATAAGGAAAAGGG - Intergenic
1188641711 X:32513743-32513765 CTAAAGATACATATGGGAGAAGG + Intronic
1188763659 X:34062664-34062686 CAACATCTACATTTGGATAATGG + Intergenic
1188929790 X:36093534-36093556 GAAAACATACAAATGGCAAATGG - Intronic
1188940972 X:36237297-36237319 CAAAAAATAAATAAGTAAAAGGG - Intronic
1189034451 X:37481427-37481449 TAAAATATACCTTTGGTAAAAGG + Intronic
1189056373 X:37703557-37703579 CAAAATAGTTCTATGGAAAATGG + Intronic
1189138594 X:38577203-38577225 CAAACTAAACACATGCAAAATGG - Intronic
1189251269 X:39602132-39602154 CTAACTCTGCATATGGAAAATGG - Intergenic
1189425882 X:40899515-40899537 CATACCATACATATGGAAAAGGG - Intergenic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1189673084 X:43432996-43433018 CAAACCATACATCTGGAAAGAGG + Intergenic
1189833980 X:45002576-45002598 TAAAATATACCTTTGGTAAAAGG - Intronic
1189972228 X:46429604-46429626 CAAAATATGAAAATGCAAAAAGG + Intergenic
1190270112 X:48856251-48856273 TAAAATATACCTTTGGTAAAAGG + Intergenic
1190751438 X:53365241-53365263 ATAAATAAACATATGGAAGACGG - Intergenic
1190771115 X:53515210-53515232 TAAAATATACCTTTGGTAAAAGG + Intergenic
1190971656 X:55356068-55356090 CAAAATAAACCTAAGGGAAAAGG + Intergenic
1191134934 X:57053655-57053677 CAATCTATACATTTGAAAAAGGG - Intergenic
1191708774 X:64124465-64124487 AAGAATATACATATAGGAAAAGG + Intergenic
1191819662 X:65290634-65290656 GAAAATATACATATACACAATGG + Intergenic
1191890015 X:65930220-65930242 TAAAATATACTTTTGGTAAAAGG - Intergenic
1192570586 X:72200895-72200917 TAAAATAAACATTTTGAAAAGGG - Intronic
1192597751 X:72429293-72429315 CAAAATGTACAGATTGAAACTGG - Intronic
1192868055 X:75156694-75156716 AAGAATATGCATAGGGAAAATGG - Intronic
1192922921 X:75726395-75726417 CAAAATATACCAATTAAAAATGG - Intergenic
1193717234 X:84947219-84947241 TAAAATATACCTTTGGTAAAAGG + Intergenic
1193944644 X:87720076-87720098 AAAAATATACATATTTAGAAGGG - Intergenic
1194044116 X:88981042-88981064 TAAAATATTAATATGGAAATAGG - Intergenic
1194249612 X:91558833-91558855 GAAGACATACATATGGCAAAAGG + Intergenic
1194292682 X:92094073-92094095 CAAAATATAAATAGGTAAAAAGG - Intronic
1194549041 X:95273700-95273722 AAAAATAAACATATAGAAGATGG + Intergenic
1194679109 X:96830006-96830028 CCAAATATATATATAAAAAAAGG + Intronic
1194885920 X:99316101-99316123 AAAAATAGAAAAATGGAAAAAGG - Intergenic
1194992490 X:100559765-100559787 AAAGATAAAGATATGGAAAATGG + Intergenic
1195189128 X:102432325-102432347 CAAAACATATATATGAATAAGGG + Intronic
1195250126 X:103035692-103035714 CAAACTATACATCTGATAAAGGG - Intergenic
1196071698 X:111530912-111530934 CAAAATATTCATGAGGAAAATGG - Intergenic
1196118242 X:112020229-112020251 AAAAATATACATCTGAAAAATGG - Intronic
1196216545 X:113058993-113059015 CAAAACATACATCTGACAAAGGG - Intergenic
1196313715 X:114198155-114198177 CATAATATGTATTTGGAAAATGG - Intergenic
1196423139 X:115543163-115543185 TAAAATATACCTTTGGTAAAAGG - Intergenic
1197196483 X:123707507-123707529 CAAAAAATACATGTATAAAATGG + Intronic
1197582158 X:128296749-128296771 CTAGATATTCATATGCAAAAGGG + Intergenic
1197582160 X:128296777-128296799 CTAGATATTCATATGCAAAAGGG + Intergenic
1197625704 X:128800126-128800148 CAAAATGCTCATATGCAAAAGGG - Intergenic
1197674786 X:129317569-129317591 CAAAAAATGCATATGAAAATTGG - Intergenic
1197964463 X:132043473-132043495 TAAAATATTCATTTGGAAAGGGG - Intergenic
1198766934 X:140089996-140090018 CCAATTACACATATGGAAAAAGG + Intergenic
1198914575 X:141653998-141654020 CAAAATATAAATAAGGAAATTGG - Intronic
1198945170 X:142003910-142003932 CAAAAAATAAATATGAAATAAGG - Intergenic
1199278463 X:145972805-145972827 TAAAATATACTTTTGGTAAAAGG + Intergenic
1199293992 X:146136864-146136886 AAAAATATACATATGGGCACAGG - Intergenic
1199353675 X:146834958-146834980 TAGGATATACATATAGAAAAGGG - Intergenic
1199408663 X:147493827-147493849 ATAAATATACATAAGGAATAAGG + Intergenic
1199637674 X:149828901-149828923 TAAAATATACCTTTGGTAAAAGG + Intergenic
1199891931 X:152093260-152093282 GATAATATACATATAGAGAAGGG - Intergenic
1200337459 X:155365285-155365307 TAAAATATATATAGGGAAAGTGG + Intergenic
1200349011 X:155475942-155475964 TAAAATATATATAGGGAAAGTGG - Intergenic
1200568569 Y:4800083-4800105 GAAGACATACATATGGCAAAAGG + Intergenic
1200610185 Y:5318653-5318675 CAAAATATAAATAGGTAAAAAGG - Intronic
1200763385 Y:7060208-7060230 TAAAATATACCTTTGGTAAAAGG - Intronic
1200898156 Y:8398092-8398114 CAAAATATACATATGACACAGGG - Intergenic
1201189314 Y:11433032-11433054 CAAAATATACATATATAGGAAGG + Intergenic
1201686193 Y:16705296-16705318 CAAAATTTTCATGTGTAAAATGG - Intergenic
1202070214 Y:20984576-20984598 CAAACTCTACTTATGTAAAAGGG - Intergenic
1202183652 Y:22160493-22160515 AAAAATATTGATATGGAAGAGGG - Intergenic
1202207707 Y:22425908-22425930 AAAAATATTGATATGGAAGAGGG + Intergenic