ID: 1168492360

View in Genome Browser
Species Human (GRCh38)
Location 19:56821542-56821564
Sequence TGCCCCCTAGAGTCCAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168492360_1168492366 6 Left 1168492360 19:56821542-56821564 CCCCAGCTGGACTCTAGGGGGCA 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1168492366 19:56821571-56821593 CACACCATCTGGGGAAAGAAAGG 0: 1
1: 0
2: 2
3: 43
4: 244
1168492360_1168492364 -4 Left 1168492360 19:56821542-56821564 CCCCAGCTGGACTCTAGGGGGCA 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1168492364 19:56821561-56821583 GGCAGATAAACACACCATCTGGG 0: 1
1: 0
2: 0
3: 11
4: 140
1168492360_1168492365 -3 Left 1168492360 19:56821542-56821564 CCCCAGCTGGACTCTAGGGGGCA 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1168492365 19:56821562-56821584 GCAGATAAACACACCATCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 177
1168492360_1168492363 -5 Left 1168492360 19:56821542-56821564 CCCCAGCTGGACTCTAGGGGGCA 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1168492363 19:56821560-56821582 GGGCAGATAAACACACCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168492360 Original CRISPR TGCCCCCTAGAGTCCAGCTG GGG (reversed) Intronic
900192107 1:1356158-1356180 TGCCCCCTAGGGCCCATGTGGGG + Intronic
900868942 1:5288252-5288274 TGCCCTCTGGATTCCAGCTGTGG + Intergenic
901628306 1:10635860-10635882 GGCCACCTGGAGTCCAGCTCAGG + Intergenic
901813464 1:11780654-11780676 TGACTCCTAGAGGCCAGGTGAGG - Intronic
903125568 1:21245165-21245187 AGCCCCCTAGGGGCCAGCAGGGG - Intronic
905263926 1:36738361-36738383 GGGCCCCCAGACTCCAGCTGAGG + Intergenic
906319998 1:44809845-44809867 TGCCCCCAAGACTCAGGCTGGGG + Intronic
907545682 1:55258124-55258146 TGCAACCTAGATGCCAGCTGGGG + Intergenic
907904698 1:58773646-58773668 TTCCCCCGTGAGTGCAGCTGGGG + Intergenic
908338235 1:63149228-63149250 TGCCCCCTAGTGCCCAGCACAGG + Intergenic
908491548 1:64649314-64649336 TGCCTCCTAAAGTGCAGTTGTGG + Intronic
914352223 1:146850271-146850293 TGTCCTCTAAAGTTCAGCTGGGG - Intergenic
914419668 1:147517837-147517859 TGCCCTCTGGTGTCCTGCTGTGG - Intergenic
914419777 1:147518745-147518767 TGCCCCCTGGAATCAGGCTGAGG - Intergenic
917880933 1:179335147-179335169 TGAGCCCTAGAGTTCAGCTTGGG + Intronic
919861158 1:201740171-201740193 TGCCCCTGAGACTGCAGCTGCGG - Intronic
921353655 1:214263916-214263938 TGCACCCTAGAGTCATGCTATGG + Intergenic
921707387 1:218339421-218339443 TGCCACCTAGAGGAAAGCTGTGG - Intergenic
922061429 1:222096345-222096367 TGCCCCCTAGAGGCAAGGAGGGG - Intergenic
924556379 1:245122498-245122520 TGCCACCTGCATTCCAGCTGGGG - Intronic
1063978847 10:11437793-11437815 TGCCACCTGGAGGCCAGGTGGGG + Intergenic
1067244168 10:44522767-44522789 TGCCCCCTATAGCCCAGCAAAGG + Intergenic
1069490648 10:68857749-68857771 TGCCCCCTAAATTAGAGCTGAGG + Intronic
1069997841 10:72354076-72354098 CGCCCGCAAGAGTCCAGCGGCGG - Intronic
1070831138 10:79418729-79418751 TGTCCCCTAGGGGCCAGATGGGG + Intronic
1074055772 10:109922324-109922346 GGCCCCCTAAAGACCACCTGAGG + Intronic
1076769749 10:132656523-132656545 TGACTCCTTGACTCCAGCTGGGG - Intronic
1077524569 11:3056755-3056777 TCCCCCCTAAAGGCCAGCTGGGG + Intronic
1078544321 11:12235736-12235758 TGCCTCATGGAGACCAGCTGGGG - Intronic
1078611924 11:12828136-12828158 AGCCCGCCAGAGTCAAGCTGGGG - Intronic
1081847487 11:46251431-46251453 TCCCTCCTGGAGTCCACCTGGGG - Intergenic
1083954968 11:65978076-65978098 TGCCCACTAGAGACAAACTGAGG - Intronic
1085758128 11:79218398-79218420 TGTCCCCAAGGGTCCTGCTGGGG + Intronic
1091872091 12:3901276-3901298 TGCCCCCTAGAGTTGTGCTATGG - Intergenic
1096137864 12:49217716-49217738 TGCCTCCTGGAGCCCAGGTGAGG - Intronic
1096264404 12:50111716-50111738 CGCCCCCTAGAGCCCGGCTGTGG - Intergenic
1098199590 12:68040631-68040653 TGGCCCCTAGAGGGCAGCAGAGG + Intergenic
1099151515 12:79119962-79119984 TGCCTCCTAAAGACCTGCTGTGG + Intronic
1099909837 12:88816058-88816080 TACCCCCTATACTCCAGCAGAGG - Intergenic
1100489696 12:95067603-95067625 TGCCCCCTACACTCCAGCCTGGG - Intronic
1102187741 12:110963040-110963062 AGCCCCCTAGATGCCATCTGAGG + Intergenic
1103639184 12:122335374-122335396 TGCCACCTTGAGTCTGGCTGTGG - Intronic
1104056865 12:125237237-125237259 TGCCCCCTGGAGGTCACCTGCGG - Intronic
1106546786 13:30737711-30737733 TGCCCCTTAGGAGCCAGCTGAGG + Intronic
1106776971 13:33017467-33017489 TGCCCCTTGGAGTCCATCTGTGG + Intronic
1113040745 13:106101512-106101534 TGCCTTCTAGAGCCGAGCTGAGG - Intergenic
1114219549 14:20684365-20684387 TGCCCGTTGGGGTCCAGCTGAGG + Exonic
1114472542 14:22973736-22973758 TGACACCTGGTGTCCAGCTGAGG - Intronic
1118460848 14:65985763-65985785 TGGACCCCACAGTCCAGCTGTGG + Intronic
1119284533 14:73441828-73441850 TGCCCACTACACTCCAGCTTGGG + Intronic
1120514769 14:85457594-85457616 TGACCCCTAGAGTCAAACTAGGG + Intergenic
1121619170 14:95334229-95334251 CGTCCCCTAGAGTCCACCTGGGG - Intergenic
1122241764 14:100373263-100373285 GGCCATCTAAAGTCCAGCTGGGG - Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1122553125 14:102560863-102560885 TGCCTCCCAGAGGGCAGCTGTGG - Intergenic
1124347375 15:28931559-28931581 TGCTCCATAGGGTCCAGCCGGGG + Intronic
1126040074 15:44581801-44581823 TTCCTCCTACATTCCAGCTGAGG + Intronic
1127279557 15:57477465-57477487 TGTCCGATAGAGTCCATCTGGGG + Intronic
1128344974 15:66847901-66847923 TTCCCCCTCGAGCCCAGGTGGGG + Intergenic
1128364101 15:66984820-66984842 TGGCCCCTAGACCCCAGCTCAGG - Intergenic
1131257261 15:90871205-90871227 GTCCCCCAAGAGTCCGGCTGAGG + Intronic
1132077271 15:98832300-98832322 TGCACCCAAGAGTGTAGCTGGGG - Intronic
1135331835 16:21566957-21566979 TGCCCATTAGCGTCCACCTGGGG - Intergenic
1136246735 16:28980559-28980581 AGCCCCCTAGAGGCCGGGTGCGG + Intronic
1137068661 16:35878265-35878287 TGTCCCCTAGAACCCAGCTTTGG - Intergenic
1138377678 16:56577200-56577222 CGCCCCCTACAGCCCACCTGAGG - Intergenic
1138599676 16:58047090-58047112 TGCCCTCAAGAGTCCAGAAGAGG + Intergenic
1139981807 16:70865261-70865283 TGTCCTCTAAAGTTCAGCTGGGG + Intronic
1141600047 16:85120134-85120156 TGCTGCCAAGAGTCCAGCAGAGG - Intergenic
1141699863 16:85637462-85637484 TGCCCCCTTGATTGCAGCAGTGG + Intronic
1142358683 16:89616103-89616125 TGCTCCCTGAACTCCAGCTGGGG + Intronic
1142915764 17:3135900-3135922 TTCCCTCTACAGGCCAGCTGTGG + Intergenic
1142924311 17:3220356-3220378 TTCCCTCTACAGGCCAGCTGTGG - Intergenic
1143947464 17:10605631-10605653 GGTCCCCTAGAGTACAGCAGAGG - Intergenic
1144658950 17:17056101-17056123 TGGCCCCTAGTGTCCAGGAGCGG + Intronic
1144791254 17:17860615-17860637 TGCCCTCTCTAGCCCAGCTGGGG + Intronic
1146651870 17:34612130-34612152 TGCTGCCTAGAGACCAGCTCAGG + Intronic
1148845613 17:50528145-50528167 TGCCCTCTAGTTTGCAGCTGTGG + Exonic
1149057018 17:52378848-52378870 TGAACCCTAGAATCCAGCTAAGG - Intergenic
1150103388 17:62443532-62443554 TGAGCCCAAGAGTCCAGCCGAGG + Intronic
1150805958 17:68319271-68319293 TATCCCCTAGAGGCCAGCTTTGG + Intronic
1154000437 18:10478084-10478106 TGCACCCTGGAGTTCAGCAGGGG - Intronic
1157867671 18:51199429-51199451 TACCCCCTAGAGGCCAGGCGCGG - Intronic
1160578145 18:79868615-79868637 TGCTTCCAAGCGTCCAGCTGGGG + Intronic
1164767302 19:30781812-30781834 TGGTCCCAGGAGTCCAGCTGTGG + Intergenic
1166695524 19:44849352-44849374 AGCCCCAAAGACTCCAGCTGTGG + Intronic
1166897901 19:46035727-46035749 AGCCCCCAAGACTGCAGCTGTGG - Intergenic
1168279013 19:55294111-55294133 AGCCTCCTGGAGACCAGCTGCGG + Exonic
1168492360 19:56821542-56821564 TGCCCCCTAGAGTCCAGCTGGGG - Intronic
925359641 2:3268352-3268374 TGCCCTCTGGAGTGCAGGTGGGG - Intronic
927808989 2:26171753-26171775 AGCCCCCTGGACTCCAGCTCGGG - Intergenic
929221083 2:39465809-39465831 TGCTCCCCAAAGTCCAGCTGAGG + Intergenic
930754859 2:54963923-54963945 TGTCTCCTGGAGACCAGCTGAGG + Intronic
932520136 2:72403661-72403683 TGCCCACTACAGTCCAGCCTGGG + Intronic
935105689 2:100041212-100041234 TGCTCCCTGAAGTCCAGCTATGG - Intronic
938900820 2:135797267-135797289 GCCCCCATATAGTCCAGCTGAGG - Intronic
939008689 2:136819685-136819707 TGCCCCCCCCAGTCCAGCTGAGG + Intronic
946828180 2:223700693-223700715 TGCCCTGCAGAGCCCAGCTGAGG + Intergenic
948753135 2:240143960-240143982 TGCCCCCTGCTGTCCAGCTCGGG + Intronic
948807036 2:240457495-240457517 TACCCACTAGAGGCCATCTGGGG - Intronic
1169440120 20:5626890-5626912 CTTCCCCTGGAGTCCAGCTGGGG - Intergenic
1170006628 20:11676713-11676735 TGCCCCCTGGAGTCAGGCAGAGG - Intergenic
1170716435 20:18835403-18835425 TGTGCCTTAGAGTCCATCTGTGG + Intergenic
1174721033 20:52812659-52812681 GGCCCCCTAGAGGAGAGCTGGGG + Intergenic
1175199991 20:57270356-57270378 GGCCCCCTGCAGGCCAGCTGGGG + Intergenic
1175215375 20:57389592-57389614 TGCCCCCTAGAGGCCGGGGGAGG - Intergenic
1175624078 20:60475890-60475912 TGGCCCCTAGAATCCTGCAGGGG - Intergenic
1178208953 21:30505791-30505813 TGCCCCCTATAGTACAGGTGAGG - Intergenic
1179627463 21:42656798-42656820 TGTGCCCTGGAGTCCAACTGAGG + Intronic
1183305377 22:37080213-37080235 TGCCCACTTGAGCCCAGCTGAGG - Intronic
1183573454 22:38671604-38671626 TGCCCAGTACAGACCAGCTGAGG + Intronic
950097410 3:10338078-10338100 TGCCCCCCAGGGCCCAGCTCTGG - Intronic
957573971 3:81986068-81986090 TGCCCCCTAGAGTGGAGATTCGG + Intergenic
962793048 3:138828724-138828746 TGCCCACTGGACTCCAGCTTAGG + Intronic
964473893 3:157081893-157081915 TGCCCCCTGGTGGACAGCTGGGG + Intergenic
965442314 3:168729768-168729790 GGCCCCCTTGAGACCTGCTGTGG - Intergenic
966871083 3:184290984-184291006 TGCCCCCAAGAGACGAGCTCTGG + Intronic
970368515 4:15385242-15385264 AGCCCCTTAGAGTCCACTTGAGG + Intronic
972835686 4:42867285-42867307 TGCCCCCATCAGTTCAGCTGAGG + Intergenic
983877828 4:172897285-172897307 GGCCCTCTAGAGACCTGCTGTGG + Intronic
986777101 5:11026151-11026173 GGGCACCTAGAGCCCAGCTGTGG + Intronic
990757146 5:59086215-59086237 TGCCCACTACAGTCAAGCTCTGG + Intronic
991493512 5:67206208-67206230 TGGGACCTAGTGTCCAGCTGAGG + Intergenic
994712353 5:103281132-103281154 GTCCCCCTAGAGTCCAGATGTGG + Intergenic
1001949812 5:175808417-175808439 TGCCCCCTAGAATCAAGCAGAGG + Intronic
1001998161 5:176178687-176178709 TCCTCCCTAGAATCCACCTGTGG + Intergenic
1006671024 6:35729759-35729781 AGCCCCATAGAGTCCACCTTTGG + Intergenic
1007733890 6:43968483-43968505 TACCCCAGAGAGGCCAGCTGAGG + Intergenic
1008561489 6:52729159-52729181 TGACCCATGGAGTCCAGCTGAGG + Intergenic
1011191059 6:84728776-84728798 TACCCCCTAGAGTCTAGTTTAGG - Intronic
1011557952 6:88588738-88588760 TGCCCTCTGGCGTCAAGCTGGGG + Intergenic
1011571823 6:88746246-88746268 TGCTCCCTGTGGTCCAGCTGTGG + Intronic
1013997727 6:116327561-116327583 TAACCCCTGGACTCCAGCTGTGG - Intronic
1016508205 6:144809291-144809313 TTGCCACTAGAGTGCAGCTGAGG + Intronic
1018308020 6:162478712-162478734 TGCCCCATAGAGCCTAGGTGTGG - Intronic
1018936231 6:168275615-168275637 TGCCCCTGTAAGTCCAGCTGAGG - Intergenic
1018972478 6:168538573-168538595 TGCTCCCCAGATTCCAGCAGGGG - Intronic
1018972531 6:168538755-168538777 TGCTCCCCAGATTCCAGCAGGGG - Intronic
1023896451 7:44437500-44437522 TGCCATTTAAAGTCCAGCTGAGG + Intronic
1024253178 7:47521495-47521517 TGCCTCCTGGGCTCCAGCTGAGG + Intronic
1026911800 7:74095348-74095370 TGCCCCCCTGGGTCCTGCTGTGG - Intronic
1029271699 7:99380866-99380888 TGGCCCCAGGACTCCAGCTGAGG - Intronic
1031974880 7:128087281-128087303 AGCCCCCTGGGATCCAGCTGTGG - Intronic
1032389504 7:131546789-131546811 TGCCCCCTAGGGGTGAGCTGAGG + Intronic
1033222930 7:139540536-139540558 TGTCCCCTAGAGTCAAGGTTGGG - Intronic
1033683595 7:143620220-143620242 TGCCCCCTAGTGGTCAGCTGCGG - Intergenic
1033701018 7:143837418-143837440 TGCCCCCTAGTGGTCAGCGGCGG + Intergenic
1034079293 7:148261648-148261670 TGCCCTCTGGAGTGCAGGTGGGG + Intronic
1035744526 8:1952214-1952236 TCCCCTCTAGGGTCCAACTGCGG + Intronic
1035973533 8:4281110-4281132 TGCCACCTAGGGGCCAGCAGAGG - Intronic
1036389178 8:8309901-8309923 TACCCCGCAGAGCCCAGCTGTGG + Intergenic
1039409521 8:37340950-37340972 TCTCTCCTAGAGGCCAGCTGAGG - Intergenic
1044206475 8:89496881-89496903 AGCCCCCAAGAGCCCAGCTATGG + Intergenic
1048981459 8:139705081-139705103 AGCCCCCTCGAGACCACCTGGGG + Intergenic
1049622567 8:143605230-143605252 TGCCCCCTAGAGCTGAGATGAGG + Exonic
1056104331 9:83332050-83332072 TGCCCACCAGAGGCCAGCTGGGG - Intronic
1059819585 9:117957175-117957197 TCCCCACTGAAGTCCAGCTGTGG + Intergenic
1060042050 9:120308407-120308429 AGCCACCTAGAGGCTAGCTGAGG + Intergenic
1060823416 9:126674084-126674106 TCCCCCCTAGAGAGGAGCTGGGG - Intronic
1061953871 9:133951489-133951511 TGCCACATTGGGTCCAGCTGGGG - Intronic
1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG + Intergenic
1062411712 9:136429132-136429154 TGGGCCCCAGAGCCCAGCTGAGG - Exonic
1062449536 9:136609735-136609757 TGTCCCCCAGAGCCCATCTGTGG + Intergenic
1187338671 X:18402345-18402367 TGCCCGCTGGAGTCCTGCTTGGG + Intergenic
1189004783 X:36984365-36984387 TGCCCCCTAGTGCGGAGCTGAGG - Intergenic
1189005039 X:36986105-36986127 TGCCCCCTAGTGCGGAGCTGAGG + Intergenic
1189043983 X:37571837-37571859 TGCCCCCTAGTGCGGAGCTGAGG - Exonic
1198580392 X:138058027-138058049 TGCACTCTAGAGTCCACCAGAGG - Intergenic