ID: 1168495012

View in Genome Browser
Species Human (GRCh38)
Location 19:56840540-56840562
Sequence CCCCGCGCGCCTCCTGCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 2, 2: 3, 3: 35, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168495012_1168495020 23 Left 1168495012 19:56840540-56840562 CCGCGGGCAGGAGGCGCGCGGGG 0: 1
1: 2
2: 3
3: 35
4: 296
Right 1168495020 19:56840586-56840608 CCTCAGTGCTGCGCAGCCTCGGG 0: 1
1: 0
2: 1
3: 29
4: 300
1168495012_1168495018 22 Left 1168495012 19:56840540-56840562 CCGCGGGCAGGAGGCGCGCGGGG 0: 1
1: 2
2: 3
3: 35
4: 296
Right 1168495018 19:56840585-56840607 ACCTCAGTGCTGCGCAGCCTCGG 0: 1
1: 0
2: 2
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168495012 Original CRISPR CCCCGCGCGCCTCCTGCCCG CGG (reversed) Intronic
900102136 1:966448-966470 CCCGGAGCCCCGCCTGCCCGCGG + Intergenic
900210650 1:1454273-1454295 CCCCGTGCGTCTCCTGCTCTAGG + Intronic
900216523 1:1484944-1484966 CCCCGTGCGTCTCCTGCTCTAGG + Intronic
900227655 1:1540492-1540514 CCCCCCGCGCCTCCTCCCCCCGG - Intergenic
900294565 1:1942519-1942541 CTCTGCCCGCCTCCTGCCCAGGG + Intronic
900346800 1:2214066-2214088 CCCCGTGCTCCCCCTGCCCTGGG - Intergenic
900382512 1:2391895-2391917 CCCCGCCGTCCTCCTTCCCGCGG + Exonic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900532400 1:3161045-3161067 CCCCTCCCGGCTCCTGCCTGAGG - Intronic
900666128 1:3816756-3816778 CCCCGCCAGCCTGCTGCCCACGG + Intronic
900786778 1:4654690-4654712 CCCCGCGCGCCTCCTCCGCGCGG + Intergenic
900787080 1:4655777-4655799 CCCGGCGCGCCTCCTCCCCGGGG + Intronic
901066627 1:6497417-6497439 CCCCGCCCGCCTCCCGTGCGAGG - Intronic
901084638 1:6603014-6603036 CCCCGCGCGGCGCCCGCCCCCGG + Intronic
901086732 1:6615195-6615217 TCCCGCGCGCCCCCGGCCCGAGG + Intronic
901150542 1:7098458-7098480 CCCAGGGAGCCTCCTGCCCGAGG + Intronic
901183664 1:7358541-7358563 CCCCGCGCCACCCCTGCCCCGGG + Intronic
901439984 1:9272045-9272067 CCCCGCGCGCCTCCCATCTGAGG - Intergenic
901634516 1:10664350-10664372 CCCTGCGCGCCTTCTGCTCAGGG - Intronic
901641519 1:10695218-10695240 CCCCGCGCGTCCCCGGCCCTGGG + Intronic
901666776 1:10830633-10830655 CCCCCAGCGCCCCCTGCCCCAGG - Intergenic
902514166 1:16980784-16980806 CCCCGGGCGCCTCTACCCCGGGG - Exonic
903986819 1:27234782-27234804 CCCCGCCCGGCGCCTGGCCGGGG - Exonic
904035666 1:27557265-27557287 CCCCCCTCCCCTCCTGCCCTTGG + Intronic
904542059 1:31239799-31239821 TCAGGCGCGCCTCCTGCCCCGGG + Intergenic
905803658 1:40861471-40861493 CCCCGCGCGCGCCCTCCGCGAGG - Exonic
907012668 1:50978051-50978073 CCGCTCCCGCCTCCTGCCCGCGG - Intergenic
907682710 1:56579086-56579108 CCCGGGTCGCCTCCTGGCCGAGG + Exonic
908605532 1:65793207-65793229 AGCCGCCCTCCTCCTGCCCGAGG - Intronic
910065955 1:83151152-83151174 ACCCACACTCCTCCTGCCCGGGG + Intergenic
912486686 1:110034751-110034773 CGCCGCGGGCCTCCTGCCTGGGG + Exonic
913615769 1:120558347-120558369 CCACGCCCGCCCCCTGCCCGAGG - Intergenic
914574506 1:148952555-148952577 CCACGCCCGCCCCCTGCCCGAGG + Intronic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
920260563 1:204685368-204685390 CTCCGCTCGCCTTCCGCCCGGGG + Intronic
920920252 1:210292533-210292555 CCCCGCGCGGCTCCGGCCCGCGG - Intergenic
921189882 1:212699796-212699818 CCGCCCGCGCGCCCTGCCCGTGG + Exonic
922603043 1:226871154-226871176 CCCCGCGCGCCTCCTTCCCGGGG - Intronic
922794804 1:228334749-228334771 CACCGCCCGCCTCCTGGCCCCGG - Intronic
922802308 1:228370105-228370127 CCCCAGGCTTCTCCTGCCCGGGG + Intronic
923630914 1:235649349-235649371 CCCCGCCTGCCTCATGCCGGAGG + Intronic
1065687744 10:28302881-28302903 GCGAGTGCGCCTCCTGCCCGCGG - Intronic
1067113962 10:43420587-43420609 CCGGGCGCGCCTGCTGCGCGGGG + Intergenic
1067227172 10:44383831-44383853 CCCAGCGCGCCTCGAGCCCTTGG - Intronic
1069709258 10:70478623-70478645 GCCCGCGTTCCTCCCGCCCGGGG + Intergenic
1073103466 10:101019074-101019096 TGCCGGGCTCCTCCTGCCCGAGG + Exonic
1073800737 10:107038682-107038704 CCCCCCCCGCCCCCTGCCCAGGG - Intronic
1076991741 11:279311-279333 GCCCGCCCGCCTCCAGCACGGGG + Exonic
1077327347 11:1969442-1969464 CCCCGAGCCCCCCCTGCCCAGGG - Intronic
1077491529 11:2862991-2863013 GCCCTCGCGCCTTCTCCCCGCGG + Intergenic
1078090746 11:8263112-8263134 CCCCGGGCGCGTGCAGCCCGGGG + Intronic
1081938194 11:46918706-46918728 CCGCCGGCGCCTCCTGCGCGGGG + Intergenic
1083366726 11:62145769-62145791 CCCCGCCCACCTCCTCCCTGAGG - Intronic
1083572660 11:63768644-63768666 CCCCGCGCCCCGCCGCCCCGGGG - Exonic
1083616124 11:64027563-64027585 CCCCGCCACCCTCCTGCCCATGG + Intronic
1084128693 11:67118200-67118222 CGCCGGGCGCCTCCGGCCGGCGG + Intergenic
1084174369 11:67415839-67415861 CCCCGGGCGCCCGCTCCCCGCGG + Intronic
1084412093 11:69011149-69011171 CCGCGCACTCCTCCCGCCCGGGG + Intronic
1084617023 11:70243263-70243285 CCCAGCACCCCTCCTGCCTGGGG - Intergenic
1085385009 11:76152573-76152595 CCGCCCGCGCCTCCTCCGCGCGG - Intergenic
1085396067 11:76207787-76207809 CCCCGCCCGCCCGCAGCCCGCGG + Intronic
1085503066 11:77040034-77040056 CCGCGCGCGCCTCGTCCTCGGGG - Exonic
1085517607 11:77120694-77120716 CCCCTCCCGCCTCCTGCAGGTGG + Exonic
1085656049 11:78316064-78316086 CCTCCCGCTCCTCCTGCCCTTGG + Intronic
1087105227 11:94401390-94401412 CGCCGCCCGCCACCAGCCCGCGG + Exonic
1091353586 11:134916618-134916640 CCCCACGCACCTGCTGCCAGTGG + Intergenic
1202810329 11_KI270721v1_random:24622-24644 CCCCGAGCCCCCCCTGCCCAGGG - Intergenic
1091383627 12:78246-78268 CACCGCCCGCCGCCAGCCCGGGG + Intronic
1091718534 12:2795886-2795908 CCCCGCGCCCGGCCTCCCCGGGG - Intronic
1093057213 12:14567545-14567567 CCCCGGGCGCCCCCCGCCCAGGG + Intronic
1095440743 12:42237560-42237582 CCCCTCGCGCCGCCGGCCGGCGG - Intronic
1096522224 12:52190961-52190983 CCCTGCGCCCCTCCTGACTGCGG - Intronic
1102150984 12:110689079-110689101 CCCGGCGCCCCACCCGCCCGCGG + Intronic
1103764650 12:123271621-123271643 CCCGGCGCGCCCGCCGCCCGGGG - Exonic
1103800236 12:123533314-123533336 CATCGCGCGCCTCATGCCCAAGG - Exonic
1103848350 12:123915057-123915079 CCCCTCCCGCCTCCTGTACGTGG + Intronic
1104977738 12:132559860-132559882 CCGCGCCCGCCGCCGGCCCGGGG - Intronic
1105725556 13:23159763-23159785 CCCTGCGCGCCTCCACCCGGCGG - Intergenic
1107078257 13:36346516-36346538 CCACGCGCGCGTCTTGCCAGCGG + Intronic
1108578307 13:51807807-51807829 CCTCGCGCTACTCCTGCCCCAGG - Intergenic
1112494757 13:99895998-99896020 CCCCGCGCTCCTCCTGCCCGCGG - Exonic
1112567614 13:100564814-100564836 GCCCCCCCGCCCCCTGCCCGGGG - Intronic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1113800860 13:113085672-113085694 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1113800878 13:113085729-113085751 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1113800896 13:113085786-113085808 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1113800915 13:113085843-113085865 CCCCTCGCACCTGCTCCCCGGGG - Intronic
1113908279 13:113830393-113830415 CCCTGGGCCCCTCCTCCCCGTGG + Intronic
1113908306 13:113830468-113830490 CCCCGGGCCCCTCCTCCCCGTGG + Intronic
1113908334 13:113830543-113830565 CCCCGGGCCCCTCCTCCCCGTGG + Intronic
1113908362 13:113830618-113830640 CCCCGGGCCCCTCCTCCCCATGG + Intronic
1113908390 13:113830693-113830715 CCCCGGGCCCCTCCTCCCCATGG + Intronic
1113908417 13:113830769-113830791 CCCCGGGCCCCTCCTCCCCATGG + Intronic
1118292631 14:64540468-64540490 CCTCGCGCGCCTCCTGCTGCTGG - Intronic
1119769825 14:77213564-77213586 CCCCGCCCGCTTCCTTCGCGCGG + Intronic
1121116027 14:91343387-91343409 CCCATCTCGCCTCCTGCCCAAGG + Intronic
1121417499 14:93789065-93789087 CCTCTCCCGCCTCCCGCCCGGGG + Intergenic
1121775016 14:96584681-96584703 CCCTGCGCCCCTCCTTCCTGAGG - Intergenic
1122582366 14:102778260-102778282 CACCGGGCGGCTCCTGGCCGCGG + Intronic
1122896694 14:104761091-104761113 CCCCTCGCTCCTTCTGCCTGGGG + Intronic
1122935097 14:104952231-104952253 CCCGGAGGGCCACCTGCCCGAGG - Exonic
1123066170 14:105620457-105620479 GTCCACGCGCCTCCTGCCCCCGG - Intergenic
1123070314 14:105639510-105639532 GTCCACGCGCCTCCTGCCCCCGG - Intergenic
1123089550 14:105736294-105736316 GTCCACGCGCCTCCTGCCCCCGG - Intergenic
1123095338 14:105764454-105764476 GTCCACGCGCCTCCTGCCCCCGG - Intergenic
1124338553 15:28875377-28875399 TCCCCAGCGCCTCCTGCCAGAGG + Intergenic
1126436695 15:48645037-48645059 ACCCGTGCGCCGCCTGCGCGTGG + Intronic
1129854085 15:78811663-78811685 TCCCGAGCGCCCCCTGCCGGCGG + Intronic
1130531063 15:84748368-84748390 CGCCTCCCGCCTCCCGCCCGAGG - Intergenic
1131215198 15:90530242-90530264 CGCCGCGCGGGTCCCGCCCGCGG - Intronic
1131493664 15:92883381-92883403 CCCCGCGTGCCCCCTACCCCAGG - Intronic
1131493678 15:92883418-92883440 CCCCGCCCACCTGCCGCCCGCGG - Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132314422 15:100879775-100879797 CGCCCCACGCCTCCCGCCCGAGG - Exonic
1132398235 15:101489578-101489600 CCCCGCGCCCCCCGCGCCCGCGG + Exonic
1132398267 15:101489642-101489664 CCGCGCGCGCCGCCTGCGCCCGG - Exonic
1132400526 15:101502174-101502196 CCCCAGGCCCCTCCTGCCAGGGG + Intronic
1132631080 16:917774-917796 CCCCGGCCTCCTCCTGACCGTGG + Intronic
1132712701 16:1276568-1276590 CACGGCCCGGCTCCTGCCCGAGG - Intergenic
1132779385 16:1614398-1614420 CCCCGGACGCCCCCTGGCCGAGG - Intronic
1132883110 16:2171001-2171023 CCTCGCCCGCCTCCTTCCTGGGG - Intronic
1133175553 16:4011366-4011388 TCCCGCCCCCCTGCTGCCCGTGG - Intronic
1136539938 16:30923625-30923647 CCCCGCGCTGCTACGGCCCGGGG - Intronic
1137787937 16:51152479-51152501 CCCCGCTCTCCGCCCGCCCGGGG - Intergenic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1138595176 16:58025925-58025947 GAGCGCGCGCCTCCTGCACGGGG - Exonic
1142136840 16:88455443-88455465 CCCGGGGCGCCTCCTCCCCATGG + Intronic
1142188093 16:88704037-88704059 CCCAGGGGGCCTCCTGCGCGAGG + Intronic
1142474617 17:181515-181537 CCCGGCGCGACCCCGGCCCGGGG + Exonic
1142638283 17:1270971-1270993 CCCCGCGCGCGGCCGGGCCGTGG - Exonic
1143446875 17:7014956-7014978 TCCCGCCCGCCCCCCGCCCGGGG - Intronic
1143596252 17:7916018-7916040 CCCCGCGCGCCGCCAGCTCGCGG + Intergenic
1144433155 17:15213671-15213693 CCCTGGGAGCCTCCTGCCCTGGG + Intergenic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146256019 17:31391900-31391922 CTCCGTGCGCCGCCTGCGCGAGG + Exonic
1147608309 17:41786447-41786469 CCCAGCGCGCCCCCTGCCGCCGG + Intronic
1148559141 17:48596177-48596199 CCGCGCGCCCTTCCTTCCCGAGG - Exonic
1148568479 17:48647521-48647543 CACCGAGCGGCTCCTGCCTGGGG + Intergenic
1148750316 17:49941745-49941767 CCCCTCTCCCATCCTGCCCGTGG + Intergenic
1149006849 17:51815103-51815125 CCACCCCCGCCTCCTGCCTGGGG + Intronic
1151491038 17:74432449-74432471 CCCCGCCCGCCCCCCGCCTGGGG + Intronic
1151707694 17:75779381-75779403 CCCCGCGCTCCCCCTCCCGGGGG - Intronic
1152097459 17:78280207-78280229 CCCCTGGCATCTCCTGCCCGGGG - Intergenic
1152477231 17:80526307-80526329 CCCCGTGGCCCTCCTGCCCTGGG + Intergenic
1152539147 17:80966161-80966183 CACCGCGTGCCGCCTGCACGTGG + Exonic
1152745570 17:82037189-82037211 GCCCGAGCGACTCCTGCCCGGGG + Intronic
1153480623 18:5543479-5543501 CCGCGCTCGCCCCCAGCCCGAGG + Intronic
1157529461 18:48409242-48409264 CCCTGCGCGCCTCCCGCACTTGG + Intronic
1159040663 18:63320341-63320363 CCCCGCGCGCCATGTGCCCCCGG - Intergenic
1159480855 18:68989606-68989628 CCCCGCAGGCCCCCTGCCTGAGG - Intronic
1160204752 18:76823028-76823050 CCCCGCGGCCCTCCGGCCCCGGG - Intronic
1160351182 18:78180724-78180746 CCCCGTCCCCCTGCTGCCCGGGG + Intergenic
1160500578 18:79399683-79399705 CCCTGCGCGCCCCCGCCCCGCGG - Intronic
1160631250 18:80247529-80247551 CCCCGCGCTCCTCCCGCGCGCGG - Exonic
1160691086 19:460936-460958 CCCCGCGCCCCCCGAGCCCGAGG - Exonic
1160719063 19:589748-589770 CCCCGCGCGCCGCCTCCGCTCGG - Intergenic
1160763844 19:798339-798361 CGCCGAGCGCTTCCTGCGCGAGG + Intronic
1160873229 19:1286319-1286341 CCCCGGGCGCCCCCCGCGCGCGG - Intronic
1160930742 19:1568418-1568440 CCCCGCGCGCCTGCGCCCTGGGG - Intergenic
1161153383 19:2720912-2720934 CCCTCCGCGCCCCCTCCCCGGGG - Intronic
1161298558 19:3532020-3532042 GCCCGCACACCTCCTGCCGGTGG - Exonic
1161320552 19:3638854-3638876 CCCCGGGCTCCTCCTGCCGCCGG - Intronic
1161531208 19:4791246-4791268 CTCCGGGCGCCCCCTGCCGGTGG + Intergenic
1162426855 19:10602386-10602408 CCCCGCGCGCCTCCTCCAATGGG - Intergenic
1162540643 19:11293943-11293965 CCTCGCGCGTCTCCTGGCGGCGG - Intergenic
1162914190 19:13865488-13865510 CCCGCCGCGCCCCCTGCCCGCGG - Intronic
1164958321 19:32405724-32405746 TCCGGCGCGCCCCCTCCCCGGGG + Intronic
1165246503 19:34500983-34501005 CCCCGTGCGGCTCCAGCCCCGGG + Exonic
1165349514 19:35268487-35268509 CCCAGCGCGCGTCCGCCCCGGGG + Intergenic
1165696674 19:37906427-37906449 ACCCTCGGGCCTCCTGCACGTGG + Intronic
1166147651 19:40848535-40848557 ACCCGCGCGCGTTCTGCCTGGGG - Intronic
1166151792 19:40880400-40880422 ACCCGCGCGCGTTCTGCCTGCGG - Intronic
1166222841 19:41376714-41376736 CCCCGCGCGCAGCGGGCCCGGGG + Exonic
1167587639 19:50384012-50384034 CCCCGCCCGCCTCTCGCCCGGGG - Intergenic
1168159812 19:54502847-54502869 GGCCGGGGGCCTCCTGCCCGTGG - Exonic
1168465047 19:56595207-56595229 CCGCGCGCGCCACCTCCCCCCGG - Intergenic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
925121584 2:1422374-1422396 CCCAGCGCGGCGCCTGCACGAGG - Intronic
925984804 2:9206953-9206975 CCCCGCGCGGCTCCCGCGCCCGG + Exonic
927982065 2:27380542-27380564 CCCGACGCGCCTCCGGCCTGCGG + Exonic
931739365 2:65228055-65228077 CCCCGCGCCCCTTCGCCCCGAGG - Intronic
936038526 2:109130544-109130566 GCCCGCGGGCCTCCTGCCTGCGG + Intronic
936161317 2:110086042-110086064 CCACGCTGACCTCCTGCCCGAGG + Intronic
936183346 2:110285312-110285334 CCACGCTGACCTCCTGCCCGAGG - Intergenic
937284536 2:120741744-120741766 CCCCGAGCGCCCCGGGCCCGCGG + Intronic
937329580 2:121018371-121018393 CCCCTCTCGCCACCTGCCCGCGG + Intergenic
941095915 2:161239083-161239105 CGCCGCGCGCCCACTCCCCGGGG + Intergenic
943342093 2:186693960-186693982 CCCCGCGCGTCACATGCGCGAGG + Exonic
945102526 2:206275015-206275037 CCCGGGGCGCCTTCTTCCCGAGG + Intronic
945235383 2:207627246-207627268 CCCCGGGAGCCTGCTTCCCGCGG + Intergenic
946683271 2:222240118-222240140 CCCCGAGTGCCTGCTGCCCTGGG + Intronic
947743724 2:232496996-232497018 CCCCAGGCGCCTGCTGCCAGGGG - Intergenic
948910195 2:240998879-240998901 CCCCGCGCGCCCCAAGCCCCAGG - Exonic
949032407 2:241803265-241803287 CAGGGCGCGCCTCCTCCCCGCGG + Intronic
949042923 2:241857767-241857789 CCCCTCGAGGCTCCTGCCCCGGG - Intronic
949068936 2:242011761-242011783 CCTCGTGGGCCTCCTGCCCAGGG - Intergenic
1169214713 20:3786484-3786506 CCCGGCGCGCCCCCCGCCCCGGG + Exonic
1171034697 20:21705822-21705844 CACAGCGCGTCTCCAGCCCGCGG + Exonic
1175267108 20:57709666-57709688 CGCCGCGCGCCTCCTGCATGCGG - Exonic
1175742659 20:61430980-61431002 CCCCAGACGCCTCCTTCCCGAGG + Intronic
1176110913 20:63410331-63410353 CCCTGTGCCCCTCCTGCCCTGGG + Intronic
1176122050 20:63458383-63458405 CCCTGCTCCCCTCCTGCCCTCGG + Intronic
1178518272 21:33266524-33266546 CCAAGCGCGCCCCCTCCCCGCGG - Intronic
1178610349 21:34073893-34073915 CCACGCGCGCCCCCTTCCCGCGG - Intronic
1179175469 21:39005044-39005066 CCCCGCCCGCTTCCTGCTCAAGG - Intergenic
1179375452 21:40846738-40846760 CGCCGCTCGGCACCTGCCCGGGG + Exonic
1179411761 21:41168092-41168114 TCCCGCGAGCCTCCTCCCCTGGG + Exonic
1179626921 21:42654029-42654051 CCCCACGCGCCGGCTCCCCGGGG + Intronic
1181026967 22:20132146-20132168 CCCCGCCCGCCCACTGCCCGGGG - Intronic
1181028821 22:20140383-20140405 CCCTGCGCACATCCTGCCTGTGG + Intronic
1181039136 22:20183767-20183789 CCCAGCGGGCTTCCTGCCTGGGG + Intergenic
1182296848 22:29315138-29315160 CCCCGAGCGCCACCGGCCCACGG - Exonic
1183299399 22:37051615-37051637 CCCCGCGCTGCTCCCGCCCCCGG - Intergenic
1183546151 22:38455628-38455650 CCCCGCTCGCCCTCTGCCCGCGG + Intergenic
1184654492 22:45934285-45934307 CCCCCCTCTCCTCCTGCCCCAGG - Intronic
1185010248 22:48308957-48308979 CCCAGCACGCCTCATGCCTGAGG + Intergenic
1185018245 22:48358181-48358203 CTCTGTGCACCTCCTGCCCGAGG - Intergenic
1185190662 22:49433912-49433934 CCCTGCTAGCCTCCTGGCCGTGG + Intronic
1185281470 22:49971767-49971789 CCCCTCCCTCCTCCTGCCCCAGG - Intergenic
950650175 3:14402334-14402356 CCCTGGGCGCCTCCTGCCTGCGG - Intergenic
952241354 3:31533418-31533440 CCCCGCTCGCGTCCTGGCTGAGG + Intronic
952241367 3:31533461-31533483 CCGGGCGCGCCCCCTGCCCGTGG + Intronic
953183231 3:40615701-40615723 CCCCGCGCGCCTGCTGCAGGGGG + Intergenic
954327179 3:49869936-49869958 CCCAGCCCGCCCCCGGCCCGGGG - Exonic
954397345 3:50299701-50299723 TCCCGCCGGCCTCCTGCCCCAGG + Intergenic
956468636 3:69542622-69542644 CCCCGCCCGCCGCCTCTCCGGGG + Intergenic
958641827 3:96814742-96814764 CCCGGGGCGCCCCCTGCGCGAGG - Exonic
961365166 3:126394996-126395018 CCCCGCGCGCCCCCTCTCCCCGG - Intronic
962809756 3:138950082-138950104 CCACCGGCGCCTCCTGACCGTGG + Intronic
964041758 3:152269245-152269267 CCCTCAGCACCTCCTGCCCGGGG + Intronic
965590381 3:170356863-170356885 CCCGCGGGGCCTCCTGCCCGAGG - Intergenic
966866192 3:184260304-184260326 TCCCGCGCAGCTACTGCCCGTGG + Intronic
967930301 3:194686145-194686167 CCCCGCGGGACTGCTGCGCGGGG + Intergenic
967945238 3:194798914-194798936 CCCCAGGTGCCTCCTACCCGGGG - Intergenic
968081552 3:195849852-195849874 CTGCGCGCGCCCCCTGCCGGCGG - Intergenic
968104257 3:195990070-195990092 GTCCCCGCGCCCCCTGCCCGGGG - Intergenic
968235917 3:197029899-197029921 CCCGGCGCGCCCCCTGCTGGAGG + Intergenic
968302558 3:197627660-197627682 GTCCCCGCGCCCCCTGCCCGGGG - Intergenic
968384648 4:125194-125216 CCCTGTGCGCCTCCTCCGCGTGG + Exonic
968393662 4:213347-213369 CCCTGTGCGCCTCCTCCTCGTGG + Intergenic
968401796 4:304753-304775 CCCTGTGCGCCTCCTCCGCGTGG - Intronic
968405873 4:338527-338549 CCCTGTGCGCCTCCTCCGCGTGG + Intronic
968410640 4:386847-386869 CCCTGTGCGCCTCCTCCGCGTGG + Intergenic
968419644 4:473429-473451 CCCTGTGCGCCTCCTCCGCGTGG - Intronic
968611851 4:1560819-1560841 CCCCTCTGGCCTCCAGCCCGTGG - Intergenic
968652953 4:1767300-1767322 CCCCGCGCCCCTCCCGGCCTGGG + Intergenic
969368653 4:6716413-6716435 CGCCGCCTGCCTGCTGCCCGGGG + Exonic
969379008 4:6782491-6782513 CCCCTCGCGCCGTCAGCCCGCGG + Intronic
969756479 4:9153382-9153404 CCCCGCCGGCCACCTGCCAGGGG - Intergenic
971019105 4:22516193-22516215 GAGCGCGCGCCTCCTCCCCGAGG - Intergenic
971207484 4:24584331-24584353 CCCCGCACGCTTCTTGCCAGAGG + Exonic
972250258 4:37292575-37292597 CCCAGCTCACCTCCTGCCCCAGG + Intronic
973551262 4:52038184-52038206 TCCCCCGCTCCTCCAGCCCGCGG + Intronic
982465428 4:155724146-155724168 CCCAGCTCCCCTCCTGCCCCTGG + Intronic
985778716 5:1858561-1858583 CCCCGCGCCCCTCCTGGCCCAGG - Intergenic
985794340 5:1950609-1950631 CCGCCCTGGCCTCCTGCCCGGGG + Intergenic
986055134 5:4129287-4129309 CCCTGAGCCCCTGCTGCCCGTGG + Intergenic
986730650 5:10632570-10632592 CCTCTCCCTCCTCCTGCCCGGGG + Intronic
986737604 5:10679728-10679750 CCCAGCGCCCCTCCTCCCTGAGG - Exonic
990509900 5:56480944-56480966 CCCAGCGCGGCTCCCGGCCGAGG + Intronic
996909156 5:128635614-128635636 CCTCTCGCTCCTCCTGCCCTTGG - Intronic
997521765 5:134527677-134527699 GCCGGCGCGCCTCCAGCCTGCGG + Intronic
998018843 5:138753376-138753398 CCCGGCCCGCCCCCCGCCCGCGG - Intronic
998095447 5:139393570-139393592 CCCCGCCGGCCTTCTTCCCGTGG - Exonic
998166768 5:139848654-139848676 GCCCGCGCGCCTCTCGCCCGTGG - Exonic
999174041 5:149619088-149619110 CCCTGCAAGCCTCCTGCCAGGGG - Intronic
1001401934 5:171451066-171451088 CGCCGGCCGCCTCCCGCCCGCGG + Intronic
1002073831 5:176696537-176696559 CCCCGCCCACCACCTGCCCAGGG - Intergenic
1002524473 5:179807383-179807405 CCCTGCGCGCCTCCGTCCAGAGG - Intronic
1004722173 6:18277319-18277341 CCCCGCTCCCCTCCGCCCCGCGG - Intergenic
1005999731 6:30955651-30955673 CCCCGGCAGCCTCCTGCCCTCGG - Intergenic
1006634563 6:35452617-35452639 CCCCGCCCGCCTCCTGCTGCAGG + Exonic
1006860834 6:37170665-37170687 CACCCCCCGCCTCCGGCCCGGGG + Intronic
1007553592 6:42747619-42747641 CCCCGCGCCCCGCCTGCGCGGGG - Intronic
1008685599 6:53922892-53922914 CCCCGCGCGCCATCTTCCCGTGG + Exonic
1009940350 6:70282356-70282378 CGCCTCCCGCCTCCTGCGCGAGG - Intronic
1010030251 6:71266046-71266068 CCCCGCCCCCCTCCTGGACGCGG + Intergenic
1013225756 6:108118516-108118538 CCCCCTGCGCCCCCTGCCCACGG - Intronic
1014437487 6:121437078-121437100 CCCCGCGCCCGTCCGGCCCACGG - Intronic
1018400303 6:163414553-163414575 CCCCGCCCGCCGCCCGCCCCCGG + Intronic
1018613281 6:165662841-165662863 CGCCGCGCCCCTCCCGCCCGCGG - Intronic
1019381617 7:727107-727129 GCCCGCGCGCCGCCCGCCCGAGG + Exonic
1019492841 7:1323171-1323193 CTCCACGCGCCTCCCACCCGGGG + Intergenic
1019530388 7:1500135-1500157 CGCTGCTCGCCTCCTGCCAGGGG + Intronic
1019533000 7:1512969-1512991 GCCCGTGCGCCACCTGCACGGGG + Intergenic
1020130495 7:5556329-5556351 CCCCTCCCGCCCCCGGCCCGCGG + Intronic
1021653584 7:22854117-22854139 CCTCGCGCGCCCCCTGTCGGCGG - Intergenic
1022207651 7:28179917-28179939 CCCCCCGCTCCACCTCCCCGCGG + Intronic
1022286275 7:28958010-28958032 CGCCTTGCGCCTCCTGCTCGTGG - Exonic
1022923262 7:35037189-35037211 CCCGGCGCGCCGCCCGCCGGGGG - Intronic
1026228052 7:68459923-68459945 CCCAGTGCGGCTCCTGCCCCGGG - Intergenic
1027278152 7:76583621-76583643 ACCCACACTCCTCCTGCCCGGGG - Intergenic
1028796351 7:94907927-94907949 CCCCAGGCGCTCCCTGCCCGCGG - Intronic
1029441088 7:100586901-100586923 CCCCGCCCGCCCCCAGCCCGGGG - Intronic
1030714316 7:112790425-112790447 CGCGGCGCGCCTCCTTCCCGAGG + Exonic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1032306057 7:130733561-130733583 CCAAGCGCGCCTGCTGCCCCGGG - Exonic
1033657033 7:143381438-143381460 CGCCCCGCGCCCCCTCCCCGTGG - Intronic
1034618059 7:152436005-152436027 CCCCGCCCGGCCCCTGCGCGCGG - Exonic
1034781732 7:153887742-153887764 CCCAGCGCGCGCCCTGTCCGTGG - Intronic
1035127170 7:156616843-156616865 CCGCGCCCCGCTCCTGCCCGCGG + Intergenic
1035167426 7:157000024-157000046 CCGGGCCCGCCTCCTCCCCGAGG + Intronic
1035263233 7:157674824-157674846 CGCCGAGCTCCTCCTGCCGGGGG + Intronic
1036195160 8:6708073-6708095 CCGCGCGCACGTCCGGCCCGAGG + Intergenic
1036789485 8:11708626-11708648 CGCCGCGCTTCTCCTTCCCGGGG + Exonic
1037390511 8:18387236-18387258 CCCCGCGCTCCTCCCGCTGGCGG + Intergenic
1039964189 8:42271753-42271775 GCCTGCCCGCCTTCTGCCCGAGG - Intronic
1045259529 8:100559834-100559856 CCCGGCGCGCCCCCTGCAGGTGG + Intergenic
1049357201 8:142194843-142194865 TCCCGTGCGGCTCCTGCCCCTGG - Intergenic
1049401317 8:142428763-142428785 CCCCCCGCCCGTCCTGCCAGTGG + Intergenic
1049565187 8:143334567-143334589 ACCGGCCCGCCTCCTGCCCGGGG - Intronic
1049620761 8:143597465-143597487 CCCCCCGGGCCCCCGGCCCGTGG - Exonic
1049697287 8:143990446-143990468 CCCTGTGCGCCCCCGGCCCGCGG + Intronic
1049715257 8:144086742-144086764 CCCCGTGCCCCGCCTGCCCCTGG - Intergenic
1049803196 8:144527548-144527570 GCCGGCGCGCCTGCTGCCCCTGG - Exonic
1049804601 8:144533190-144533212 CCCCGAGCGCCAGCTGCCCTGGG - Exonic
1052022124 9:23537793-23537815 CCCCTCGGGCCTCCTGTTCGGGG + Intergenic
1053435205 9:38069395-38069417 CCCCGCCCCCCTCGCGCCCGGGG + Intergenic
1054781948 9:69174034-69174056 TCACGCGCGACTCCTGGCCGGGG - Intronic
1056773892 9:89497920-89497942 TGCAGCGCGCGTCCTGCCCGCGG + Intronic
1057801148 9:98192235-98192257 CCGCCCACCCCTCCTGCCCGCGG - Intronic
1060182828 9:121545912-121545934 CTCTGCTCGCCTCCTGCCAGGGG - Intergenic
1060276829 9:122188847-122188869 CCCTGTGTGCCTCCTGTCCGGGG + Intronic
1060849261 9:126860884-126860906 CCGCGCCGGCCGCCTGCCCGCGG - Intronic
1061179302 9:129014373-129014395 CCCCGCTGGCCTCCTGGCCCAGG - Intronic
1061517192 9:131096719-131096741 CCCCGCCCGCTTCCCGCGCGCGG - Intronic
1061754331 9:132802308-132802330 CCCCTCCCGCCCCCTGCCCTGGG - Intronic
1061955066 9:133957019-133957041 CCCAGCTCCCCACCTGCCCGGGG + Intronic
1062230426 9:135479356-135479378 CCCCGCACGCTCCCTTCCCGCGG + Intronic
1062341563 9:136095723-136095745 CCCGGCGCGCGCCCTGCCCGCGG + Intergenic
1062539307 9:137034574-137034596 CCCCGGGGGCCCCCTGCCAGAGG - Intronic
1062597634 9:137306309-137306331 CCCCAGGCCCCTGCTGCCCGAGG + Intergenic
1185467667 X:364221-364243 CCCAGCGCGCCTCCGGCCCCAGG + Intronic
1189310651 X:40015040-40015062 CCCCGCGCTCCTCGTCGCCGCGG + Intergenic
1190008085 X:46759040-46759062 CCCCCCGCGCCTCCTCCGAGCGG + Exonic
1198343103 X:135733817-135733839 CCTCCCACTCCTCCTGCCCGAGG - Intergenic
1198344886 X:135749478-135749500 CCTCCCACTCCTCCTGCCCGAGG + Intergenic