ID: 1168489350

View in Genome Browser
Species Human (GRCh38)
Location 19:56795313-56795335
Sequence CGTGAGGAAGACTCCGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168489350_1168489361 30 Left 1168489350 19:56795313-56795335 CCCGCCGCGGAGTCTTCCTCACG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1168489361 19:56795366-56795388 CTTGCGCCCTCAAGTCCACTGGG 0: 1
1: 0
2: 0
3: 2
4: 72
1168489350_1168489354 1 Left 1168489350 19:56795313-56795335 CCCGCCGCGGAGTCTTCCTCACG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1168489354 19:56795337-56795359 AGCCGCGCGCTGCCCCGCGCTGG 0: 1
1: 0
2: 0
3: 23
4: 196
1168489350_1168489360 29 Left 1168489350 19:56795313-56795335 CCCGCCGCGGAGTCTTCCTCACG 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1168489360 19:56795365-56795387 TCTTGCGCCCTCAAGTCCACTGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168489350 Original CRISPR CGTGAGGAAGACTCCGCGGC GGG (reversed) Intronic
901051930 1:6429681-6429703 AGTGAGGAAGGCTCAGGGGCTGG - Intronic
906528694 1:46511181-46511203 CGTGAGGAGGACCCCAGGGCAGG + Exonic
908389944 1:63675292-63675314 TGTGAGAAAGCCTCCGCAGCAGG + Intergenic
1069582450 10:69574985-69575007 CTGGAGGAAGACGCCGAGGCGGG + Intergenic
1073094095 10:100969502-100969524 CGAGAGGAAGGGGCCGCGGCTGG - Intronic
1076659292 10:132044600-132044622 CCTGAGGAAGAGCCCGCGCCAGG - Intergenic
1077273217 11:1691528-1691550 CGCGAGGAGGGGTCCGCGGCTGG - Intergenic
1083186729 11:61021973-61021995 GGTGGGGCAGACTCAGCGGCAGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1113831213 13:113297254-113297276 CACGAAGAAGACACCGCGGCCGG - Exonic
1115591869 14:34873717-34873739 AGTGAGGAAGAAGTCGCGGCTGG - Intronic
1117094985 14:52288040-52288062 CGTGAGGAAGATGCTGTGGCAGG + Intergenic
1121544422 14:94753003-94753025 TGTGAGGAAGAGGCCACGGCAGG + Intergenic
1130490182 15:84425533-84425555 GAAGAGGGAGACTCCGCGGCAGG - Intergenic
1139702739 16:68718959-68718981 CGTGAGGGAGCCACCGCGCCCGG - Intronic
1142151882 16:88516254-88516276 CGTGGGGATGACTCCTGGGCCGG - Intronic
1143563598 17:7708962-7708984 AGTGGGGAGGACTCCGTGGCAGG + Intronic
1148134756 17:45285014-45285036 AGTGAGGAAGACTCTCCAGCTGG + Intronic
1148867321 17:50635233-50635255 AGTGAGGAAGAGTGCGCGGCTGG + Intronic
1151154610 17:72116028-72116050 CGTGAGGGAGTCTCGGGGGCTGG - Intergenic
1153621367 18:6981342-6981364 TGTGAGGAAGACTCCCAGGTAGG - Intronic
1158517605 18:58143742-58143764 TGTGAAGAAGACACAGCGGCCGG + Intronic
1160592733 18:79952868-79952890 CGTGGAGAAGAGGCCGCGGCTGG - Intergenic
1163128043 19:15254994-15255016 CCGGAGGAAGACTCAGCAGCAGG + Intronic
1168489350 19:56795313-56795335 CGTGAGGAAGACTCCGCGGCGGG - Intronic
927503335 2:23596706-23596728 CGATAGGAAGACTCCGATGCTGG + Intronic
929598168 2:43188982-43189004 CGTGAGGGAGGCACCGCGGCTGG - Intergenic
937084964 2:119165513-119165535 CATGAGGAAGACTAAGGGGCTGG - Intergenic
940989086 2:160079816-160079838 CGTGAGGGAGAATCTGCGCCAGG - Intergenic
943692276 2:190881144-190881166 CGTGAGCGCGACTCTGCGGCGGG + Exonic
948767846 2:240232798-240232820 TGTGCGGAAGGCTCTGCGGCCGG + Intergenic
1175565937 20:59976984-59977006 AGTGAGGAAGAATCGGCGGAAGG + Intronic
1180177771 21:46098575-46098597 CGCGGGGAAGACGCCCCGGCTGG + Intronic
1182764245 22:32746997-32747019 CGGGAGGTAGACTCCCTGGCTGG + Intronic
1182994138 22:34797427-34797449 CGTGAGGAAGGCCCAGAGGCAGG + Intergenic
953033561 3:39192951-39192973 CGTCAGGAAGAGTCAGAGGCAGG - Intergenic
954862930 3:53705223-53705245 TGTGAGGAAGGCTCCGTGGGAGG + Intronic
962240239 3:133746016-133746038 ACAGAGGAAGACTCCGAGGCTGG - Exonic
968517933 4:1022682-1022704 TGGGAGGAAGGCTCCGAGGCTGG - Intronic
991491009 5:67182537-67182559 CCTGTGGGAGACTCCGGGGCCGG + Exonic
993898791 5:93570814-93570836 CGCGCGCAAGGCTCCGCGGCCGG + Intergenic
997585182 5:135039642-135039664 CCTGAGCCAGAGTCCGCGGCGGG - Intronic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1006402487 6:33825947-33825969 AGTGAGGAAGAGTCTGGGGCTGG - Intergenic
1007558008 6:42782780-42782802 CGAGGGGAAGACGGCGCGGCGGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1036802896 8:11806061-11806083 AGTGAGGAAGGCTCCGTGGAGGG + Intronic
1039315468 8:36367183-36367205 CATGAGGAAGACTCCTCTCCTGG + Intergenic
1047336276 8:123939721-123939743 CGGCAGGAAGACTCAGCAGCTGG + Intronic
1053004394 9:34594338-34594360 CTTGAGGAAGGCTCCTCGCCCGG - Intergenic
1203616807 Un_KI270749v1:73277-73299 CGTGGGGAACAAGCCGCGGCGGG - Intergenic
1198328130 X:135595198-135595220 CGTGAGGAAGAGTCCCCTGCAGG + Intergenic
1198338332 X:135689801-135689823 CATGAGGAAGAGTCCCCTGCAGG - Intergenic
1200003968 X:153075464-153075486 CATGTGGAGGACTCCGCGGGTGG + Intergenic
1200108235 X:153726006-153726028 CGTGAGGAACACCACGAGGCCGG - Exonic