ID: 1168514548

View in Genome Browser
Species Human (GRCh38)
Location 19:57000714-57000736
Sequence CTATGTGGCCAAAAGAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168514540_1168514548 8 Left 1168514540 19:57000683-57000705 CCGCTCCTTCCCCAACAGAGGTT No data
Right 1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG No data
1168514538_1168514548 13 Left 1168514538 19:57000678-57000700 CCACACCGCTCCTTCCCCAACAG No data
Right 1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG No data
1168514542_1168514548 -1 Left 1168514542 19:57000692-57000714 CCCCAACAGAGGTTTCCTGCTGC No data
Right 1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG No data
1168514544_1168514548 -3 Left 1168514544 19:57000694-57000716 CCAACAGAGGTTTCCTGCTGCTA No data
Right 1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG No data
1168514541_1168514548 3 Left 1168514541 19:57000688-57000710 CCTTCCCCAACAGAGGTTTCCTG No data
Right 1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG No data
1168514543_1168514548 -2 Left 1168514543 19:57000693-57000715 CCCAACAGAGGTTTCCTGCTGCT No data
Right 1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168514548 Original CRISPR CTATGTGGCCAAAAGAGAGT GGG Intergenic
No off target data available for this crispr