ID: 1168494563

View in Genome Browser
Species Human (GRCh38)
Location 19:56838618-56838640
Sequence CACCGCGCTCGCTGTGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 32
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168494563_1168494566 10 Left 1168494563 19:56838618-56838640 CCAAAAACACAGCGAGCGCGGTG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1168494566 19:56838651-56838673 ACCCTGTCCTTAAGCATAAATGG 0: 1
1: 0
2: 0
3: 6
4: 112
1168494563_1168494570 18 Left 1168494563 19:56838618-56838640 CCAAAAACACAGCGAGCGCGGTG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1168494570 19:56838659-56838681 CTTAAGCATAAATGGCTCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 46
1168494563_1168494571 27 Left 1168494563 19:56838618-56838640 CCAAAAACACAGCGAGCGCGGTG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 1168494571 19:56838668-56838690 AAATGGCTCCGCGGCCGCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168494563 Original CRISPR CACCGCGCTCGCTGTGTTTT TGG (reversed) Intronic
1063579590 10:7293651-7293673 CACCTCTGTGGCTGTGTTTTTGG - Intronic
1067725778 10:48769714-48769736 CCCAGCGCTCGCTGGGCTTTGGG + Intronic
1084709209 11:70833598-70833620 CACTGTGCTTGCTTTGTTTTTGG - Intronic
1085079092 11:73619285-73619307 CACCACGGTCACTGTGTATTGGG - Intergenic
1111998769 13:95191161-95191183 CACCGTGCTTTCTGTCTTTTGGG - Intronic
1117637120 14:57755190-57755212 CACAGGGCTCGCTGTGTTGGCGG + Intronic
1132884411 16:2176324-2176346 CACCGCGCTGGCTGTGTCCCGGG + Exonic
1142061551 16:88033320-88033342 CACCGGTTCCGCTGTGTTTTGGG + Intronic
1146603955 17:34242216-34242238 CACTGCTTTCTCTGTGTTTTAGG + Intergenic
1148990198 17:51659323-51659345 CACCTCTCTCCCTGTGGTTTGGG + Intronic
1151245887 17:72794336-72794358 CACCGCGCTCGCTGGCTTGGTGG - Intronic
1152897862 17:82923630-82923652 CACCGTGCTGCCTTTGTTTTAGG + Exonic
1162147076 19:8619255-8619277 CACCGCGCCCAATCTGTTTTTGG + Intergenic
1163651247 19:18519430-18519452 CTCCGTGCTCTCTGTGGTTTTGG - Intronic
1168494563 19:56838618-56838640 CACCGCGCTCGCTGTGTTTTTGG - Intronic
930124522 2:47784747-47784769 CACCGCGCCCGGTCTGTTTAGGG + Intronic
938119437 2:128623419-128623441 CACCGAGCTCAGTGTGTCTTTGG + Intergenic
1169261940 20:4145644-4145666 CACCGCGCCCGGCCTGTTTTGGG - Intronic
1171413795 20:24963950-24963972 CACCGCTGTCGCTGAGTTCTAGG + Exonic
1178460046 21:32794753-32794775 CATCGCTCTGGCTGTGTTGTTGG - Intronic
949360306 3:3224784-3224806 CACAGCCCTCCCTGTCTTTTTGG + Intergenic
965809165 3:172574730-172574752 CACCACTGTGGCTGTGTTTTTGG - Intergenic
968066190 3:195761117-195761139 CACCGCGCTCTGTGTGTTACAGG - Exonic
970415659 4:15854464-15854486 CACCACTCTGGCTGTGTATTAGG + Intergenic
970838317 4:20437622-20437644 CACCACGCTCGGCCTGTTTTGGG - Intronic
985884692 5:2668560-2668582 CTGCGCTCTCCCTGTGTTTTGGG - Intergenic
998272469 5:140719142-140719164 CACCGCGCCCGGCCTGTTTTTGG - Intergenic
1016199780 6:141394213-141394235 CACCCTGCTTGCTGTGCTTTTGG + Intergenic
1017163717 6:151390065-151390087 CCCCGAGCGCGCTGTGCTTTCGG - Intronic
1045701353 8:104870311-104870333 CACCAAGCTCATTGTGTTTTTGG - Intronic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1061891301 9:133622036-133622058 CAGAGCCCTCGCTCTGTTTTTGG + Intergenic