ID: 1168505131

View in Genome Browser
Species Human (GRCh38)
Location 19:56927723-56927745
Sequence CTGAAGACCAGGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168505128_1168505131 26 Left 1168505128 19:56927674-56927696 CCAGATTTTCCTTTGATAAATCT No data
Right 1168505131 19:56927723-56927745 CTGAAGACCAGGAATGATGAAGG No data
1168505129_1168505131 17 Left 1168505129 19:56927683-56927705 CCTTTGATAAATCTACTCAGACT No data
Right 1168505131 19:56927723-56927745 CTGAAGACCAGGAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168505131 Original CRISPR CTGAAGACCAGGAATGATGA AGG Intergenic
No off target data available for this crispr