ID: 1168505131 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:56927723-56927745 |
| Sequence | CTGAAGACCAGGAATGATGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1168505128_1168505131 | 26 | Left | 1168505128 | 19:56927674-56927696 | CCAGATTTTCCTTTGATAAATCT | No data | ||
| Right | 1168505131 | 19:56927723-56927745 | CTGAAGACCAGGAATGATGAAGG | No data | ||||
| 1168505129_1168505131 | 17 | Left | 1168505129 | 19:56927683-56927705 | CCTTTGATAAATCTACTCAGACT | No data | ||
| Right | 1168505131 | 19:56927723-56927745 | CTGAAGACCAGGAATGATGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1168505131 | Original CRISPR | CTGAAGACCAGGAATGATGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||