ID: 1168492418

View in Genome Browser
Species Human (GRCh38)
Location 19:56821908-56821930
Sequence TGTAGGGCCACTGGTTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168492418_1168492426 -1 Left 1168492418 19:56821908-56821930 CCCATAAAACCAGTGGCCCTACA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1168492426 19:56821930-56821952 AACAACCCAGACCCAGGGCAGGG 0: 1
1: 0
2: 1
3: 25
4: 259
1168492418_1168492422 -7 Left 1168492418 19:56821908-56821930 CCCATAAAACCAGTGGCCCTACA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1168492422 19:56821924-56821946 CCCTACAACAACCCAGACCCAGG 0: 1
1: 0
2: 1
3: 17
4: 187
1168492418_1168492431 6 Left 1168492418 19:56821908-56821930 CCCATAAAACCAGTGGCCCTACA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1168492431 19:56821937-56821959 CAGACCCAGGGCAGGGCCAGGGG 0: 1
1: 3
2: 6
3: 113
4: 948
1168492418_1168492428 4 Left 1168492418 19:56821908-56821930 CCCATAAAACCAGTGGCCCTACA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1168492428 19:56821935-56821957 CCCAGACCCAGGGCAGGGCCAGG 0: 1
1: 1
2: 19
3: 179
4: 1241
1168492418_1168492425 -2 Left 1168492418 19:56821908-56821930 CCCATAAAACCAGTGGCCCTACA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1168492425 19:56821929-56821951 CAACAACCCAGACCCAGGGCAGG 0: 1
1: 0
2: 0
3: 22
4: 246
1168492418_1168492424 -6 Left 1168492418 19:56821908-56821930 CCCATAAAACCAGTGGCCCTACA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1168492424 19:56821925-56821947 CCTACAACAACCCAGACCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 133
1168492418_1168492430 5 Left 1168492418 19:56821908-56821930 CCCATAAAACCAGTGGCCCTACA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1168492430 19:56821936-56821958 CCAGACCCAGGGCAGGGCCAGGG 0: 1
1: 2
2: 32
3: 228
4: 1466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168492418 Original CRISPR TGTAGGGCCACTGGTTTTAT GGG (reversed) Intronic
901904518 1:12396234-12396256 TGTAGGGCCGTTGGTTTTCAAGG + Intronic
902819424 1:18934837-18934859 TGCAGGGCCACTGGTTTGATGGG + Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904074338 1:27829111-27829133 GGGAGGGCCTCTGGTTTTAATGG - Intergenic
905773171 1:40651243-40651265 TATAAGGACACTGGTTATATTGG - Intronic
908941279 1:69437438-69437460 TGAAGACCCACTGGTTGTATAGG - Intergenic
909792194 1:79693502-79693524 TGGAGGCCAAATGGTTTTATGGG - Intergenic
910429416 1:87146595-87146617 TGTAGGGCCAGTGGTAGTATTGG + Intronic
913037790 1:114989227-114989249 TGTAGGGGCAGAGTTTTTATAGG + Intronic
915726398 1:158020941-158020963 TACAGGGCCGCTGGATTTATTGG + Intronic
918997706 1:191783741-191783763 AGTAGGGCCTCTGATCTTATTGG + Intergenic
923400231 1:233609719-233609741 TGTAGAGACAGTGGTTCTATAGG - Intergenic
924488762 1:244513867-244513889 TGTATGGCCACTGGCTGTAGTGG + Intronic
1064963415 10:20991526-20991548 AGTAGAACCTCTGGTTTTATAGG - Intronic
1065609644 10:27459782-27459804 TGTGGGGCCAGTGGTTCTTTTGG + Intergenic
1068237371 10:54255864-54255886 TCTAGGGCAACTGGTGTTCTAGG - Intronic
1078865576 11:15294246-15294268 GGTAGGCCCACTGGTTCTGTTGG + Intergenic
1080624264 11:34014405-34014427 TGTAAACCCACAGGTTTTATAGG - Intergenic
1085782507 11:79422519-79422541 TGCAGGGCCTCTGCTTTTTTTGG - Intronic
1088140318 11:106608017-106608039 TGTAAGGGCACTGGTCCTATGGG - Intergenic
1090897992 11:130996447-130996469 TTTATGGTCACTGGTATTATTGG + Intergenic
1091804387 12:3345615-3345637 GGAGGGGCCACTGGTTTTGTTGG - Intergenic
1094044077 12:26147788-26147810 TGCAGAGCCACAGGTTCTATGGG + Intronic
1098865306 12:75755592-75755614 TATATGGCCAGTTGTTTTATGGG + Intergenic
1100301554 12:93312458-93312480 TGTAAGGTCACTGGTCATATTGG + Intergenic
1103682089 12:122702258-122702280 TGGAGCGCCTCTGGTTTTGTTGG + Exonic
1103683832 12:122715712-122715734 TGGAGCGCCTCTGGTTTTGTTGG + Exonic
1108932124 13:55838147-55838169 TGAAAGGTCACTGGTTCTATTGG + Intergenic
1110069917 13:71161987-71162009 TTTAGGGACAGTGGTTTTAAGGG - Intergenic
1111964260 13:94845464-94845486 TGTAGGGACACTGGTGTGTTAGG + Intergenic
1112900353 13:104350707-104350729 TGTAAGGACACTGGTCATATTGG + Intergenic
1112904186 13:104396974-104396996 GGTCTGGCCACTGCTTTTATTGG - Intergenic
1113415992 13:110129163-110129185 TATAAGGACAGTGGTTTTATTGG - Intergenic
1119646386 14:76351478-76351500 TATAGGGCCACTGGTTGCATTGG + Intronic
1121232867 14:92371248-92371270 TTAAGGCCCACTGTTTTTATTGG - Intronic
1121591233 14:95112314-95112336 TGTTGGGGCAGTGGTTTCATAGG - Intronic
1124400923 15:29346493-29346515 TGTAGAGCCTCTGGTTTACTAGG + Intronic
1126279670 15:46930336-46930358 TGTAGGGCCAGAGGGTATATAGG - Intergenic
1136479229 16:30531463-30531485 TACAGGGTCACTGGTTTTTTAGG + Intronic
1137749938 16:50853617-50853639 TGTACAGCTCCTGGTTTTATGGG + Intergenic
1140779780 16:78284148-78284170 TGTAGGGTCACTGGTTTAAGGGG + Intronic
1141535678 16:84678113-84678135 TGTAAGGACACCGGTTGTATTGG + Intergenic
1155230052 18:23763987-23764009 TGTAGGACAACTGGTTTCACTGG + Intronic
1157436594 18:47675378-47675400 TCTAGTGGCACTGGTTTCATAGG - Intergenic
1162330882 19:10028765-10028787 TGGAGTGGAACTGGTTTTATAGG + Intergenic
1162331673 19:10033651-10033673 TGGAGTGGAACTGGTTTTATAGG + Intergenic
1167804698 19:51772867-51772889 TGTAGGGGCAGTGGGTTTATGGG - Intronic
1168492418 19:56821908-56821930 TGTAGGGCCACTGGTTTTATGGG - Intronic
926421135 2:12700681-12700703 TGTGGGGTCACTGATTTTCTTGG - Intergenic
926627744 2:15107187-15107209 TATAAGGCCACTGGTCCTATTGG - Intergenic
926635268 2:15171777-15171799 TGTAAGGACACCGGTTATATCGG - Intronic
928753447 2:34496482-34496504 TGTAAGGCCACCGGTTCTAATGG - Intergenic
933678701 2:85079757-85079779 TGGAGGGCCTATTGTTTTATTGG + Intergenic
934732515 2:96668553-96668575 TTTAGGGCCTCTTGTTTTCTGGG - Intergenic
937022340 2:118669052-118669074 TTCAGGACCACTGGTGTTATAGG + Intergenic
937064294 2:119005671-119005693 TGTCAGGACACTGGTTTTGTGGG + Intergenic
937514676 2:122639904-122639926 TGTAAGGAGACTGGTTTTACAGG + Intergenic
942092341 2:172505702-172505724 TGTAGTGCCACTGTTGTTTTGGG + Exonic
945388828 2:209238809-209238831 TGTTGGGCCACTGTTTTACTCGG - Intergenic
945969666 2:216223244-216223266 TGCAGGGCTTCTGGTTCTATGGG + Intergenic
948154600 2:235771205-235771227 TGTTGGGCCACTGGGTTCATGGG + Intronic
1169642608 20:7771444-7771466 TGTAGGGCAACTGACATTATAGG - Intergenic
1172768689 20:37364451-37364473 TGTGGGGCCCCTGGTTTATTTGG + Intronic
1174199811 20:48799459-48799481 GGCAGGGCCACAGGGTTTATAGG - Intronic
1176910737 21:14561742-14561764 TTCAAGGACACTGGTTTTATTGG - Intronic
1178626042 21:34219730-34219752 TGCAGAGCCACTTGTTTTCTTGG + Intergenic
1182516017 22:30859530-30859552 GGTAGGGCCAGTGGTTTCAGGGG + Intronic
1182767185 22:32765939-32765961 TGGAGGGCCCCTGGGTTTACAGG - Intronic
954205397 3:49055334-49055356 TATAGGGCCTCTGGTCTTATGGG - Intronic
954322851 3:49843779-49843801 AGTAGGTCCTCAGGTTTTATGGG - Exonic
954880090 3:53829480-53829502 TGTAGGGGCAAAGGTTATATGGG + Intronic
963030647 3:140971641-140971663 TGTAGGGCCTTTGGTGTTCTGGG + Intronic
963448760 3:145449576-145449598 TGTAAGGTCACTAGTGTTATTGG + Intergenic
965641514 3:170833709-170833731 TGTAGGGGCAATGGGTATATAGG - Intronic
968112538 3:196060879-196060901 TGTGGGGGCAGTGGATTTATGGG - Intronic
974541039 4:63236070-63236092 TGTAAGGACACTAGTCTTATTGG + Intergenic
977444287 4:97109746-97109768 CGAAGGGCCTCTGTTTTTATTGG + Intergenic
979469350 4:121075393-121075415 TACAATGCCACTGGTTTTATCGG - Intergenic
979959012 4:126993143-126993165 TGGAGGGCCACTGCATTTCTTGG + Intergenic
979962005 4:127032370-127032392 TGTGGGGCCTCAGTTTTTATGGG + Intergenic
983062032 4:163171818-163171840 TGAAGGCCCACTGTTTTTACTGG - Intergenic
983064781 4:163195594-163195616 TGAAGGCCCACTGTTTTTACCGG + Intergenic
985775700 5:1840695-1840717 TGTGAGGACACTGGTCTTATTGG - Intergenic
987607299 5:20153776-20153798 TATAGGGACACCAGTTTTATTGG + Intronic
987686979 5:21217453-21217475 TGTAGAGCCACTGGTATAAAGGG + Intergenic
990491240 5:56305004-56305026 TGTGGGGACACCGGTTGTATTGG + Intergenic
993078547 5:83267518-83267540 TGTATGCCCAATCGTTTTATGGG - Intronic
995012555 5:107274275-107274297 TGTAGGGACACCAGTTATATTGG - Intergenic
995460440 5:112397926-112397948 TGTGGGGCCACATGTTTTCTAGG - Intronic
1010082715 6:71883057-71883079 TATAAGGGCACTAGTTTTATTGG - Intergenic
1010253621 6:73733658-73733680 TGTAGGGGAACAGGTGTTATTGG + Intronic
1010968079 6:82235206-82235228 TGTAGGGACAGTGTATTTATGGG - Intronic
1012562185 6:100596884-100596906 TGGAGGGCCAGTGGTGATATAGG - Intronic
1015948767 6:138530189-138530211 TGTAGGTGCACTAATTTTATAGG - Intronic
1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG + Intronic
1019326449 7:440758-440780 TGTAGGACCAGTGTTCTTATGGG - Intergenic
1022352520 7:29579335-29579357 TATAAGGCCACTAGTTCTATCGG + Intergenic
1022960366 7:35420044-35420066 TGCAGGGGCACTGATTTTCTGGG - Intergenic
1023188035 7:37551502-37551524 GGGAGGGGAACTGGTTTTATAGG + Intergenic
1023385458 7:39652469-39652491 TGAAGGTCCGTTGGTTTTATTGG + Intronic
1024574800 7:50754905-50754927 TGTAAGGACACCGGTTGTATTGG - Intronic
1031956496 7:127947864-127947886 TTTATGGCCAGTTGTTTTATTGG + Intronic
1035876216 8:3192527-3192549 TAAAGGGCAACTTGTTTTATGGG - Intronic
1038349251 8:26761490-26761512 TATAAGGACACCGGTTTTATTGG - Intronic
1051246563 9:15117798-15117820 TGTAGAGGCAGTGGTGTTATGGG - Intergenic
1054784177 9:69194930-69194952 TGTAGGCTCACTGGCTTTATGGG + Intronic
1057452420 9:95176431-95176453 TGGAGGGCCACAGGCTTTTTGGG + Intronic
1057945709 9:99326267-99326289 TGTTAGGCCACTGGGTTTACAGG - Intergenic
1061765703 9:132879831-132879853 GCTAGGGCCACTGGTTAGATTGG + Intronic
1062684264 9:137802149-137802171 GGCAGGCCCACTGGTTTTGTGGG - Intronic
1185472489 X:392659-392681 TGCAGGGCCGCAGGATTTATAGG - Intergenic
1186321575 X:8432274-8432296 TCTGGGGCCACTGGGTCTATGGG + Intergenic
1189230320 X:39447177-39447199 TGTAAGGACACTGGTCATATTGG + Intergenic
1192497140 X:71623374-71623396 TGTGGGGACACTGCTTTTTTGGG + Intergenic
1195693403 X:107648250-107648272 TCCAGGACCTCTGGTTTTATAGG - Intronic
1196887241 X:120259891-120259913 TTTAATGCCACTGGTCTTATCGG - Exonic
1198620127 X:138498869-138498891 TGTAAGGACACTCGTTATATTGG - Intergenic
1200139917 X:153895058-153895080 TGTAGCGGGGCTGGTTTTATTGG - Intronic
1201788589 Y:17811996-17812018 TGTAGGAGCACTGGGTGTATAGG - Intergenic
1201812964 Y:18093992-18094014 TGTAGGAGCACTGGGTGTATAGG + Intergenic