ID: 1168510835

View in Genome Browser
Species Human (GRCh38)
Location 19:56972391-56972413
Sequence TGGGCTTCACTCTAGCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168510831_1168510835 19 Left 1168510831 19:56972349-56972371 CCTTCGTGAGTGAGAAGGCGAGA No data
Right 1168510835 19:56972391-56972413 TGGGCTTCACTCTAGCATGTGGG No data
1168510828_1168510835 25 Left 1168510828 19:56972343-56972365 CCATTCCCTTCGTGAGTGAGAAG No data
Right 1168510835 19:56972391-56972413 TGGGCTTCACTCTAGCATGTGGG No data
1168510830_1168510835 20 Left 1168510830 19:56972348-56972370 CCCTTCGTGAGTGAGAAGGCGAG No data
Right 1168510835 19:56972391-56972413 TGGGCTTCACTCTAGCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168510835 Original CRISPR TGGGCTTCACTCTAGCATGT GGG Intergenic
No off target data available for this crispr