ID: 1168491739

View in Genome Browser
Species Human (GRCh38)
Location 19:56816689-56816711
Sequence GGATTTTCTGGTGCTCAATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168491739 Original CRISPR GGATTTTCTGGTGCTCAATC AGG Exonic
903437555 1:23362736-23362758 GGATTGTCTGATGCTGAATCAGG + Exonic
904367427 1:30023498-30023520 TGATTTCCTGGTCCTCAAGCTGG + Intergenic
908290039 1:62656737-62656759 GGCTTTTCTGGTTCTAAGTCTGG - Intronic
909100704 1:71344217-71344239 GGCTTTTCTTGTGCTCCATATGG - Intergenic
910312640 1:85842350-85842372 GGAATTCCTGGTTCTCCATCAGG + Exonic
910841226 1:91563526-91563548 GGCATTTCTGGAGCTCACTCTGG - Intergenic
911435419 1:97850538-97850560 GGATTTTCTGGAGTAGAATCCGG + Intronic
915070718 1:153263495-153263517 AGATTTTCTAGTGCCCAATGTGG - Intergenic
920515783 1:206583896-206583918 GGATTTTCTGGTGCTCCATCTGG - Intronic
1072666053 10:97393236-97393258 TGATTTTCTGCTCCTCAATAAGG + Intronic
1073170327 10:101501337-101501359 GGATTATCTGAAGCTCAGTCTGG - Intronic
1076463184 10:130660306-130660328 GGGTTTTCTGGAGCTCAGCCTGG - Intergenic
1090789865 11:130082539-130082561 TGATTTTCTGCTTCTCAATAAGG + Intronic
1090882251 11:130843938-130843960 GAATTTTCAGTTGCTCATTCAGG - Intergenic
1099270684 12:80506026-80506048 ATATTTTCTGGTGCACTATCAGG - Exonic
1105061589 12:133156755-133156777 GAATTCTCTGGTGCTTAATGAGG - Exonic
1105293069 13:19065451-19065473 GGAGTCTCTGTTGCCCAATCTGG - Intergenic
1111529213 13:89515115-89515137 GGCTTTTCTGGTTCTCCAGCTGG - Intergenic
1116204528 14:41846562-41846584 GGAATTTCTGTTTCTTAATCTGG + Intronic
1120804563 14:88732684-88732706 GGATTTTCTGCTTCTGTATCTGG - Intronic
1121100994 14:91250228-91250250 GCATTTCCTGGTGCTGAACCGGG + Intronic
1121875290 14:97445792-97445814 GGGCTTCCTGGTGCTCAAGCAGG + Intergenic
1126890554 15:53199844-53199866 GGCTTTTGTGGTGAGCAATCTGG + Intergenic
1127300975 15:57653385-57653407 GAATTTTCTAGAGCTCACTCAGG + Intronic
1127371144 15:58342820-58342842 GGATTTGAAGGTGCTCAATTTGG - Intronic
1127739103 15:61880932-61880954 GTATTTTATGGTCCTCATTCAGG - Exonic
1136372648 16:29845899-29845921 GGATCTTCTGCCGCTCAAGCCGG - Exonic
1138887668 16:61099185-61099207 TTATTTTATGGTGGTCAATCAGG - Intergenic
1141647524 16:85375580-85375602 GGGTTTGCTGGTGTTCAAGCAGG + Intergenic
1141679437 16:85535717-85535739 GGATTTTGTGTTGCTCTCTCAGG - Intergenic
1142296647 16:89227761-89227783 GGATTCTCGCGTGCTCAGTCAGG - Exonic
1143334146 17:6159752-6159774 GGATTATCTGGGGCTCAGCCTGG - Intergenic
1153659650 18:7315656-7315678 GGAGTTTCTGATGCTCAGTCAGG - Intergenic
1156246726 18:35307416-35307438 GGATTCTCTGGTGTTTAATGAGG - Intergenic
1157424491 18:47573066-47573088 GGTTTTTCTGTTGCTTAAACTGG - Intergenic
1159644496 18:70901346-70901368 TGTTTTTCTCTTGCTCAATCTGG - Intergenic
1163055979 19:14718383-14718405 GGATTTTCTCGGGCACAATTAGG - Exonic
1163056005 19:14718635-14718657 GGTTTCTCTGGTGCAAAATCAGG - Exonic
1164167953 19:22699631-22699653 CGATTTTCTGCTCCTCAATAAGG - Intergenic
1165262764 19:34635114-34635136 GAATTCTCTGGTGTTCAATAAGG + Intronic
1165506746 19:36236866-36236888 GGATTTTCTCATGCTCAGTAAGG - Exonic
1166025031 19:40075127-40075149 GAATTTTCTGATGCTGAATAAGG + Exonic
1166025072 19:40075547-40075569 GAATTTTCTGATGCTGAATAAGG + Exonic
1166702688 19:44891342-44891364 GGATTTGCTGGGGCTGAGTCGGG + Exonic
1167536849 19:50059147-50059169 GGATCTTCTGGTGCTCAATGAGG + Intergenic
1167536927 19:50059651-50059673 GGACTCGCTGGTGCTCAGTCAGG + Intergenic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168474226 19:56664469-56664491 GGATGCGCTGGTGCTCTATCAGG + Exonic
1168491608 19:56815471-56815493 GAATCTTCTGGTGCTCAGTGAGG + Exonic
1168491715 19:56816497-56816519 GGATTTTCTGATGTTCTTTCAGG + Exonic
1168491739 19:56816689-56816711 GGATTTTCTGGTGCTCAATCAGG + Exonic
1168563093 19:57399760-57399782 GGATTTTCTGGTGATGAACCAGG - Exonic
1168568489 19:57443946-57443968 GAATTTTCTGGTGCTGAACTAGG - Exonic
1168568545 19:57444504-57444526 GGATTTTCTGGTGCTGAACTAGG - Exonic
1168583205 19:57572358-57572380 GAATTTTCTGGTGTTCAACGAGG + Exonic
1168585801 19:57590738-57590760 GTATTTTCTGGTGGTCAACAAGG - Exonic
1168591679 19:57641299-57641321 GGACTTTCTGGTGCTGAATGAGG - Exonic
1168645007 19:58054006-58054028 GGAGCTTCTGGTGGTCAATGAGG - Exonic
1168653374 19:58108527-58108549 GGATTTTTTGATGTACAATCAGG + Intronic
1168656035 19:58128747-58128769 GGATTCTTTGATGCACAATCAGG + Exonic
1168667205 19:58213080-58213102 GGGTTCTCTGGTGCCCAATAAGG - Exonic
1168684391 19:58339200-58339222 GGATCCTCTGGTGCTCAATGAGG - Exonic
928293088 2:30057165-30057187 GGGATCTCTGGGGCTCAATCTGG - Intergenic
929752351 2:44728897-44728919 GGATTTTCTATTTCTTAATCTGG + Intronic
931183409 2:59926481-59926503 GGATTCCCTGGTTCTCAGTCAGG - Intergenic
934537617 2:95148745-95148767 GAATTTTCTGATGCTTAATAAGG + Exonic
935353446 2:102176507-102176529 GGATTTTCTCCAGCTCAAGCAGG - Exonic
936298784 2:111288640-111288662 AGATTCTCTAGTCCTCAATCTGG - Intergenic
936823295 2:116550863-116550885 GGATTTTCTGTAGGTTAATCTGG + Intergenic
938095684 2:128460817-128460839 GGTTTCTATGTTGCTCAATCAGG - Intergenic
938868582 2:135450783-135450805 GGATATTCTGAGGCTCCATCTGG - Intronic
944556769 2:200894878-200894900 GAAATTTCTGATGCACAATCGGG + Intronic
1170748902 20:19126531-19126553 GTCTTTTCTAGTTCTCAATCAGG + Intergenic
1170997598 20:21378310-21378332 TGATTTTGTGCTGCTTAATCAGG - Intronic
1173890236 20:46502396-46502418 GAATTTTCTGGTGTACAATAAGG + Exonic
1175236055 20:57512645-57512667 GAGTTTTCTGGTGCTGAATGAGG + Exonic
1178706724 21:34881158-34881180 GGATGTTCTGTTTCTCAAACGGG - Intronic
1179729548 21:43360117-43360139 GGATTTTCTGGTTCCTAACCTGG + Intergenic
1181566834 22:23743904-23743926 GGGTTTTATAGTGCTCAATGAGG + Exonic
1181566860 22:23744069-23744091 GGATGCGCTGGTGCTCAATGAGG + Exonic
1182757193 22:32689719-32689741 GGATTGTCTGGTCCTCATTATGG + Intronic
1183429674 22:37757964-37757986 GGTTTTGCTGGTCCTCAGTCAGG - Exonic
949632939 3:5948943-5948965 GGACTTTCTGTTCCTCAAGCCGG - Intergenic
953457525 3:43054748-43054770 GAATTTTCTGGTGCTGATTTTGG + Intronic
953633632 3:44642702-44642724 GGATTCTCTGGTGCAGAATGAGG - Exonic
953633705 3:44643458-44643480 GGATTCTCTTATGCTCAATGAGG - Exonic
953635410 3:44659575-44659597 GAATTCTCTGGTGCACAATAAGG - Exonic
957551648 3:81712971-81712993 GTATTTTATGTTCCTCAATCAGG + Intronic
959682818 3:109115765-109115787 GGATGTCCTGGAGCTCAAGCTGG + Intronic
960588943 3:119346883-119346905 TAATTTCCTGGTGCTGAATCAGG + Intronic
963726439 3:148927118-148927140 GGAGTTCCTGGTTCTCAGTCTGG + Intergenic
966297918 3:178445225-178445247 GGACTTTTTGGTGCTGAAACCGG - Intronic
971870434 4:32229497-32229519 GGTTTTTCTGTTCCTCAATGAGG - Intergenic
976561507 4:86506800-86506822 GGAATTTCTGCTCCTCAGTCTGG - Intronic
978315781 4:107435108-107435130 TGCTTTTCTGGTGCTCATTTTGG + Intergenic
979519200 4:121646643-121646665 GAATTTTCTGCTACTCAAGCAGG - Intergenic
980101648 4:128547381-128547403 GGCTTTTCTGGTGGAGAATCTGG + Intergenic
981372669 4:143977231-143977253 GGAATTTCTAGTGCAGAATCTGG - Intergenic
986539197 5:8826554-8826576 GGATGTTCTAGTTCTCATTCTGG + Intergenic
992609335 5:78493896-78493918 GGTTTTTCTGATACTCAATTTGG + Intronic
995528614 5:113071212-113071234 GGGATTTGAGGTGCTCAATCCGG + Exonic
997511496 5:134457893-134457915 GCATTTTGAGGTGCTCACTCTGG + Intergenic
1001091864 5:168747694-168747716 GGAGTTTCTGGTGCAGAAACAGG + Intronic
1001450472 5:171820689-171820711 GGACCTGCTGTTGCTCAATCTGG - Intergenic
1002406050 5:179032602-179032624 GGATTCTCTGGTGTTTACTCAGG - Exonic
1004061238 6:12200125-12200147 GTATTTGCTAGTCCTCAATCTGG - Intergenic
1004201667 6:13554468-13554490 GAATTTTTATGTGCTCAATCTGG - Intergenic
1005675789 6:28153456-28153478 GGATTCTCTGGTGCAGAATCAGG - Exonic
1005675801 6:28153540-28153562 GGATTCTCTGGTGCAGAATAAGG - Exonic
1005675836 6:28153792-28153814 GGATTCTCTGATGTTCAATAAGG - Exonic
1005679268 6:28189408-28189430 GGATTCTCTGGGGATTAATCAGG - Intergenic
1005697659 6:28366150-28366172 GGATTTTTTGATGTTCAATGAGG - Exonic
1005699955 6:28390651-28390673 GGATTCTCTGATGCTGAATGAGG + Exonic
1005702815 6:28419721-28419743 GGATTCTCTGGTGTTGAATAAGG + Intergenic
1006654829 6:35582051-35582073 GGATTTTCTGGTGATGAAGATGG + Intronic
1007407583 6:41643886-41643908 GGATCTTCTGCTTCTCACTCAGG + Intronic
1007439713 6:41848070-41848092 GGAGTTTCTGCTGGTAAATCTGG - Intronic
1008139175 6:47812108-47812130 GCAGTTTCTGGGGCTCATTCAGG + Intronic
1008545384 6:52578712-52578734 GGATTCTCTGTTGCCCAAGCTGG + Intergenic
1009262619 6:61513709-61513731 GGATATTTTGGTGCTCATTGAGG + Intergenic
1010197129 6:73251172-73251194 GGATTTTTTGGTATTCAATAAGG - Intronic
1013179455 6:107706054-107706076 GAAATTTCAGGTGCTCAAGCAGG + Intronic
1013705629 6:112830561-112830583 TTTATTTCTGGTGCTCAATCTGG - Intergenic
1014246331 6:119073754-119073776 AGATTTTCTGGGGATTAATCAGG - Intronic
1016418537 6:143859096-143859118 GAATTTTGATGTGCTCAATCAGG - Intronic
1016866871 6:148776254-148776276 GCACTTTCTGGTTCTCATTCAGG + Intronic
1016939853 6:149474740-149474762 GGACTTTCAGTTGCTCAATGTGG + Intronic
1019294205 7:265418-265440 CGACTTTCTGGAGCTCAATACGG + Intergenic
1020530301 7:9324844-9324866 GGATTTTCTGGAGCTTAGTTTGG - Intergenic
1022411520 7:30141987-30142009 GGACTTCCTGGTGCTTAAGCAGG - Intronic
1023669576 7:42561549-42561571 GAATTTTCTTGTGCAGAATCTGG + Intergenic
1024031162 7:45460937-45460959 GCATGTTCTGATGCTCATTCTGG - Intergenic
1024377869 7:48659521-48659543 GGATTTTCTGGTCCTTACACTGG + Intergenic
1024855032 7:53769043-53769065 GTATATTCTGCTGCTAAATCTGG - Intergenic
1025595840 7:62924619-62924641 GGATTTTTTGGAGCTCATTGAGG + Intergenic
1028936839 7:96474358-96474380 GGCTTTTCTGGTGCTCTGTTTGG + Intergenic
1029307268 7:99629552-99629574 GGGTTCTCTGGTGCTTCATCAGG - Exonic
1029358629 7:100071736-100071758 GGATTCTCTGATGCTGAATAAGG + Exonic
1039791310 8:40878004-40878026 GGATTTTAGGGAGCTCATTCTGG + Intronic
1040346720 8:46508815-46508837 GGATGTTATGGAGCTCAATAAGG - Intergenic
1041260323 8:56015994-56016016 GGTTTTTCTGGGCCACAATCTGG - Intergenic
1041735813 8:61109352-61109374 GGATTTTTAGGTGCTAAATTTGG - Intronic
1041788733 8:61666698-61666720 GAATTTCCTGGTGATCAACCAGG + Intronic
1044097969 8:88092555-88092577 GGATTTTGTGGTGCTCATTGTGG + Intronic
1046104395 8:109648701-109648723 GGGTTTTCTTGGGCTCAATCAGG + Intronic
1048454121 8:134562573-134562595 GGATTTACTGTTTCTCACTCAGG + Intronic
1049630298 8:143650787-143650809 GAATTCTCTGGTGTTCAATAAGG - Exonic
1049630323 8:143651039-143651061 GGATTTTCTGGTGTCGAATAAGG - Exonic
1049841195 8:144773544-144773566 GGATTCTCTGGTGCTGGATGAGG + Exonic
1049841228 8:144773880-144773902 GGATTCTCTGGTGATAAATCAGG + Exonic
1049858646 8:144881865-144881887 GGACTCTCTGGTGCTGGATCAGG + Exonic
1049865207 8:144930920-144930942 GGATTATCTGATGCTGAATGAGG + Exonic
1052690026 9:31805755-31805777 CAATTTTCTGGTGAGCAATCTGG - Intergenic
1055480480 9:76704554-76704576 CGATTTTCTCGTGCACTATCAGG + Intronic
1056954842 9:91073565-91073587 GGCTGTTCTGGTGCTCACCCAGG + Intergenic
1058135088 9:101298502-101298524 GGATTTTCTAGTTCTCAAAAAGG - Intronic
1059279670 9:113121636-113121658 AGAGTTTCTGGTGCTCATGCAGG + Intergenic
1186546886 X:10459207-10459229 GGAGTCTGTGGTTCTCAATCAGG - Intronic
1188741957 X:33795163-33795185 GGATTTTCTGGAGCTCATTATGG - Intergenic
1189727042 X:43977661-43977683 GACATTTATGGTGCTCAATCTGG + Intergenic
1190941383 X:55044746-55044768 GAATTTTCTGGTGATTAATAAGG + Intergenic
1191267626 X:58416272-58416294 GGAATTTTTGGAGCTCAATGAGG - Intergenic
1191937662 X:66442465-66442487 GGATTTTGTAGTGCTAAATTCGG - Intergenic
1192370290 X:70507357-70507379 GGAGTCTCTGTTGCTCAGTCTGG + Intergenic
1193106479 X:77680114-77680136 TGATTATCTGGTGCTGCATCAGG + Intronic
1200337293 X:155363678-155363700 GGCTTCTCAGGTGCTCAACCAGG - Intergenic
1200349177 X:155477549-155477571 GGCTTCTCAGGTGCTCAACCAGG + Intergenic