ID: 1168492165

View in Genome Browser
Species Human (GRCh38)
Location 19:56820375-56820397
Sequence AATTATGCAGACATGGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 662}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168492160_1168492165 17 Left 1168492160 19:56820335-56820357 CCATACTGAGTCAGTAGGAATCA 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1168492165 19:56820375-56820397 AATTATGCAGACATGGGGCTCGG 0: 1
1: 0
2: 1
3: 44
4: 662
1168492159_1168492165 20 Left 1168492159 19:56820332-56820354 CCACCATACTGAGTCAGTAGGAA 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1168492165 19:56820375-56820397 AATTATGCAGACATGGGGCTCGG 0: 1
1: 0
2: 1
3: 44
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168492165 Original CRISPR AATTATGCAGACATGGGGCT CGG Intronic
900728961 1:4239159-4239181 AATTATCCAGGCATGGTGTTGGG - Intergenic
900873688 1:5325917-5325939 AATTATGTAGATAAGGGGCTGGG - Intergenic
901079459 1:6575665-6575687 AATTATCCAGGCATGGTGGTGGG - Intronic
901097623 1:6694824-6694846 AATTATCCAGGCATGGTGGTGGG + Intronic
901183071 1:7355055-7355077 AATTATCCAGGCATGGTGGTGGG + Intronic
901707786 1:11089312-11089334 ATTTAAGAAAACATGGGGCTGGG + Intronic
901844316 1:11972398-11972420 AATTAGCCAGACATGGTGGTGGG - Intronic
901867882 1:12119242-12119264 ACTTTTGCAGACATGAGGCCTGG - Intronic
902791544 1:18771808-18771830 AATTATCCAGGCATGGTGGTGGG - Intergenic
902908056 1:19573763-19573785 AATTAGCCAGACATGGTGGTTGG + Intergenic
903078709 1:20791629-20791651 AATTAGGCAGGCATGGTGGTGGG - Intergenic
904022915 1:27481548-27481570 AATTAGCCAGGCATGGGGGTGGG + Intronic
904287637 1:29462341-29462363 ACGTATGCAGGCAGGGGGCTTGG - Intergenic
904557582 1:31375144-31375166 AATGATGGAGAGCTGGGGCTGGG + Intronic
905069733 1:35214815-35214837 AATTATCCAGGCATGGTGGTGGG + Intergenic
905228862 1:36499330-36499352 AATTAGCCAGACATGGTGGTGGG - Intergenic
905406034 1:37733039-37733061 AATTAGCCAGACATGGTGGTGGG - Intronic
905563840 1:38947778-38947800 AATTTGGCAGGCAGGGGGCTAGG - Intergenic
907202505 1:52739752-52739774 AATTAGCCAGGCATGGGGGTGGG - Intronic
907466945 1:54644489-54644511 AATTATCCAGGCATGGTGGTGGG - Intronic
908280160 1:62525152-62525174 AATTAGCCAGACATGGTGGTGGG - Intronic
908465381 1:64388478-64388500 AATTATGCCAACATGGGTCAAGG - Intergenic
908472833 1:64460599-64460621 AATTAGCCAGGCATGGTGCTGGG + Intergenic
908531662 1:65040064-65040086 AATTAGCCAGACATGGTGGTGGG + Intergenic
908537901 1:65095588-65095610 AATTAGGCAGGCATGGTGGTGGG - Intergenic
908641456 1:66228473-66228495 AATTAGCCAGACATGGTGGTGGG + Intronic
910001540 1:82348380-82348402 AATTATCCAGGCATGGTGCCGGG + Intergenic
910441909 1:87261642-87261664 AATTATGGAGCCAAGGGGCTGGG - Intergenic
910532381 1:88252509-88252531 CATTATTCAGAGATGAGGCTGGG + Intergenic
911158472 1:94658980-94659002 AATTAGCCAGACATGGTGGTGGG + Intergenic
911580296 1:99626090-99626112 AATTATCCAGGCATGGCGGTGGG + Intergenic
911732035 1:101301409-101301431 AATTATGGAATCATGGGGATTGG + Intergenic
912335921 1:108862653-108862675 AATTAGCCAGGCATGGGGCATGG + Intronic
912896581 1:113598061-113598083 AATTAGCCAGACATGGTGGTGGG + Intronic
913286116 1:117228423-117228445 AATTAGGCAGGCATGGTGGTGGG - Intergenic
913656252 1:120963017-120963039 AATTAGCCAGGCATGGGGCTAGG - Intergenic
914520807 1:148414246-148414268 AATTAGCCAGGCATAGGGCTAGG - Intergenic
915160535 1:153916954-153916976 AATTAGCCAGACATGGTGGTGGG - Intronic
915181030 1:154060088-154060110 AATTAGCCAGACATGGTGGTGGG + Intronic
915337851 1:155157711-155157733 AATTAGCCAGACATGGTGGTGGG - Intergenic
915584989 1:156839671-156839693 AAGTGGGCAGACATGGGGCAAGG - Intronic
916235567 1:162584629-162584651 AATTAGCCAGGCATGGTGCTGGG - Intronic
916963588 1:169912880-169912902 AATTAGCCAGGCATGGTGCTGGG - Intergenic
917157179 1:172016036-172016058 AATTAGCCAGGCATGGTGCTGGG + Intronic
917343319 1:174003236-174003258 AATTAGCCAGACATGGTGGTGGG + Intronic
917382535 1:174429588-174429610 AATTAGCCAGACATGGTGGTGGG + Intronic
918116540 1:181502845-181502867 AATTAGCCAGACATGGTGGTGGG - Intronic
918251564 1:182707853-182707875 AATTAGCCAGACATGGTGGTGGG - Intergenic
918386673 1:184015006-184015028 ATTAACACAGACATGGGGCTGGG + Intronic
918875490 1:190036523-190036545 AATTATCCAGGCATGGTGGTGGG + Intergenic
919257976 1:195150687-195150709 AATTAGTCAGACATGGTGGTGGG - Intergenic
919624972 1:199902475-199902497 AATTAACCAGACATGGTGGTGGG + Intergenic
921050884 1:211510693-211510715 AATTAGCCAGACATGGTGGTGGG - Intergenic
921651689 1:217686865-217686887 AATTATCCAGACATGGTGGCAGG - Intronic
922053301 1:222015936-222015958 AATTGTGCCAACATGGTGCTAGG + Intergenic
922602172 1:226864811-226864833 AATTAGGCAGGCATGGTGGTGGG - Intergenic
922850573 1:228730289-228730311 AGTTATGCAGATATGGCCCTTGG + Intergenic
923140519 1:231158584-231158606 AATTATCCAGACATGGTGGCAGG - Intergenic
923665819 1:235997753-235997775 AATTAGCCAGACATGGTGGTGGG - Intronic
924010591 1:239660939-239660961 AATAATGCACACATAGAGCTTGG - Intronic
924134907 1:240955401-240955423 AATTAGCCAGACATGGTGGTGGG + Intronic
924240191 1:242032888-242032910 AATTAGCCAGACATGGTGTTGGG + Intergenic
924335473 1:242982972-242982994 AATTATCCAGACATGGTGGTGGG - Intergenic
924597446 1:245459760-245459782 AATAGTGCAGACCTGGAGCTAGG + Intronic
924616254 1:245614321-245614343 AATTAGCCAGACATGGTGGTGGG - Intronic
1064210302 10:13355758-13355780 AATTATCCAGGCATGGGGGCGGG - Intergenic
1064520828 10:16198963-16198985 AATTAGCCAGGCATGGTGCTGGG + Intergenic
1064697753 10:17985192-17985214 AATTAGCCAGACATGGTGGTGGG + Intronic
1064774220 10:18757478-18757500 AATTAGCCAGGCATGGTGCTGGG - Intergenic
1065006134 10:21382128-21382150 AATTAGCCAGACGTGGGGCCGGG - Intergenic
1065185087 10:23163595-23163617 AGTGATGCTGAAATGGGGCTGGG - Intergenic
1065328151 10:24568643-24568665 AATTAGCCAGACATGGCGGTGGG + Intergenic
1066379994 10:34893043-34893065 AATTAGCCAGACATGGTGGTAGG - Intergenic
1066576066 10:36826144-36826166 AGTTATCCAGACATGGTGGTGGG + Intergenic
1066592829 10:37014186-37014208 AATTAGCCAGGCATGGTGCTGGG + Intergenic
1067544149 10:47179842-47179864 AATTTTGTAGAGATGGGGGTGGG - Intergenic
1068527652 10:58148590-58148612 AACTATGCAGAGATGAGGCCGGG + Intergenic
1068725807 10:60301559-60301581 AATTAGCCAGACATGGTGGTGGG - Intronic
1069886731 10:71628316-71628338 AATAGTGCAGGGATGGGGCTGGG + Intronic
1070601842 10:77871689-77871711 AATTAGGCAGGCATGGTGGTGGG - Intronic
1071225333 10:83522166-83522188 AATTAGCCAGACATGGGGTGGGG - Intergenic
1072574605 10:96688501-96688523 AAATATGCACACATTAGGCTGGG + Intronic
1072635910 10:97177825-97177847 AATTAGCCAGACATGGTGGTAGG + Intronic
1073951541 10:108814804-108814826 AATTAGCCAGACATGGTGGTGGG + Intergenic
1074096235 10:110315287-110315309 AAGAATGCTGACATGGGGCCGGG - Intergenic
1074523762 10:114247444-114247466 AATTAGCCAGACATGGTGGTGGG - Intronic
1074805515 10:117047211-117047233 AATTAGCCAGGCATGGTGCTGGG - Intronic
1074939213 10:118218410-118218432 AATTAGCCAGACATGGTGCTGGG - Intergenic
1075681596 10:124337321-124337343 AATTAGCCAGACATGGTGGTGGG + Intergenic
1076176116 10:128369186-128369208 AGTTTTGGAGACATGGGGCAAGG + Intergenic
1077590443 11:3486899-3486921 AATTAGCCGGACATGGTGCTGGG - Intergenic
1077760813 11:5095273-5095295 AATTATCCGGGCATGGTGCTGGG - Intergenic
1078408405 11:11091491-11091513 AATTTGGCAGACAGGGGGCTAGG - Intergenic
1080429895 11:32188707-32188729 AATTCTGCAGACATTGAGCAGGG - Intergenic
1080830120 11:35885229-35885251 AATTATCCAGGCATGGTGGTGGG + Intergenic
1081518929 11:43862735-43862757 AATTAGGCAGGCATGGTGGTGGG - Intergenic
1082177056 11:49072879-49072901 AATTATCCAGACATGGTGGTGGG + Intergenic
1082201902 11:49382077-49382099 AATTAGCCAGACATGGTGGTGGG + Intergenic
1082850112 11:57756824-57756846 AATTAGCCAGACATGGTGGTGGG + Intronic
1083075778 11:60035715-60035737 AATTAGCCAGACATGGTGGTGGG + Intergenic
1083383290 11:62286574-62286596 AATTATGCACTCAGGGAGCTTGG - Intergenic
1083481482 11:62950491-62950513 AATTAGCCAGACATGGTGGTGGG + Intronic
1084246164 11:67858680-67858702 AATTAGCCGGACATGGTGCTGGG - Intergenic
1084530490 11:69724728-69724750 AATTAGCCAGACATGGTGGTGGG - Intergenic
1084821407 11:71693629-71693651 CATTAGGCAGAAATGTGGCTGGG + Intergenic
1085098568 11:73780835-73780857 AATTAGGCAGGCATGGTGGTGGG + Intergenic
1085101790 11:73807016-73807038 AATTAGCCAGACATGGTGGTGGG - Intronic
1085288893 11:75383217-75383239 AATTAGCCAGGCATGGGCCTGGG - Intergenic
1085665818 11:78415339-78415361 AAATATACAGCCATGGGGCTGGG + Intronic
1086653764 11:89324079-89324101 AATTAGCCAGACATGGTGGTGGG - Intergenic
1086688652 11:89762980-89763002 AATTATCCAGACATGGTGATGGG - Intergenic
1086717206 11:90076981-90077003 AATTATCCAGACATGGTGATGGG + Intergenic
1087750939 11:102006254-102006276 AATTAGCCAGACATGGTGATGGG - Intergenic
1088454645 11:110020987-110021009 AATTAGCCAGACATGGTGGTGGG - Intergenic
1088459421 11:110066978-110067000 AATTAGCCAGACATGGTGGTAGG + Intergenic
1089132005 11:116219623-116219645 AATTACGCAGACATAGGACGTGG + Intergenic
1089497486 11:118914985-118915007 AATTATCCAGACATGGTGGTGGG + Intronic
1089971348 11:122696096-122696118 AATTATCCAGGCATGGTGGTGGG - Intronic
1090917188 11:131175915-131175937 AAACATGCAGACATGGGCATTGG - Intergenic
1091682226 12:2535238-2535260 AATTAGCCAGGCATGGTGCTGGG + Intronic
1092416728 12:8295805-8295827 AATTAGCCGGACATGGTGCTGGG - Intergenic
1092421700 12:8337202-8337224 CATTAGGCAGAAATGTGGCTGGG - Intergenic
1092458569 12:8666738-8666760 AATTATCCAGGCATGGTGGTGGG - Intergenic
1092604616 12:10104606-10104628 AATTAGCCAGACATGGTGGTGGG + Intronic
1093210339 12:16300666-16300688 AATTAGCCAGACATGGTGGTGGG - Intergenic
1093729454 12:22550681-22550703 AATTAGCCAGGCATGGGGGTAGG + Intergenic
1093810728 12:23489667-23489689 AATTAGTCAGACATGGTGGTGGG + Intergenic
1094234543 12:28148574-28148596 AATTTGGCAGGCAGGGGGCTAGG + Intronic
1094482902 12:30899108-30899130 AATTTGGCAGGCATGGGGCTAGG - Intergenic
1094823195 12:34243554-34243576 AATTAGCCAGACATGGTGGTGGG + Intergenic
1095159842 12:38904258-38904280 AATTATGCAAACAAGGGAGTGGG + Intronic
1096015906 12:48274579-48274601 AATTAGCCAGACATGGTGGTGGG + Intergenic
1096360759 12:50983978-50984000 AATTATCCAGGCATGGTGGTGGG + Intronic
1096438420 12:51616461-51616483 AATTAGCCAGACATGGTGGTGGG + Intronic
1097665649 12:62474571-62474593 AATTAGCCAGACATGGTGATGGG - Intronic
1097947560 12:65388720-65388742 AATTAGCCAGACATGGTGGTGGG + Intronic
1097988092 12:65805529-65805551 AATTAGCCAGACATGGTGGTGGG + Intergenic
1099514597 12:83582124-83582146 AATTGTCCAGAAATGGGGCCAGG + Intergenic
1099814049 12:87622106-87622128 AATTATGCAGCCCTTGAGCTGGG + Intergenic
1100350746 12:93779736-93779758 AATTAGCCAGACATGGTGGTGGG - Intronic
1100710395 12:97250123-97250145 AATTATGCTCACAAAGGGCTTGG + Intergenic
1101098238 12:101366081-101366103 AATTAGCCAGGCATGGTGCTGGG + Intronic
1102083914 12:110120603-110120625 AATTAGCCAGACATGGTGGTGGG - Intergenic
1102267454 12:111499553-111499575 AATTAGGCAGACATGGTGGCAGG + Intronic
1102369130 12:112366730-112366752 AATTAGCCAGACATGGTGATGGG + Intronic
1102448031 12:113018630-113018652 AATTATCCAGGCATGGTGGTGGG + Intergenic
1102448059 12:113018778-113018800 AATTATCCAGGCATGGTGGTGGG + Intergenic
1103711150 12:122913671-122913693 AATTATCCAGACATAGTGGTGGG + Intergenic
1103804516 12:123561961-123561983 AATTAGCCAGACATGGTGGTGGG + Intergenic
1104370762 12:128222073-128222095 AATTATCCAGGCATGGTGGTGGG - Intergenic
1104372731 12:128237704-128237726 AATAATGCAGATTTGGGGCTGGG - Intergenic
1104944727 12:132410493-132410515 AATCCTGCAGACCTGGAGCTGGG + Intergenic
1105045021 12:132995798-132995820 AATTATCCAGGCATGGTGGTGGG - Intronic
1105298487 13:19112080-19112102 AATTAGCCAGACATGGTGGTGGG + Intergenic
1105300080 13:19125384-19125406 AATTAGCCAGACATGGTGGTGGG - Intergenic
1105464548 13:20626207-20626229 AATTATCCAGGCATGGTGGTGGG - Intronic
1105654079 13:22415517-22415539 AATGCTGCAGAGATAGGGCTTGG + Intergenic
1105694946 13:22878891-22878913 AATTAGGCAGACATGGTGGCAGG + Intergenic
1105842616 13:24267955-24267977 GATTCTGCAGACCTGGGGCAGGG + Intronic
1105887106 13:24651524-24651546 AAGCATGCGGACAGGGGGCTTGG + Intergenic
1106708584 13:32307949-32307971 AATTAGGCAGACATGGTGGCAGG - Intronic
1106730646 13:32538375-32538397 AAGTCTGGAGGCATGGGGCTCGG - Intronic
1106732124 13:32552283-32552305 AATTAGCCAGACATGGTGGTGGG - Intergenic
1106755514 13:32819412-32819434 AATTAGCCAGACATGGTGGTTGG - Intergenic
1106807147 13:33321355-33321377 AATTAGCCAGACATGGTGGTAGG + Intronic
1107193902 13:37623902-37623924 AATTATCCAGGCATGGTGGTGGG + Intergenic
1107859556 13:44647895-44647917 AATTAGCCAGACATGGTGGTGGG - Intergenic
1107888784 13:44896120-44896142 TATTATGCAGATATGGTGGTGGG - Intergenic
1108619995 13:52172932-52172954 AATTAATCAGACATGGTGGTGGG + Intergenic
1108729170 13:53215328-53215350 AATTATATATACATGGAGCTAGG - Intergenic
1108965266 13:56290523-56290545 AATTAGCCAGGCATGGTGCTTGG + Intergenic
1109042897 13:57363589-57363611 ATATATGGAGATATGGGGCTAGG - Intergenic
1109095377 13:58107599-58107621 AATTACCCAGACATGTGCCTAGG + Intergenic
1110833716 13:80060888-80060910 AATGATTTAAACATGGGGCTAGG - Intergenic
1110994748 13:82093270-82093292 AATTATCCAGGCATGGTGGTGGG + Intergenic
1111239773 13:85458411-85458433 AATTATGAAGACATGAGATTTGG + Intergenic
1112093286 13:96105500-96105522 AATTATCCAGGCATGGTGGTGGG + Intronic
1112096043 13:96133274-96133296 AATTATCCAGGCATGGTGGTGGG - Intronic
1112287069 13:98113590-98113612 AATTATCCAGGCATGGTGGTGGG - Intergenic
1113545738 13:111148029-111148051 AATTCTGCAGAGATAGGGCAGGG - Intronic
1113712618 13:112478471-112478493 AATTAGACAGACATGGTGATGGG + Intergenic
1113855123 13:113439594-113439616 AATTAGCCAGACATGGTGGTGGG - Intronic
1113929655 13:113960106-113960128 AATTAGCCAGACATGGTGGTGGG + Intergenic
1114236615 14:20829309-20829331 AATTAGCCAGACATGGTGGTGGG + Intergenic
1115201295 14:30856864-30856886 AATTAGCCAGACATGGTGGTGGG - Intergenic
1115307024 14:31944189-31944211 AATTACCCAGACTTGGGTCTGGG - Intergenic
1115656415 14:35447717-35447739 AATTAGCCAGACATGGTGGTGGG + Intergenic
1115938514 14:38582702-38582724 AATTATCCAGGCATGGTGGTGGG + Intergenic
1116417571 14:44697401-44697423 AATTAGGCAGGCATGGTGGTGGG - Intergenic
1118388111 14:65273550-65273572 AATTAGCCAGACATGGTGGTGGG + Intergenic
1118845576 14:69545518-69545540 AATTAGCCAGACATGGCGGTGGG - Intergenic
1119249482 14:73139132-73139154 AATTAGCCAGACATGGTGCCAGG + Intronic
1119363216 14:74069250-74069272 AATTAGGCAGGCATGGTGGTGGG - Intronic
1120474040 14:84964303-84964325 AATTTTGCAGACATACTGCTTGG - Intergenic
1120519678 14:85511960-85511982 AATCAGGAAGACATGAGGCTGGG + Intergenic
1120783225 14:88505539-88505561 AATTAGGCAGATATGAGTCTTGG + Intronic
1121317458 14:92970779-92970801 AATTAGCCAGACATGGTGGTGGG - Intronic
1121532660 14:94668257-94668279 AATTATCCAGGCATGGTGGTGGG + Intergenic
1121540141 14:94719493-94719515 TACTATGCAGATATGGGACTTGG + Intergenic
1121704538 14:95981754-95981776 AATTAGCCAGACATGGTGATGGG + Intergenic
1122094783 14:99362968-99362990 CCTTATGCACACTTGGGGCTGGG - Intergenic
1122576309 14:102744982-102745004 AATTAGCCAGACATGGTGGTGGG - Intergenic
1122848155 14:104512087-104512109 GAGTATGCAGACATGTGGCTCGG + Intronic
1122869465 14:104629753-104629775 AATTATCCAGGCATGGTGGTGGG + Intergenic
1123712708 15:23001189-23001211 AATTAGCCAGACATGGTGGTGGG - Intronic
1124186829 15:27537986-27538008 AATTAGCCAGACATGGTGGTGGG - Exonic
1124261595 15:28197601-28197623 AATTATCCAGGCATGGTGGTGGG + Intronic
1124923966 15:34053149-34053171 AATTATCCAGACATGGTGGTGGG + Intronic
1125302298 15:38269085-38269107 AATTAGCCAGACATGGTGGTGGG - Intronic
1125818097 15:42603654-42603676 AGTTTTGCAGGCAGGGGGCTAGG + Intronic
1125885162 15:43223823-43223845 AATTAGCCAGACATGGTGGTGGG + Intergenic
1127509032 15:59622162-59622184 AATTAGCCAGACATGGTGGTGGG + Exonic
1127553245 15:60061844-60061866 AATTTGGCAGGCAGGGGGCTAGG - Intergenic
1129243668 15:74267188-74267210 CATTTTGCAGACATGGGACTGGG + Intronic
1129378215 15:75148062-75148084 AATTAGCCAGACATGGTGGTGGG - Intergenic
1129542156 15:76359216-76359238 CCTTATGGAGAGATGGGGCTGGG - Intronic
1129633605 15:77290271-77290293 AATTAGCCAGGCATGGTGCTGGG - Intronic
1129741281 15:77990852-77990874 ATTTATGCAAGGATGGGGCTTGG - Intronic
1129844383 15:78761547-78761569 ATTTATGCAAGGATGGGGCTTGG + Intronic
1130257415 15:82332232-82332254 ACTTATGCAAGGATGGGGCTTGG - Intergenic
1130416644 15:83700613-83700635 AATTATCCAGGCATGGTGGTGGG + Intronic
1130597530 15:85257733-85257755 ACTTATGCAAGGATGGGGCTTGG + Intergenic
1130831533 15:87606111-87606133 AATTAGCCAGACATGGTGGTGGG + Intergenic
1131036835 15:89228060-89228082 AATTAGGCAGGCATGGTGGTGGG - Intergenic
1132600808 16:772042-772064 AATTAGCCAGACATGGTGGTGGG + Intronic
1132825549 16:1903556-1903578 AATTATCCAGACATGGTGGCGGG + Intergenic
1133066482 16:3211143-3211165 AATTATCCAGGCATGGTGGTGGG + Intergenic
1133319855 16:4906371-4906393 AATTATCCAGGCATGGTGGTGGG - Intronic
1133354266 16:5124456-5124478 AATTATCCAGGCATGGTGGTGGG - Intergenic
1133769394 16:8859043-8859065 AAATAGGCAGACCTGGGGCTGGG - Intronic
1134170219 16:11962461-11962483 AATTAGCCAGACATGGTGGTGGG + Intronic
1134320295 16:13156583-13156605 AATTAGGCAGGCATGGTGGTGGG + Intronic
1134359659 16:13519498-13519520 ATTTATAAAGACATGGTGCTTGG - Intergenic
1134454377 16:14383605-14383627 AATTAGCCGGACATGGGGGTGGG + Intergenic
1134483555 16:14638794-14638816 AATTAGCCAGGCATGGTGCTGGG + Intronic
1134827497 16:17296323-17296345 AAGATTGCAGAGATGGGGCTGGG + Intronic
1135740961 16:24974824-24974846 AATTAGGCAGTTATGGGGTTTGG + Intronic
1135874516 16:26185855-26185877 AATTATCCAGGCATGGTGGTGGG + Intergenic
1136562125 16:31045704-31045726 AATTATCCAGGCATGGTGGTGGG + Intergenic
1136627404 16:31470528-31470550 AATTAGCCAGACATGGTGGTGGG - Intergenic
1137425398 16:48375487-48375509 AATTATCCAGGCATGGTGGTGGG + Intronic
1137603671 16:49773168-49773190 AATTAGCCAGACATGGTGGTGGG + Intronic
1139570466 16:67808423-67808445 AATTAGCCAGGCATGGGGGTGGG + Intronic
1139590283 16:67929396-67929418 AATTCTGAGGCCATGGGGCTTGG - Exonic
1140186327 16:72775669-72775691 AATTGTGGGGACAGGGGGCTTGG - Intergenic
1140431750 16:74910114-74910136 AATTAGCCAGGCATGGGGGTGGG - Intronic
1140770123 16:78195671-78195693 AATTAGCCAGACATGGTGCTGGG + Intronic
1140907437 16:79420883-79420905 AATTATCCAGGCATGGGGGCAGG + Intergenic
1141129840 16:81428902-81428924 AATTATCCAGGCATGGTGGTGGG - Intergenic
1141807733 16:86353119-86353141 AATTAGCCAGGCATGGTGCTGGG - Intergenic
1141844726 16:86599798-86599820 AATTAGCCAGACATGGTGGTGGG - Intergenic
1142361024 16:89626964-89626986 AATTAGTCAGACGTGGGGCCAGG + Intronic
1142515863 17:428318-428340 AATTAATCAGACATGGTGGTGGG + Intergenic
1142839913 17:2620075-2620097 ATTTATGAAAATATGGGGCTGGG - Intronic
1143049470 17:4112292-4112314 AATTATCCAGGCGTGGGGGTGGG - Intronic
1143052288 17:4136193-4136215 AATTAGCCAGACATGGGGGCAGG + Intronic
1143522080 17:7450290-7450312 AATTAGGCAGGCATGGTGGTGGG - Intronic
1144628137 17:16855789-16855811 AATTAGCCAGACATGGTGGTGGG - Intergenic
1144822249 17:18083482-18083504 AAGTATGTATATATGGGGCTGGG - Intergenic
1144961726 17:19048003-19048025 AATTAGCCAGACATGGTGGTGGG - Intergenic
1144973435 17:19126521-19126543 AATTAGCCAGACATGGTGGTGGG + Intergenic
1145353552 17:22113354-22113376 AATTAGCCAGACATGGTGGTAGG + Intergenic
1146148546 17:30445314-30445336 AATTATCCAGGCATGGTGGTGGG + Intronic
1147009058 17:37429072-37429094 AATTTTGTAGACAGGGGTCTAGG + Intronic
1147011419 17:37451833-37451855 AATTAGCCAGACATGGTGGTGGG + Intronic
1147599591 17:41737689-41737711 AAACATGCAGACTTTGGGCTGGG - Intergenic
1148882377 17:50739503-50739525 AATTACGCAGGCATGGTGGTGGG + Intronic
1149620656 17:58042544-58042566 AATTAGCCAGACATGGTGGTGGG - Intergenic
1150102506 17:62436401-62436423 AATTATCCAGGCATGGTGGTGGG + Intronic
1150340493 17:64362702-64362724 AATTAGGCAGACATGGTGGTGGG + Intronic
1150437187 17:65163320-65163342 AATTAGCCAGGCATGGTGCTGGG - Intronic
1150502872 17:65668043-65668065 AATTATCCAGGCATGGTGGTGGG - Intronic
1150681034 17:67284705-67284727 AATTAGCCAGGCATGGTGCTGGG + Intergenic
1150872796 17:68932059-68932081 AATTATCCAGGCATGGTGGTCGG + Intronic
1150903526 17:69311636-69311658 AATTATCCAGCCATGGTGGTGGG - Intronic
1150976754 17:70096029-70096051 AATTAGCCAGACATGGTGGTGGG - Intronic
1151955574 17:77378554-77378576 AAATATGCAGATCTGGGGATGGG + Intronic
1152037320 17:77881270-77881292 AAAGCTGCAGACAGGGGGCTGGG + Intergenic
1153929814 18:9868217-9868239 AATTAGCCAGGCATGGGGGTGGG - Intergenic
1154282346 18:13015892-13015914 AATTAGCCAGACATGGTGGTGGG - Intronic
1154389871 18:13927288-13927310 AATTAGCCAGACATGGTGGTAGG + Intergenic
1155023622 18:21920478-21920500 AATTAACCAGACATGGTGGTAGG - Intergenic
1155299697 18:24418107-24418129 AATTAGCCAGACATGGTGCCAGG - Intergenic
1155690679 18:28618603-28618625 TATTCTACAGACATGGGGCAGGG + Intergenic
1155989103 18:32260813-32260835 AATTAGTCAGACATGGTGATGGG - Intronic
1156866621 18:41895783-41895805 AATTTTGTGGACAAGGGGCTAGG - Intergenic
1158285055 18:55871348-55871370 AATTATCCAGGCATGGTGGTGGG - Intergenic
1158447394 18:57533098-57533120 AATCATCCCGACTTGGGGCTTGG + Intergenic
1158892358 18:61884706-61884728 AATTAGGCAGGCATGGTGGTGGG - Intronic
1160615285 18:80122066-80122088 AATTAGCCAGACATGGTGGTAGG - Intronic
1160773033 19:841874-841896 AATTATCCAGGCATGGTGGTGGG - Intronic
1161308630 19:3581272-3581294 AATTAGCCAGACATGGTGGTGGG - Intergenic
1161581677 19:5084096-5084118 AATTATCCAGGCATGGTGGTGGG + Intronic
1161621296 19:5298715-5298737 AAAAAGGCAGACATGGAGCTGGG - Intronic
1162053350 19:8048813-8048835 AATTAGCCAGACATGGTGGTAGG + Intronic
1162380384 19:10328400-10328422 AATTATCCAGGCATGGGGGCGGG + Intronic
1162684695 19:12372308-12372330 AATTATCCAGACATGGTGGCGGG + Intergenic
1162687982 19:12403699-12403721 AATTAACCAGACATGGTGGTGGG - Intronic
1163225969 19:15961548-15961570 AATTAGCCAGACATGGTGGTGGG + Intergenic
1163520224 19:17787732-17787754 AACTGTGCAGCCACGGGGCTGGG - Exonic
1163760950 19:19136505-19136527 AATTAGCCAGACATGGTGGTGGG + Intronic
1163953130 19:20609796-20609818 AATTAACCAGACATGGTGGTGGG - Intronic
1164427064 19:28150946-28150968 AATTAGCCAGGCATGGTGCTGGG - Intergenic
1165082539 19:33317303-33317325 AATTATCCAGACATGGTGGCGGG - Intergenic
1165219500 19:34303762-34303784 AATTAGCCAGACATGGTGGTGGG - Intronic
1165561590 19:36685137-36685159 AATTATCCGGACATGGTGGTGGG + Intergenic
1165567400 19:36742837-36742859 AATTAGCCAGACATGGTGGTGGG - Intronic
1165926898 19:39332179-39332201 AATTATCCAGACATGGTGGTGGG + Intronic
1166258657 19:41623163-41623185 AATTAGGCAGGCATGGTGGTGGG - Intronic
1167005580 19:46774533-46774555 AATTAGCCAGACATGGTGGTGGG - Intronic
1167115393 19:47486594-47486616 AAGTATCCAGACTTGGGGCTGGG - Intergenic
1167312098 19:48742873-48742895 AATTAGCCAGACATGGTGGTGGG - Intronic
1167562659 19:50235207-50235229 AATTAGCCAGACATGGTGGTGGG + Intronic
1167646266 19:50706924-50706946 AATTAGCCAGACATGGTGGTGGG - Intronic
1168210190 19:54884481-54884503 AATTATCCAGGCATGGTGGTGGG + Intronic
1168383334 19:55942708-55942730 AATTAGCCAGACATGGTGATGGG - Intergenic
1168431475 19:56284661-56284683 AATTAGGCAGACATGGTGGTGGG - Intronic
1168492165 19:56820375-56820397 AATTATGCAGACATGGGGCTCGG + Intronic
1168513585 19:56992811-56992833 AATTAAACAGACATGGTGGTGGG + Intergenic
1168558765 19:57365652-57365674 AATTAGGCAGGCATGGTGGTGGG - Intronic
926189151 2:10714423-10714445 AATTATCCAGACATGGTGGTGGG + Intergenic
927807527 2:26161288-26161310 AATTAGCCAGACATGGTGGTGGG - Intergenic
928230781 2:29497121-29497143 AATTATCCAGGCATGGTGGTGGG + Intronic
928533266 2:32214082-32214104 AATTAGCCAGACGTGGGGCATGG - Intronic
928692549 2:33815834-33815856 AATTAGCCAGGCATGGTGCTGGG - Intergenic
929149133 2:38732203-38732225 AATTAAGCAGGCATGGTGGTAGG - Intronic
929161068 2:38832692-38832714 AATTAGCCAGACATGGTGATGGG - Intronic
930607909 2:53511241-53511263 AATTATCCAGGCATGGTGGTAGG + Intergenic
930729711 2:54716207-54716229 AATTAGCCAGACATGGTGGTGGG - Intergenic
930876858 2:56228679-56228701 AATTAGCCAGGCATGGGGGTGGG - Intronic
931661539 2:64568756-64568778 AATTAGCCAGGCATGGTGCTGGG - Intronic
932243693 2:70178456-70178478 AATTAGGCAGGCATGGTGGTGGG + Intronic
932544559 2:72694291-72694313 AATTAGCCAGACATGGTGGTGGG + Intronic
933283503 2:80358497-80358519 AATTAGGCAGGCATGGTGGTGGG - Intronic
933767955 2:85723627-85723649 TATGAAGCAGAGATGGGGCTTGG + Intergenic
933784704 2:85829272-85829294 AATTAGGCAGTCCAGGGGCTGGG + Intergenic
933826756 2:86168472-86168494 AATTATCCAGACATGGTGGTGGG + Intronic
934583018 2:95461918-95461940 AATTAGCCAGACATGGTGGTGGG - Intergenic
934596432 2:95614796-95614818 AATTAGCCAGACATGGTGGTGGG + Intergenic
934781792 2:96974085-96974107 AAATATACAGAAAAGGGGCTGGG + Intronic
934958534 2:98646556-98646578 AATTAGCCAGGCATGGGGGTGGG + Intronic
935159169 2:100514388-100514410 AATTATCCAGACATGGTTGTGGG - Intergenic
935359041 2:102232258-102232280 AATTAGCCAGACATGGTGGTGGG - Intronic
935390959 2:102552236-102552258 AATTAGGCAGGCATGGCGGTGGG - Intergenic
935723648 2:106002093-106002115 AATTAGCCAGACATGGTGGTGGG - Intergenic
936181948 2:110274761-110274783 AACTAAGCAGAGCTGGGGCTAGG + Intergenic
936230620 2:110696912-110696934 AACTAAGCAGAGCTGGGGCTAGG - Intergenic
936548026 2:113409526-113409548 GATGATGCAGAGTTGGGGCTGGG - Intergenic
937373002 2:121315371-121315393 ACTTATGCAGATTTGTGGCTGGG + Intergenic
937502468 2:122494760-122494782 AATTATGCATCCATGGGGCATGG + Intergenic
937537993 2:122914620-122914642 AATTAGCCAGACATGGTGGTGGG - Intergenic
938198749 2:129355861-129355883 AATTATGCAAATATGGGGTTGGG - Intergenic
938759237 2:134408802-134408824 AATAACCCAGACAAGGGGCTGGG - Intronic
938779084 2:134568376-134568398 AATTACCCAGACATGGTGGTGGG + Intronic
939013545 2:136875271-136875293 AATTAGCCAGACATGGTGGTGGG + Intronic
939666791 2:144962898-144962920 AGTTATGCAAACATGGGGACTGG + Intergenic
940294904 2:152112420-152112442 AATTAGCCAGGCATGGGGGTGGG - Intergenic
940576642 2:155515438-155515460 AAAGATTCAGACATGAGGCTTGG - Intergenic
940848106 2:158662489-158662511 AAGGAGGCAGACATGGGACTTGG + Intronic
941245073 2:163086027-163086049 AGTTTGGCAGACAGGGGGCTAGG - Intergenic
941404629 2:165073871-165073893 AATTTGGCAGGTATGGGGCTAGG + Intergenic
941441953 2:165549426-165549448 AATTAGGCAGATATAGAGCTTGG + Intronic
941449890 2:165647312-165647334 TATTTTGCAGACATTGGGATAGG + Intronic
941581115 2:167295941-167295963 AATGATGCAGAGTTGGGGTTGGG + Intergenic
941665682 2:168242140-168242162 AAATGTGCTGTCATGGGGCTGGG - Intronic
942060301 2:172223228-172223250 AATTAGCCAGACATGGTGGTGGG + Intergenic
944469051 2:200033407-200033429 AATTAACCAGACATGGTGGTGGG - Intergenic
945925476 2:215798992-215799014 AATTAGCCAGACATGGTGGTGGG - Intergenic
946241573 2:218359191-218359213 AATTATCCAGGCATGGTGGTGGG + Intronic
946358673 2:219205992-219206014 AATTTTGTAGAAATGGGGTTGGG - Intronic
946390246 2:219410910-219410932 AATTAGCCAGACATGGTGGTGGG - Intergenic
947196353 2:227572073-227572095 AATTAGCCAGACATGGTGGTGGG + Intergenic
947358006 2:229317204-229317226 AACTATACAGGCATGAGGCTAGG - Intergenic
947453445 2:230230181-230230203 AGTTAGGCAGACAGGGGGCTGGG + Intronic
947682917 2:232052169-232052191 AATTAGCCAGACATGGTGATGGG - Intronic
947790715 2:232866860-232866882 AATTATCCAGGCATAGGGGTGGG - Intronic
947965247 2:234274880-234274902 AATTAGCCAGACATGGTGGTGGG + Intergenic
948925060 2:241090716-241090738 AATTAGTCAGACATGGTGGTGGG + Intronic
1169240218 20:3970895-3970917 AATTATCCAGGCATGGTGGTGGG + Intronic
1169361950 20:4957750-4957772 AATTAGCCAGACATGGTGGTGGG + Intronic
1169801015 20:9511692-9511714 ATTTATGCAGACACTGTGCTAGG + Intergenic
1170068157 20:12337566-12337588 AGATATGCAGACATGTGTCTGGG - Intergenic
1170318355 20:15066731-15066753 AATTATGCAGGCGTGGTGGTGGG + Intronic
1170674273 20:18464822-18464844 AATTAGCCAGACATGGTGGTGGG - Intronic
1171788118 20:29491771-29491793 AATTATTCAGGCATGGTGGTAGG - Intergenic
1172131311 20:32657809-32657831 AATTAGCCAGACATGGTGGTGGG + Intergenic
1172224353 20:33295455-33295477 AATTAGCCAGACATGGTGGTGGG + Intronic
1172415595 20:34764535-34764557 AATTAGCCAGACATGGTGGTGGG + Intronic
1173050007 20:39550206-39550228 AATAATCCAGCCATGGGGCTGGG + Intergenic
1174872949 20:54200545-54200567 AATAAAGCAGACAAGGTGCTTGG - Intergenic
1174887424 20:54351053-54351075 AATTATCCAGGCATGGTGGTGGG + Intergenic
1174924756 20:54746983-54747005 AATTTTGCAGGCACGGGGCTAGG + Intergenic
1176215321 20:63945042-63945064 AATCAGGCAGGAATGGGGCTGGG + Intronic
1176518729 21:7808337-7808359 AAACAAGCAGACAAGGGGCTGGG + Intergenic
1178652757 21:34438350-34438372 AAACAAGCAGACAAGGGGCTGGG + Intergenic
1178708847 21:34896532-34896554 AATTAGCCAGACATGGTGGTGGG + Intronic
1178801334 21:35798613-35798635 AATTAGCCAGGCATGGTGCTGGG + Intronic
1180589395 22:16923600-16923622 GATGATGCAGAGTTGGGGCTGGG + Intergenic
1180622968 22:17174168-17174190 AATTAGCCAGACATGGTGGTGGG - Intergenic
1180740010 22:18046779-18046801 AATTAGCCAGACATGGTGGTGGG - Intergenic
1180926925 22:19561698-19561720 AATTAGGCAGGCATGGTGGTGGG - Intergenic
1181098008 22:20519407-20519429 AAATAAGGAGACATGGGGCTTGG - Intronic
1181737930 22:24896679-24896701 AATTATGTATACATGAGGCTGGG + Intronic
1181765811 22:25091204-25091226 AATTAGCCAGACATGGTGGTGGG - Intronic
1182159550 22:28107717-28107739 AATTATTCAGAGACTGGGCTAGG + Exonic
1182330330 22:29546987-29547009 AATTAGCCAGACATGGTGGTGGG - Intronic
1182875746 22:33689776-33689798 AATTATCCAGGCATGGTGGTGGG + Intronic
1183514501 22:38256360-38256382 AATTAGGCAGGCATGGTGGTGGG - Intronic
1184440567 22:44510329-44510351 AATTAGACAGACATGGTGGTGGG + Intergenic
1184510124 22:44928556-44928578 AATTAGCCAGACATGGTGGTGGG - Intronic
1184558951 22:45250281-45250303 AATTATCCAGGCATGGTGGTGGG + Intergenic
1184629325 22:45763477-45763499 CACTCTGCAGACCTGGGGCTGGG - Intronic
1184961313 22:47930861-47930883 AAAGATGCAGAAATGGGGGTAGG - Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949550760 3:5111019-5111041 AATTAGCCAGACATGGGGGTGGG + Intergenic
949770701 3:7574306-7574328 AATTAGCCAGGCATGGGGGTGGG - Intronic
950091220 3:10296464-10296486 AATTAGCCAGACATGGTGGTAGG - Intronic
950340573 3:12240567-12240589 AATTAGCCAGACATGGTGGTGGG - Intergenic
950622432 3:14216483-14216505 GATGAAGCAGACAGGGGGCTGGG + Intergenic
950918099 3:16665830-16665852 AATTAGCCAGACATGGTGGTGGG - Intronic
951314950 3:21178889-21178911 AAGTATGCAGAAAAGGGGGTAGG - Intergenic
952007848 3:28862939-28862961 AATTGTACAGATTTGGGGCTGGG + Intergenic
952036783 3:29212481-29212503 AAATGTGCAGACATGAGGTTTGG + Intergenic
952371233 3:32724705-32724727 AATTAGCCAGGCATTGGGCTGGG - Intronic
953226442 3:41025877-41025899 AATTAGCCAGACATGGTGATGGG + Intergenic
954050219 3:47969257-47969279 AATTAGCCAGACATGGTGGTGGG + Intronic
954239259 3:49280749-49280771 CATTATGGAGCCATGGGGGTTGG - Exonic
954284037 3:49605109-49605131 AATTAGCCAGACATGGTGGTGGG + Intronic
954350073 3:50035906-50035928 AATTAGCCAGACATGGTGGTGGG - Intronic
954454081 3:50587650-50587672 AGTTCTGCAGACATGCGGGTAGG + Intergenic
954561727 3:51562378-51562400 AATTAGCCAGACATGGTGGTGGG - Intronic
954588713 3:51761048-51761070 AATTATCCAGACGTGGTGGTGGG + Intergenic
954922661 3:54205057-54205079 AATAATGAAGACATGGAGTTAGG + Intronic
955234475 3:57127552-57127574 AATTAGCCAGACATGGTGGTGGG - Intronic
955723275 3:61906157-61906179 AATTATAGGGACTTGGGGCTGGG + Intronic
955938071 3:64121680-64121702 AATTATGTAGCCATGGGGGAGGG + Intronic
956933264 3:74070580-74070602 CACTGTGCAGACCTGGGGCTTGG - Intergenic
958180773 3:90057746-90057768 AATTATTTGGCCATGGGGCTAGG + Intergenic
958672458 3:97221879-97221901 AATTAGGCAGATATGGTGGTGGG + Intronic
959077520 3:101764627-101764649 AATTAGGCAGACATGGTGGTGGG + Intronic
959344453 3:105175490-105175512 AAATTTACAGACATGGGACTAGG - Intergenic
959755921 3:109898805-109898827 AATTATCCAGGCCTGGGGGTGGG + Intergenic
960039959 3:113140657-113140679 AATTAGCCAGACATGGTGGTGGG + Intergenic
960417774 3:117406280-117406302 AATTAGCCAGACATGGTGGTAGG - Intergenic
960862780 3:122168596-122168618 AATTAGCCAGACATGGTGGTAGG - Intergenic
961230225 3:125300118-125300140 AATTAGGCAGGCATGGTGGTGGG - Intronic
961286220 3:125806500-125806522 AATTAGCCAGACATGGTGGTAGG - Intergenic
961287636 3:125819261-125819283 CATTAGGCAGAAATGTGGCTGGG + Intergenic
961894283 3:130154406-130154428 AATTAGCCGGACATGGTGCTGGG - Intergenic
961899439 3:130196727-130196749 CATTAGGCAGAAATGTGGCTGGG - Intergenic
962217917 3:133538740-133538762 AATTAGCCAGACATGGTGGTGGG + Intergenic
962523339 3:136216943-136216965 AATTAGGCAGGCATGGTGGTGGG + Intergenic
962867960 3:139463333-139463355 AATTAACCAGACATGGTGGTGGG - Intronic
962890701 3:139670350-139670372 AGTTATCCCGTCATGGGGCTGGG - Intronic
963006955 3:140735349-140735371 AATTAGCCAGACATGGTGGTGGG - Intergenic
963144696 3:141980682-141980704 AATTAGCCAGTCATGGGGGTAGG - Intronic
963872663 3:150435124-150435146 AATTAGGCAGGCATGGTGGTGGG - Intronic
964105392 3:153034254-153034276 AATTAGCCAGACATGGTGGTGGG - Intergenic
964109599 3:153074777-153074799 AATTATGCAAAGATGTGGCCGGG - Intergenic
964261259 3:154840346-154840368 AAGTATGCAGGCATGGTGGTGGG - Intergenic
964261856 3:154848384-154848406 AATTATCCAGATATGGTGGTGGG + Intergenic
965566019 3:170118558-170118580 AATTATCCAGGCATGGTGGTGGG - Intronic
967227804 3:187309404-187309426 AATTAGCCAGACATGGTGGTGGG - Intergenic
967522834 3:190454812-190454834 AATTAGCCAGACATGGTGGTGGG - Intergenic
967869098 3:194214836-194214858 AATTAGCCAGGCATGGGGGTGGG + Intergenic
967906425 3:194504650-194504672 AATTAGCCAGACATGGTGGTGGG + Intergenic
968753803 4:2404171-2404193 AATTATCCAGGCATGGTGGTGGG + Intronic
969109068 4:4830084-4830106 AATTAGACAGACATGGGTTTGGG - Intergenic
969748489 4:9092664-9092686 AATTAGCCGGACATGGTGCTGGG + Intergenic
970545947 4:17130585-17130607 AAAAATGTAGACATTGGGCTGGG + Intergenic
971276014 4:25197591-25197613 AATTATCCAGGCATGGTGGTGGG - Intronic
971321629 4:25610626-25610648 AATTAGTCAGACATGGTGGTGGG - Intergenic
972224555 4:36997445-36997467 ATTTTTGTAGACATGGGGCCTGG + Intergenic
972274728 4:37546548-37546570 AATTGTGCAGTCAGGGAGCTCGG + Intronic
972567876 4:40285312-40285334 AATTATCCAGGCATGGTGGTGGG + Intergenic
973107949 4:46363141-46363163 AATTATGCATACATGAGACATGG + Intronic
973756466 4:54079066-54079088 AATTAGGCAGGCATGGTGGTGGG + Intronic
974027451 4:56746219-56746241 AATTAGCCAGACATGGTGGTGGG + Intergenic
974035548 4:56814810-56814832 AATTAGCCAGACATGGTGGTGGG + Intronic
974346238 4:60685443-60685465 AATTATCCAGGCATGGTGATGGG - Intergenic
975213541 4:71728706-71728728 AACTGGGCAGAGATGGGGCTGGG - Intergenic
975251881 4:72189728-72189750 AATTATGTAGTTATGGGGCATGG - Intergenic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
975919926 4:79373205-79373227 AATTAGCCAGACATGGTGTTGGG + Intergenic
976457516 4:85265571-85265593 AATTATCCAGGCATGGCGGTGGG + Intergenic
976607584 4:86997058-86997080 AATTAGCCAGACATGGTGGTGGG - Intronic
976910968 4:90305063-90305085 AATTATCCAGGCATGGTGGTGGG - Intronic
977081762 4:92538891-92538913 AATTATCCAGGCATGGTGGTGGG + Intronic
977500076 4:97827382-97827404 AATTATCCGGACATGGTGGTGGG - Intronic
977568761 4:98609234-98609256 AAATAGTCAGGCATGGGGCTTGG - Intronic
978044241 4:104106926-104106948 AAGTATGCTGCCAAGGGGCTGGG + Intergenic
978178936 4:105769900-105769922 AATTAGGCAGGCATGGTGGTGGG - Intronic
978304044 4:107302722-107302744 AATTTTGTAGAGATGGGGTTTGG - Intergenic
978863279 4:113476972-113476994 AATTTGGCAGGCAGGGGGCTAGG - Intronic
979149184 4:117286753-117286775 AATTAGCCAGACATGGTGGTGGG + Intergenic
979241639 4:118452327-118452349 AATTATCCAGACATGGTGGTGGG + Intergenic
980254492 4:130360750-130360772 AATTAGCCAGGCATGGGGGTGGG + Intergenic
980990059 4:139731467-139731489 AATTAGCCAGACATGGTGGTGGG + Intronic
981988191 4:150883309-150883331 AATTAGCCAGGCATGGGGGTGGG + Intronic
982009885 4:151096558-151096580 AATTATCCAGGCATGGCGATGGG - Intergenic
982398082 4:154935375-154935397 AATTAGCCAGGCATGGTGCTGGG - Intergenic
982731153 4:158956818-158956840 AATTATGGAGAGCTGGGGCCAGG - Intronic
983190024 4:164745442-164745464 AATTATCCAGGCATGGTGGTGGG - Intergenic
984181340 4:176486632-176486654 AAATTTGTAGACATTGGGCTGGG + Intergenic
984310065 4:178046659-178046681 AATTTGGCAGACATGGGGCTAGG + Intergenic
984408577 4:179366441-179366463 AATTAGCCAGACATGGTGGTGGG + Intergenic
984760799 4:183361027-183361049 AATTAGCCAGACATGGTGGTGGG + Intergenic
985013184 4:185605429-185605451 AATTAGTCAGACATGGTGTTGGG - Intronic
985299710 4:188475168-188475190 AATTAGGCAGGCATGGTGGTGGG - Intergenic
985437985 4:189951340-189951362 AATTATTCAGGCATGGTGATAGG + Intronic
985746049 5:1648396-1648418 AAGAATGCAGACATGAGGGTGGG - Intergenic
986210762 5:5669667-5669689 GATTGCTCAGACATGGGGCTGGG - Intergenic
987787307 5:22518236-22518258 AATGATGAAGAGATGGTGCTTGG - Intronic
987859552 5:23466920-23466942 AATTTGTCAGACAAGGGGCTAGG - Intergenic
988002933 5:25372434-25372456 AATTCTCCAGACATTGGTCTCGG + Intergenic
988855641 5:35225828-35225850 AATTAGGCAGGCATGGTGGTGGG - Intronic
989626564 5:43435263-43435285 AATTAGCCAGACATGGTGGTGGG - Intergenic
990147117 5:52774748-52774770 AATTAGCCAGACATGGTGGTGGG + Intergenic
990265622 5:54071822-54071844 AATTAGCCAGGCATGGTGCTGGG + Intronic
990420786 5:55630982-55631004 AATTAGGCAGACATGGTGGTGGG + Intronic
991453940 5:66782138-66782160 AATTAGGCAGGCATGGTGGTGGG + Intronic
991660827 5:68949285-68949307 TATGAGGCAGCCATGGGGCTTGG + Intergenic
991672028 5:69057206-69057228 AATTAGGCAGGCATGGTGGTGGG + Intergenic
992219927 5:74561643-74561665 AATTAGGCAGGCATGGTGCCGGG + Intergenic
992932669 5:81665640-81665662 AATTAGCCAGACATGGTGCCTGG - Intronic
994715878 5:103321050-103321072 AATTAGCCAGACATGGTGGTGGG - Intergenic
996135563 5:119837710-119837732 AATTAGCCAGACATGGTGGTGGG - Intergenic
997345974 5:133192431-133192453 AATTAGCCAGACATGGTGGTGGG - Intergenic
998089509 5:139355987-139356009 AATTAGCCAGACATGGTGTTGGG + Intronic
998444919 5:142191265-142191287 AATTAGCCAGACATGGTGGTGGG + Intergenic
998816557 5:146020384-146020406 AATAATGCAGGCATTGTGCTGGG - Intronic
999291090 5:150426948-150426970 AATTATCCAGGCATGGTGGTGGG - Intergenic
999629658 5:153557411-153557433 AATTAGCCAGACATGGGGGCAGG - Intronic
999783197 5:154868083-154868105 AATTATCCAGGCATGGTGGTGGG - Intronic
999816208 5:155178891-155178913 ATTTATGCAGGCATGGGGGAGGG + Intergenic
999885490 5:155918412-155918434 AATTATCCAGCCATGGTGCTGGG + Intronic
1000839271 5:166196423-166196445 AATAATAAAGACATGGGGCCGGG + Intergenic
1003202630 6:3976258-3976280 AATTATCCAGGCATGGTGGTGGG - Intergenic
1003281682 6:4698113-4698135 AATTAGCCAGACATGGTGGTGGG - Intergenic
1003401068 6:5791397-5791419 AATTAGCCAGACATGGTGGTAGG - Intergenic
1003693045 6:8373785-8373807 AATTTAGCAGGCAGGGGGCTAGG + Intergenic
1004355474 6:14926584-14926606 AATTATCCAGGCATGGTGGTGGG + Intergenic
1004622019 6:17339135-17339157 AATTAGCCAGGCATGGTGCTGGG + Intergenic
1006507603 6:34499645-34499667 AATTATGCAGGCATGGTGACGGG + Intronic
1006972656 6:38062665-38062687 AATTAAGCAGACAATGGGCTGGG - Intronic
1007426697 6:41750845-41750867 AATTATCCAGGCATGGCGGTGGG + Intronic
1007448976 6:41928816-41928838 ACTTATGCAGACATGGGAACTGG - Intronic
1008611297 6:53186926-53186948 AATTAGCCAGGCATGGCGCTAGG - Intergenic
1008925605 6:56889020-56889042 CCTTAAGCAGACATGGGTCTAGG - Intronic
1009417739 6:63434289-63434311 AATTAGCCAGACATGGTGGTGGG + Intergenic
1010279277 6:74005193-74005215 AATTAGCCAGGCATGGTGCTGGG + Intergenic
1010435104 6:75820516-75820538 AATTAGCCAGACATGGTGGTGGG - Intronic
1011484894 6:87830828-87830850 AATTATCCAGGCATGGTGGTGGG - Intergenic
1012281352 6:97331178-97331200 AATTATCCAGGCATGGTGGTGGG + Intergenic
1012800160 6:103816204-103816226 TGATATGCAGACATTGGGCTTGG - Intergenic
1013127679 6:107200813-107200835 AATTATCCAGGCATGGTGGTGGG - Intronic
1013785530 6:113775663-113775685 AATTATCCAGACTTGGTGGTGGG - Intergenic
1014038923 6:116800979-116801001 AGTTAGGCAGAAATGAGGCTAGG - Intronic
1015112662 6:129610774-129610796 AATTATCCAGGCATGGTGTTGGG - Intronic
1015147335 6:130002026-130002048 ATTCATGCAGATATGAGGCTAGG - Intergenic
1015166119 6:130202011-130202033 TACTATGTAGACATGGGGTTGGG - Intronic
1015618858 6:135108181-135108203 AATTACCCAGACATGGTGGTGGG - Intergenic
1016123186 6:140368767-140368789 AATTAGCCAGGCATGGGGGTGGG + Intergenic
1016474972 6:144417280-144417302 AATTATGAAGACACAGGACTAGG - Intronic
1016601046 6:145861048-145861070 AAGTTTGCAGACATTGGACTGGG + Intergenic
1017137758 6:151163161-151163183 AATTAGACAGACATGGTGGTAGG + Intergenic
1017274073 6:152545429-152545451 AATTAGCCAGACATGGTGGTGGG + Intronic
1017560640 6:155624791-155624813 AATTAGCCAGGCATGGGGGTGGG - Intergenic
1017693565 6:156991377-156991399 AATTAGCCAGACATGGTGATGGG - Intronic
1017806201 6:157947608-157947630 AAAAATGCAGAACTGGGGCTAGG + Intergenic
1018198494 6:161375335-161375357 GACCATGCAGACCTGGGGCTGGG - Intronic
1019974690 7:4571755-4571777 AATTAGCCAGACATGGTGGTGGG + Intergenic
1020140542 7:5609204-5609226 AATTAGCCAGACATGGTGGTGGG + Intergenic
1020236881 7:6362929-6362951 AATTAGCCAGACATGGTGATGGG + Intergenic
1020435156 7:8153739-8153761 AATTATTGAGTCATGGGGCTAGG - Intronic
1021688449 7:23210172-23210194 AATTAGGCAGGCATGGTGGTGGG + Intergenic
1022357625 7:29630723-29630745 AATTATCCAGGCATGGTGGTGGG + Intergenic
1023001461 7:35811976-35811998 AATTAGCCAGACATGGTGGTTGG + Intronic
1023316336 7:38941472-38941494 AATTAGCCAGACATGGTGCCGGG - Intergenic
1023482392 7:40647700-40647722 AATTAGCCAGGCATGGGGGTGGG + Intronic
1023483545 7:40660405-40660427 AATTAGCCAGACATGGTGGTGGG - Intronic
1024292833 7:47817719-47817741 AATTAGCCAGACATGGTGATGGG + Intronic
1024547459 7:50534446-50534468 AATTATCCAGGCATGGTGATGGG + Intronic
1024861598 7:53849190-53849212 AATTCTACAGACATTGGTCTAGG - Intergenic
1025697075 7:63783448-63783470 AATTAGCCAGACATGGTGGTCGG + Intergenic
1025926119 7:65961851-65961873 AATTATACAGGCATGGTGGTGGG + Intronic
1026232125 7:68493989-68494011 AATTAGCCAGACATGGTGATGGG + Intergenic
1026423401 7:70264499-70264521 AATAATGCAAACATTTGGCTGGG - Intronic
1026493359 7:70882137-70882159 AATAATTCAAACTTGGGGCTGGG - Intergenic
1026935223 7:74250935-74250957 AATTAGGCAGGCATGGTGGTGGG - Intronic
1028078445 7:86544382-86544404 AATGATAAAAACATGGGGCTTGG + Intergenic
1029187346 7:98748581-98748603 AATTAGGCAGGCATGGTGGTGGG + Intergenic
1029474933 7:100777508-100777530 AATTAGCCAGACGTGGGGCGTGG - Intronic
1029475640 7:100782475-100782497 AATTATCCAGGCATGGTGGTGGG - Intronic
1029632309 7:101760631-101760653 AAAAATGCGGATATGGGGCTGGG - Intergenic
1029665179 7:101990523-101990545 AATTAGCCAGACATGGTGGTGGG - Intronic
1030271205 7:107670255-107670277 AATTAGCCAGGCATGGGGGTAGG - Intronic
1030412620 7:109200883-109200905 AATTAGCCAGACATGGTGGTGGG - Intergenic
1031015255 7:116568279-116568301 AATTAGCCAGACATGGTGGTGGG + Intergenic
1031049060 7:116926738-116926760 AATTATCCAGGCATGGTGGTGGG + Intergenic
1031305649 7:120123247-120123269 TCTTATGCAGAAAAGGGGCTGGG - Intergenic
1031560195 7:123228779-123228801 AATTATCCAGGCGTGGGGGTGGG + Intergenic
1031887287 7:127254891-127254913 ATTTATGCGGAGATGGGGCTGGG + Intergenic
1032031656 7:128489285-128489307 AATTATCCAGGCATGGTGGTGGG + Intronic
1032127311 7:129204495-129204517 AATTAGCCAGACATGGTGGTGGG + Intronic
1032362019 7:131264985-131265007 AATTAGCCAGACATGGTGGTGGG - Intronic
1032411297 7:131694768-131694790 AATTAGCCAGACATGGTGGTGGG + Intergenic
1032493469 7:132342796-132342818 AATTAGCCAGGCATGGTGCTGGG + Intronic
1032819870 7:135514231-135514253 AATTAGCCAGACATGGTGGTGGG + Intergenic
1032877921 7:136057541-136057563 AATTATGAACACATCTGGCTGGG - Intergenic
1033211142 7:139461099-139461121 AATTATCCAGGCATGGTGATGGG + Intronic
1033981533 7:147171023-147171045 GATTCAGCAGACATGGAGCTGGG - Intronic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1034615993 7:152417265-152417287 AATTAGCCAGACATGGTGGTGGG - Intronic
1034853058 7:154514125-154514147 AATTAGGCAGGCATGGTGGTGGG + Intronic
1035124156 7:156595715-156595737 AAGTTTGCATACATTGGGCTTGG + Intergenic
1036371559 8:8166958-8166980 AATTAGCCGGACATGGTGCTGGG + Intergenic
1036488294 8:9199851-9199873 AATTATCCAGGCATGGTGGTGGG + Intergenic
1036490726 8:9223022-9223044 AATTAGCCAGACATGGTGGTGGG - Intergenic
1036631821 8:10521252-10521274 AATTAGCCAGACATGGTGGTGGG + Intergenic
1036634210 8:10537882-10537904 ATTTATGTAGACGTGGGGCATGG + Intronic
1036879344 8:12498686-12498708 AATTAGCCGGACATGGTGCTGGG - Intergenic
1037010634 8:13838193-13838215 AATTTGGCAGGCATGAGGCTAGG - Intergenic
1037127985 8:15373147-15373169 AATTATCCAGGCATGGTGGTGGG - Intergenic
1037683748 8:21119973-21119995 AATTAGCCAGACATGGTGATGGG + Intergenic
1037854858 8:22364395-22364417 GATTGTGCAGACAGTGGGCTGGG - Intergenic
1038409192 8:27345012-27345034 AATTAGCCAGACATGGTGGTGGG + Intronic
1038788729 8:30647432-30647454 AATTAGCCAGACATGGGAATGGG + Intronic
1039710002 8:40046140-40046162 AATTAGCCAGACATGGTGGTGGG + Intergenic
1039849464 8:41350647-41350669 AATTATCCAGGCATGGTGGTGGG + Intergenic
1039880693 8:41623720-41623742 CTTTAGGCAGCCATGGGGCTGGG + Exonic
1040000399 8:42571049-42571071 AATTAGCCAGACATGGTGGTGGG - Intergenic
1040472419 8:47745358-47745380 AATTAGCCAGACATGGTGGTGGG + Intergenic
1040663326 8:49600243-49600265 AATTAGCCAGACATGGTGGTGGG + Intergenic
1040830105 8:51666737-51666759 GATTATGCAGGCATGGGACTTGG - Intronic
1040950257 8:52931582-52931604 AATTAGCCAGACATGGTGGTGGG - Intergenic
1041351287 8:56950434-56950456 AAATATGAGGACATGAGGCTGGG - Intergenic
1041381907 8:57260211-57260233 CATTGTGCAGCCATGGGGTTTGG - Intergenic
1041542534 8:59002295-59002317 AAAAATGCAGACATAGGGCCGGG + Intronic
1042479746 8:69290049-69290071 AATTATCCAGGCATGGTGGTGGG - Intergenic
1042754049 8:72190139-72190161 AATTAGGCAGGCATGGTGGTGGG + Intergenic
1044080874 8:87881798-87881820 AATAATGTAGACATGGTTCTTGG + Intergenic
1044354880 8:91209278-91209300 AATTAGCCAGACATGGTGGTGGG + Intronic
1044464519 8:92487898-92487920 AATTATGAAAACGTGGGGATGGG + Intergenic
1044649839 8:94482492-94482514 ATTTAGCCAGACATGGGGGTGGG + Intergenic
1045133295 8:99182883-99182905 AATTAGCCAGACATGGGGGTGGG - Intronic
1045284417 8:100778128-100778150 AATTAGCCAGACATGGTGGTGGG - Intergenic
1045335687 8:101202307-101202329 AATTAGGCAGGCATGGTGGTAGG + Intronic
1045961320 8:107972292-107972314 AATTATCCAGACATGGTGGCAGG - Intronic
1046399561 8:113687049-113687071 AATGATGCTTACATGGAGCTTGG + Intergenic
1046563557 8:115869408-115869430 AATTTTGAAGACATTGTGCTAGG + Intergenic
1047065943 8:121283552-121283574 TATTATGAAGATATGGGTCTTGG - Intergenic
1047304076 8:123639248-123639270 AATTATCCAGGCATGGTGGTGGG - Intergenic
1047467782 8:125135063-125135085 AATTAGCCAGACATGGAGGTTGG - Intronic
1047992932 8:130305510-130305532 AATTAGCCAGACATGGTGGTGGG - Intronic
1048432724 8:134385290-134385312 TATTAGGAAGGCATGGGGCTGGG - Intergenic
1049088731 8:140497427-140497449 AATTAGCCAGATATGGTGCTGGG - Intergenic
1049740006 8:144234663-144234685 AATTAGCCAGACATGGTGGTGGG - Intronic
1050252246 9:3757263-3757285 AATTATCCAGACATGGTGGTGGG + Intergenic
1050798676 9:9580695-9580717 AATTAGGCAGGCATGGTGGTAGG - Intronic
1051949939 9:22619390-22619412 AAGAATGCAGACATAGGGCTAGG + Intergenic
1052327780 9:27234092-27234114 AAATATGTAGTCATGGGGTTGGG + Intergenic
1052561632 9:30090947-30090969 AATTAGACAGACGTGGGGGTGGG - Intergenic
1052792810 9:32891850-32891872 AATTATACATACATGAAGCTTGG - Intergenic
1052873977 9:33538585-33538607 AATTAGCCAGGCATGGGGGTGGG + Intronic
1053502069 9:38605760-38605782 AATTAGCCAGGCATGGGGGTGGG - Intergenic
1053575772 9:39356740-39356762 AATTAGGCAGGCATGGTGGTGGG - Intronic
1053840292 9:42184677-42184699 AATTAGGCAGGCATGGTGGTGGG - Intronic
1054097341 9:60915431-60915453 AATTAGGCAGGCATGGTGGTGGG - Intergenic
1054118747 9:61191061-61191083 AATTAGGCAGGCATGGTGGTGGG - Intronic
1054589009 9:66991501-66991523 AATTAGGCAGGCATGGTGGTGGG + Intergenic
1054855861 9:69898885-69898907 AATTAGAAAGACATGGGGGTGGG - Intronic
1055118733 9:72634077-72634099 AATTTGGCAGACAGGGGACTAGG + Intronic
1056423599 9:86454178-86454200 AATTATCCAGGCATGGTGGTAGG - Intergenic
1056908199 9:90673153-90673175 AATTAGCCAGACATGGTGGTGGG - Intergenic
1058007998 9:99940277-99940299 AATTATCCAGGCATGGTGGTGGG - Intronic
1058197932 9:102001560-102001582 AATTAGGCAGGCATGGCGGTAGG - Intergenic
1058200754 9:102036850-102036872 AATTAGCCAGACATGGTGGTGGG + Intergenic
1058755101 9:108076572-108076594 AATTAGCCAGGCATGGTGCTGGG - Intergenic
1059052659 9:110943709-110943731 AATTAGTCAGACATGGTGGTGGG + Intronic
1059325024 9:113498766-113498788 AATTAACTAGACATGGTGCTGGG + Intronic
1059836028 9:118154074-118154096 AATGATGCTTACAAGGGGCTGGG - Intergenic
1059947988 9:119432103-119432125 AATTAGCCAGACATGGTGATGGG - Intergenic
1060046100 9:120342337-120342359 AATTTAGAAGACATGGGGCTGGG + Intergenic
1060964051 9:127702222-127702244 AATTAGGCAGGCATGGTGATGGG + Intronic
1185561631 X:1064363-1064385 AATTAGCCAGACATGGTGGTGGG + Intergenic
1185974743 X:4707547-4707569 AATTAGCCAGACATGGTGGTGGG + Intergenic
1187449242 X:19382102-19382124 AATTAGCCAGACATGGTGGTGGG + Intronic
1187855497 X:23632792-23632814 AATTAGCCAGACATGGTGGTGGG + Intergenic
1190822736 X:53989109-53989131 AATTAGCCAGACATGGTGGTGGG - Intronic
1190837555 X:54114894-54114916 AATTAGCCAGACATGGTGGTGGG - Intronic
1192108942 X:68344461-68344483 AATTAGCCAGACATGGAGTTGGG + Intronic
1192593331 X:72380393-72380415 AATTGTTCAGAAATGAGGCTTGG + Intronic
1192999783 X:76551608-76551630 AATTAGCCAGACATGGTGGTGGG - Intergenic
1193387160 X:80885512-80885534 AATTAGCCAGACATGGTGGTGGG - Intergenic
1193572632 X:83162367-83162389 AATTAGCCAGGCATGGGGGTGGG - Intergenic
1194952741 X:100145814-100145836 AATTATGAAGACATGAGATTTGG + Intergenic
1195628673 X:107031038-107031060 AATTAGCCAGACATGGTGGTGGG - Intergenic
1196987267 X:121288793-121288815 AATTAGGCAGTCATGGTGGTGGG + Intergenic
1198165486 X:134051363-134051385 AATTATCCAGGCATGGTGGTGGG + Intergenic
1198191128 X:134307154-134307176 AATTATCCAGGCATGGTGGTGGG + Intergenic
1198380189 X:136076419-136076441 AATTAGCCAGACATGGTGGTGGG - Intergenic
1198435183 X:136610062-136610084 TATAATACAGACATGGAGCTCGG - Intergenic
1198857093 X:141030553-141030575 AATTAGGCAGGCATGGTGGTGGG - Intergenic
1198905602 X:141556814-141556836 AATTAGGCAGGCATGGTGGTGGG + Intergenic
1201339552 Y:12918645-12918667 AGTTTTGCAGACTTGGGGTTGGG + Intronic
1202389354 Y:24354151-24354173 AATTATCCAGACATGGTCGTGGG + Intergenic
1202481433 Y:25315974-25315996 AATTATCCAGACATGGTCGTGGG - Intergenic