ID: 1168500562

View in Genome Browser
Species Human (GRCh38)
Location 19:56889442-56889464
Sequence ATCCATCAGCAAATCCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168500559_1168500562 7 Left 1168500559 19:56889412-56889434 CCATTTTTGATTCACAGCTCTGC No data
Right 1168500562 19:56889442-56889464 ATCCATCAGCAAATCCTGGTTGG No data
1168500558_1168500562 14 Left 1168500558 19:56889405-56889427 CCTAAGGCCATTTTTGATTCACA No data
Right 1168500562 19:56889442-56889464 ATCCATCAGCAAATCCTGGTTGG No data
1168500557_1168500562 27 Left 1168500557 19:56889392-56889414 CCAGCTGCTCAGACCTAAGGCCA No data
Right 1168500562 19:56889442-56889464 ATCCATCAGCAAATCCTGGTTGG No data
1168500556_1168500562 28 Left 1168500556 19:56889391-56889413 CCCAGCTGCTCAGACCTAAGGCC No data
Right 1168500562 19:56889442-56889464 ATCCATCAGCAAATCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168500562 Original CRISPR ATCCATCAGCAAATCCTGGT TGG Intergenic
No off target data available for this crispr