ID: 1168489637

View in Genome Browser
Species Human (GRCh38)
Location 19:56797402-56797424
Sequence CTCTCTCACCTTTCTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168489637_1168489642 14 Left 1168489637 19:56797402-56797424 CCATCCTTAGAAAGGTGAGAGAG 0: 1
1: 0
2: 0
3: 25
4: 204
Right 1168489642 19:56797439-56797461 ACAGTGTAGACTACAGAACCAGG 0: 1
1: 0
2: 0
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168489637 Original CRISPR CTCTCTCACCTTTCTAAGGA TGG (reversed) Intronic
903803133 1:25984790-25984812 TTCTCCCACTTTTCTAGGGAAGG + Intronic
905450461 1:38052827-38052849 GTATCTCACTTTTCTAATGATGG - Intergenic
909166460 1:72232458-72232480 CTATCTAACCTCTTTAAGGAAGG - Intronic
909875473 1:80797416-80797438 CCTTCTCACATTTCTAAGGATGG + Intergenic
910983429 1:92981322-92981344 CTCTCTCACCCTTCATAGAATGG - Intergenic
911469985 1:98306595-98306617 CTCTAACAGCTTTCTAAGAAAGG + Intergenic
911567092 1:99475067-99475089 CTCTTTCCCCTTTATAAAGAAGG - Intergenic
911684892 1:100764328-100764350 CTCTTTCACCTTTCAAAGCCTGG - Intergenic
912518833 1:110231870-110231892 CTCCATCACCTTTCTAGGGAAGG - Intronic
915086264 1:153390948-153390970 TTCTCTCTCCTCTCTCAGGAAGG + Intronic
915456548 1:156044313-156044335 CTCTCTCCCTTTTCTGGGGAAGG - Intronic
915552716 1:156644546-156644568 CTCTCTGACCTTTCAGAGGGAGG - Intronic
916831125 1:168492545-168492567 CTCCCTCATCTTTCTAAGGGTGG + Intergenic
917201189 1:172517261-172517283 CTCTTTCACTTGTCCAAGGATGG - Intergenic
917474028 1:175352927-175352949 TTCTCTCACCTCTCTGGGGATGG + Intronic
921948599 1:220906346-220906368 GTCATTCACCTTTCAAAGGAAGG + Intergenic
922916145 1:229259344-229259366 CTCTCCCTCCTTTCTTAGGGAGG - Intergenic
923437341 1:233979850-233979872 CTCCCTCACCTATCAAACGACGG - Intronic
923448645 1:234095971-234095993 ATCTCTCACCTATTTCAGGATGG - Intronic
1065747277 10:28854028-28854050 CTCTCTCACCTTTTTGAGATGGG + Intronic
1066299433 10:34083860-34083882 ATCTGTCACCTTCCTGAGGAAGG + Intergenic
1066336912 10:34487192-34487214 CTCACTCTCTTTTCTAAGGTCGG + Intronic
1068991638 10:63157021-63157043 CTCTCTCCCCTTCCAAAGGATGG - Intergenic
1069701206 10:70427763-70427785 CTCTGCCACCTTTCTAAGGGTGG + Exonic
1070473732 10:76811909-76811931 TTCTCTGACCTTTATGAGGATGG + Intergenic
1070755970 10:78993569-78993591 CACTATCACCTCTCTTAGGAAGG - Intergenic
1074369295 10:112886648-112886670 GTCTCTCACCTGGCTGAGGAGGG - Intergenic
1076075073 10:127527176-127527198 CTCTCTCTCCTTCCTGGGGAAGG - Intergenic
1076603319 10:131673498-131673520 CTCTCTCCCCTCTCTAAGTTGGG + Intergenic
1080133707 11:28827842-28827864 CTGTCTCACCTGTCTCAGGATGG - Intergenic
1081430650 11:42973019-42973041 CTCCCTCTCCTCTCTAAGGGTGG - Intergenic
1081674688 11:44961929-44961951 GTCTCTGTCCTCTCTAAGGAGGG + Intergenic
1082761805 11:57134334-57134356 CTCTCTCAGCTTTCACAGAATGG + Intergenic
1086586001 11:88451896-88451918 CTCCCTCACCCTTCTGAGTAGGG - Intergenic
1088188351 11:107198607-107198629 CTTTCTCACCTTCCTCTGGAAGG - Intergenic
1090208720 11:124900300-124900322 CTTTCTCACCCTGCTGAGGACGG - Intergenic
1090795506 11:130132300-130132322 CTCTCTGACCTTTCAAAGCAAGG - Intronic
1091026083 11:132142334-132142356 GTATCTCACCTCTCTCAGGATGG - Intronic
1091840344 12:3616093-3616115 CTCTCTGAGCTTTGTCAGGAAGG - Intronic
1093822419 12:23637748-23637770 CTTTCTCACCACACTAAGGATGG - Intronic
1096505100 12:52087701-52087723 CTATCTCATTTTCCTAAGGATGG - Intergenic
1097269331 12:57764778-57764800 CTCTGTCACATTTCCCAGGATGG + Exonic
1098075160 12:66721936-66721958 CTCTCTCAGCTTTCACAGAATGG + Intronic
1098968529 12:76822503-76822525 AGCTTTCAGCTTTCTAAGGAAGG - Exonic
1100745324 12:97639360-97639382 ACCTCTCACCTTCCTAAGGATGG - Intergenic
1104054917 12:125222141-125222163 CTTTCCCACCTTTCTAATAAAGG - Intronic
1104157007 12:126143014-126143036 CTCTCTCTCCTTTCTCTGGGAGG + Intergenic
1107438222 13:40400998-40401020 CTCTCCCACCTTTCCAAGAGAGG + Intergenic
1114271334 14:21102107-21102129 CCCTCTCACCTTCCAAAGGCGGG - Exonic
1115207171 14:30921031-30921053 CCTTCTCACCTTTCTGAGAATGG - Intronic
1115738332 14:36359689-36359711 TTCTCTAACCATTCGAAGGAAGG - Intergenic
1116257867 14:42580591-42580613 ATCTCTGACCCTTCTATGGAAGG - Intergenic
1116600434 14:46915608-46915630 ATCTCTTTCCTTTCTGAGGAAGG + Intronic
1116762649 14:49033385-49033407 CTCTCTCCTCTTCCTAAGTATGG + Intergenic
1117825503 14:59698129-59698151 CTGTCAGAACTTTCTAAGGATGG + Intronic
1117865204 14:60141018-60141040 CTCTTTCATCTTTATAAGTAGGG - Exonic
1120067199 14:80056477-80056499 CTCTCTCATCTTTCTCAGGGCGG + Intergenic
1120209985 14:81624439-81624461 CTCCCTCACCATTCTAGGGCTGG - Intergenic
1120566761 14:86069067-86069089 CTCTGTCACCTTTTTTATGAAGG - Intergenic
1121211782 14:92212754-92212776 CTCTCTGACCTTCCTTAGAATGG - Intergenic
1121910316 14:97784432-97784454 CTCCGTCACCTCTCTGAGGAGGG + Intergenic
1121928788 14:97953124-97953146 CTCTCTCACATTTCTCCTGATGG - Intronic
1126387666 15:48110477-48110499 CCCTCTCTCATTGCTAAGGAAGG + Intergenic
1128138233 15:65280131-65280153 ATGGCTAACCTTTCTAAGGAAGG - Intronic
1128606863 15:69043009-69043031 CTCTCTCCCCCTTCTAATGGGGG - Intronic
1129970714 15:79775542-79775564 CTCTCTCACCTGCCTAGGAAGGG + Intergenic
1131328282 15:91469914-91469936 TTCTCTCATCTTTATAATGACGG + Intergenic
1136365784 16:29808560-29808582 CTGCCTCACATTTCTGAGGAGGG - Exonic
1136929230 16:34403995-34404017 CTCTCTCTCAGTTCTAAGAAGGG - Intergenic
1136975344 16:35007809-35007831 CTCTCTCTCAGTTCTAAGAAGGG + Intergenic
1137584094 16:49653666-49653688 CTCTCTCTCCTTTGCAGGGAGGG + Intronic
1146685962 17:34841819-34841841 TTCTCCCACCTTGCTAGGGATGG - Intergenic
1146810880 17:35902151-35902173 CTTTCCCACCTTTCTTAGGTTGG + Intergenic
1146979090 17:37142552-37142574 ATCACTCTCCTTTCTAAAGAGGG - Intronic
1147329570 17:39689186-39689208 CTCTAGCACCTTGCTAAGCAAGG + Intronic
1147555425 17:41476062-41476084 CTCTCACACCCATCTGAGGAGGG + Intergenic
1151759142 17:76090764-76090786 CACACTCCCCTTTCTAAAGATGG + Intronic
1152174429 17:78778188-78778210 CTCCCTCAGCTTTCTGAGTAGGG - Intronic
1153145044 18:2021730-2021752 CTCACTCACCTTGCTATGGATGG + Intergenic
1153260389 18:3218015-3218037 CTCTCTTACCTCTTTAAGTAGGG - Intronic
1156492174 18:37502727-37502749 CTGTCTCACCTCACTAAGGATGG + Intronic
1157415307 18:47497527-47497549 CTCTCTCTCCTTACTGAGGCAGG + Intergenic
1157562324 18:48657060-48657082 CTCTCTCCCCTTTCGATGGTGGG - Intronic
1157863826 18:51164323-51164345 CCCTCTCAAATGTCTAAGGAGGG + Intergenic
1158934096 18:62348807-62348829 CTCTCTCATCATTCTGGGGAGGG + Intronic
1159643611 18:70891628-70891650 ACCTCTTACCTCTCTAAGGAAGG - Intergenic
1159755364 18:72357856-72357878 CTCTCTGACCTCTTTAGGGAAGG - Intergenic
1160212505 18:76894269-76894291 CTCCCTCACCCCTCTCAGGATGG - Intronic
1160983119 19:1825846-1825868 ATCTCCCACCTTTCCAAGCAAGG - Exonic
1163807958 19:19411425-19411447 CCCTCTCAGTTCTCTAAGGAAGG - Intronic
1164729562 19:30492510-30492532 CTATCTGACCTTTCAAAGGAAGG - Intronic
1166253811 19:41588254-41588276 CCCTCTCTCATTTGTAAGGAAGG + Intronic
1166993686 19:46708609-46708631 ATCTCTTCCCTTTATAAGGAAGG - Intronic
1168489637 19:56797402-56797424 CTCTCTCACCTTTCTAAGGATGG - Intronic
924965707 2:74463-74485 CTCTTTCACATTTGTGAGGACGG + Intergenic
926759365 2:16263757-16263779 CTCTCTCCTCTGTCTAAGGGGGG - Intergenic
927010703 2:18900808-18900830 CTCACTCTCCTTCCCAAGGAGGG - Intergenic
928340604 2:30439973-30439995 CTCTCTTTCCTTTATAAGGTTGG - Intergenic
929464669 2:42133817-42133839 TTCTCTCTCTTTTCTCAGGAAGG + Intergenic
930229126 2:48826291-48826313 CTCTCTCATCCTTATAAAGAGGG - Intergenic
931022379 2:58062682-58062704 CTCTCTCAGCTTTCCCAGAATGG - Intronic
932590530 2:73064018-73064040 CTGACTCACCTTTCTTATGAAGG - Intronic
936404692 2:112192372-112192394 CTCTCTGTCCTTCCAAAGGAGGG - Intergenic
936971836 2:118183892-118183914 CTCACACCCCTTTCTTAGGAAGG - Intergenic
937501007 2:122479162-122479184 TCCTATCACCTTTCTCAGGAGGG + Intergenic
939718069 2:145610380-145610402 TTCTCTCAGCTTTATAAGGAGGG - Intergenic
945306573 2:208265077-208265099 CTCCCTCATCTCTCTGAGGAAGG - Intronic
946922868 2:224597487-224597509 CCCCCTCACCCTTCTTAGGAGGG - Intergenic
947605863 2:231484711-231484733 CTCTCCCACCTTTCACAAGAGGG - Intergenic
948981548 2:241497227-241497249 CTGTATCACATTTCTGAGGACGG + Intronic
1169361060 20:4949477-4949499 CTCTCTCACATACCTAAGGGCGG + Intronic
1170782862 20:19441123-19441145 CTGTCTCACCAAGCTAAGGATGG + Intronic
1174102145 20:48135926-48135948 TTCTTTTACCTTTCTAGGGATGG - Intergenic
1177899718 21:26899593-26899615 ATCTCTCATCTTTTTAAGGGTGG + Intergenic
1178304554 21:31480638-31480660 TTCTATCACCTTTGGAAGGAAGG + Intronic
1178402280 21:32297278-32297300 CTCTCTCCCCTTTCCAGGGTGGG - Intronic
1178901229 21:36600832-36600854 GTCTCCCACCTCCCTAAGGAGGG + Intergenic
1179100117 21:38349073-38349095 CTAGCTAACCTTTCTCAGGATGG + Intergenic
1179391308 21:40994575-40994597 CTGTCCCACCCTTCTCAGGAAGG - Intergenic
1179413141 21:41177560-41177582 CTCTGTCACCTTCCCAAGAAAGG + Intronic
1180025323 21:45157868-45157890 CTTTCTCACCTTTCTATTGCTGG - Intronic
1183483073 22:38075395-38075417 CTCCCTCTCCTTCCTAAGGCAGG - Exonic
1183817627 22:40316620-40316642 CTCTCTCTCCTTTTTGAGAAAGG - Intronic
1185065769 22:48631064-48631086 CGCCCTGTCCTTTCTAAGGACGG + Intronic
949512717 3:4780864-4780886 CTCTCTGACCTATCTCAGGTGGG + Intronic
950017368 3:9763546-9763568 CTCTCTCACCTTCCAAAAAATGG - Intronic
950750200 3:15122470-15122492 ATCTCTCAAATTTCCAAGGATGG - Intergenic
950987367 3:17389347-17389369 CTCTTTCATCTTTCTATGGGAGG - Intronic
954068992 3:48129199-48129221 CTGTCTCCTATTTCTAAGGAAGG - Intergenic
955056787 3:55462032-55462054 GTCACTCAACTGTCTAAGGAAGG + Intergenic
955219978 3:57015387-57015409 CACATACACCTTTCTAAGGAGGG - Intronic
957347069 3:78975410-78975432 CTCTCTCAATATTCTCAGGAAGG - Intronic
958983416 3:100752200-100752222 CTATCTCTTCTTACTAAGGAAGG + Intronic
959363582 3:105427238-105427260 CTCTCTCACCCTTTTAGGAAAGG + Intronic
959817906 3:110697593-110697615 TTCTTTCTCTTTTCTAAGGAAGG - Intergenic
960316984 3:116190359-116190381 CTCTATCACTTTTCTCAGCAGGG - Intronic
960938983 3:122921441-122921463 CTCTCTACCTCTTCTAAGGAAGG + Intronic
965758981 3:172054664-172054686 CTTTCTCTCCTGTCTCAGGAGGG + Intronic
965788154 3:172358453-172358475 CACTCTCACCTTGCTGCGGATGG + Intronic
968802065 4:2749630-2749652 CTCTCTCAAGGTTCTAGGGAAGG - Intronic
969273846 4:6121427-6121449 CCCTCTCACCTTCCGAAGAACGG + Intronic
970598397 4:17620730-17620752 CTCTCTCACCCTTTTAAGAAAGG + Intronic
971990787 4:33890812-33890834 CTCACACACCTTACTTAGGAGGG - Intergenic
973208854 4:47592032-47592054 CTCTTTCCCCTTTCCAATGAAGG - Exonic
973809350 4:54554765-54554787 TACTCTCACCTCTCCAAGGAGGG - Intergenic
974033406 4:56796183-56796205 CTCTCTCCCCTTTGCAAGGAAGG + Intergenic
976916360 4:90379992-90380014 CTCACTCACTTTCCTAAGGATGG + Intronic
979103479 4:116653587-116653609 CTCAATCACCTTTCCAAGAAGGG - Intergenic
980897739 4:138875907-138875929 CTCTCTCATCTTTCTGCGTATGG - Intergenic
981242906 4:142499981-142500003 TTCTCTTACATTTCTAAGGCTGG - Intronic
984552726 4:181180209-181180231 CTCTCTCACATCTCAAAGTATGG - Intergenic
985023771 4:185718788-185718810 CTCTCTCACTTTGCAAACGAGGG - Intronic
985523117 5:388450-388472 CTGTCACACCCTTGTAAGGAGGG + Intronic
986512684 5:8525022-8525044 TTCTCTCACCTTTCTGATTATGG + Intergenic
987959213 5:24783009-24783031 CTCTCTCATCTTTCTTTTGAAGG + Intergenic
988488799 5:31689908-31689930 CTCTTTCTCCTTCCTAAGGAAGG - Intronic
989685287 5:44078396-44078418 GTGTCTCACCATTCTAAGGCAGG - Intergenic
990626202 5:57614002-57614024 CTCACTCTTCTTTCTAAAGATGG + Intergenic
992985857 5:82228918-82228940 CTTTCTCAACTTGATAAGGAAGG - Intronic
993750967 5:91666949-91666971 CTTTCTCACAGTTCTAATGATGG - Intergenic
998619098 5:143774699-143774721 TTCACTCCCTTTTCTAAGGAGGG - Intergenic
998846904 5:146319297-146319319 CTCTGTAACTTTTCTAAGCAAGG + Intronic
999322849 5:150625592-150625614 CTCTCTCACCTTGGCAAGGAGGG - Intronic
1000955699 5:167540963-167540985 CCCTCTCACCTTCCTTAGAAAGG + Intronic
1001501254 5:172236951-172236973 CTACCTCACATTTGTAAGGAAGG - Intronic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1006382653 6:33709137-33709159 CTCTCTCACCTCCCCAAGGATGG + Intronic
1006456314 6:34133855-34133877 CTCTCTTCCCCTTCTAAGGTTGG - Exonic
1006907756 6:37544594-37544616 CTCTCTATCCTTCCTATGGATGG + Intergenic
1007932356 6:45703549-45703571 CTCTCTCACTTTCCTACTGAGGG - Intergenic
1009676469 6:66829729-66829751 CTCTCTCACTTTTCATAGGAAGG + Intergenic
1009718496 6:67431161-67431183 ATCCCTCGCCTTTCCAAGGAAGG - Intergenic
1009845274 6:69126550-69126572 CTCTCTCTCTCTTCTAAAGATGG - Intronic
1015390313 6:132674439-132674461 CTTTCACACCTTCCAAAGGATGG - Intergenic
1018925965 6:168207283-168207305 GTATCTGATCTTTCTAAGGAAGG + Intergenic
1020602721 7:10295972-10295994 CACTCTCTATTTTCTAAGGAAGG - Intergenic
1020951134 7:14679128-14679150 CTCTCTCTCCTGTAGAAGGATGG - Intronic
1021812249 7:24414477-24414499 CTTTTTCCCCTTTCAAAGGAGGG - Intergenic
1021910228 7:25378281-25378303 CAGACTCTCCTTTCTAAGGAAGG + Intergenic
1022595260 7:31707453-31707475 CTCTCTCTTCTTTCTGAGTATGG + Exonic
1024878975 7:54063494-54063516 TTCTCACAGCTTTCTAAGGAAGG - Intergenic
1030935047 7:115575356-115575378 CTCTCTCCCATTTGTAGGGAGGG - Intergenic
1031446339 7:121859527-121859549 CTCTCTCTCTTTTCTATGCAGGG + Intergenic
1033309081 7:140246751-140246773 CTCTCTCTCCCTTATAAGGATGG + Intergenic
1033475370 7:141687231-141687253 CTCTCTCTCCTCTCTAAGTGAGG + Intronic
1034388998 7:150768197-150768219 CTCTCTCACCTTGTAAAAGAGGG - Intergenic
1035722879 8:1805337-1805359 CTCACTCACCTGTACAAGGAAGG + Intergenic
1037042635 8:14256249-14256271 CTCTTACATCTTTCTTAGGATGG - Intronic
1037174724 8:15933143-15933165 CTCTGGCACCTTTTTAAGTATGG - Intergenic
1037568139 8:20135086-20135108 TTATCTCAGCTTTCTAAAGACGG + Intergenic
1038779264 8:30556706-30556728 CTTTCCCACCTGTCTCAGGAAGG + Intronic
1042230554 8:66550051-66550073 CTCTCTCTCTTTTTTAAAGATGG - Intergenic
1043168404 8:76933749-76933771 CACTCACACCTTTCAAAAGAAGG + Intergenic
1043890267 8:85645902-85645924 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043891882 8:85658092-85658114 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043894222 8:85724605-85724627 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043894578 8:85727690-85727712 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043894934 8:85730775-85730797 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043895290 8:85733860-85733882 TTCTCTCATCTTTCCAAGCAAGG + Intergenic
1043897386 8:85747948-85747970 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043897742 8:85751036-85751058 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043898098 8:85754121-85754143 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043899712 8:85766316-85766338 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043901319 8:85778509-85778531 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043901674 8:85781594-85781616 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043903284 8:85793784-85793806 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043904895 8:85805977-85805999 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1043906506 8:85818168-85818190 TTCTCTCATCTTTCCAAGCAAGG - Intergenic
1047641335 8:126824734-126824756 CTCTTTCACTTTCTTAAGGAGGG + Intergenic
1047989691 8:130273288-130273310 ATCTCTTTCCTTTCTGAGGAAGG + Intronic
1050860594 9:10424573-10424595 CTCTCCCACCTGTCTTACGAAGG + Intronic
1051369418 9:16345525-16345547 CTCCCTACCCTTCCTAAGGAGGG + Intergenic
1052297540 9:26914785-26914807 CTCTCACACTTTTCTAAATATGG + Intronic
1054914021 9:70479438-70479460 CTTCCTCACCTTTCCAGGGAGGG - Intergenic
1058116762 9:101093099-101093121 CTCTCACTACTTTCTAAGGAAGG + Intronic
1058350857 9:104022152-104022174 CTCTCTCAATTTTCTAAAAATGG - Intergenic
1059637627 9:116186402-116186424 CTCTCTCACCTGTCAAACAAAGG + Intronic
1060170148 9:121454454-121454476 CTCACTCACCCTTCTGAGGTAGG + Intergenic
1062131611 9:134897246-134897268 CTCTCTCACCTTTATTCTGAGGG - Intergenic
1186155889 X:6726049-6726071 ATCTCTCACCTTTCAGAGGATGG + Intergenic
1187758894 X:22558295-22558317 CTCTCCCATCTTTCCAAGGGAGG - Intergenic
1187888328 X:23909771-23909793 CCCTCTCACTTTACCAAGGAGGG + Intronic
1187960374 X:24562028-24562050 CACTCTAACCTTGCTAAGGAAGG - Exonic
1189698070 X:43686403-43686425 CTTTCTCACATTCCTAAGGGGGG - Intronic
1193726908 X:85051774-85051796 CTCTGGCACCTTGTTAAGGATGG + Intronic
1194792972 X:98173962-98173984 CTCTCTACTCTTTCTTAGGATGG + Intergenic
1195392807 X:104380651-104380673 CTCTATTACCTTTCTAGGAATGG + Intergenic
1196344030 X:114630941-114630963 CTCTCTCACTTTTTTTAGGCAGG - Intronic
1199297582 X:146176751-146176773 CTCTAACTCCTTTCTAAGGGTGG - Intergenic
1199523975 X:148770689-148770711 CTCTCACTCCTTTGTGAGGATGG + Intronic