ID: 1168515594

View in Genome Browser
Species Human (GRCh38)
Location 19:57008159-57008181
Sequence TCCAATCCCTGCACTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168515591_1168515594 8 Left 1168515591 19:57008128-57008150 CCTTTAAATACTGGGCACAGTGT No data
Right 1168515594 19:57008159-57008181 TCCAATCCCTGCACTTTAGGAGG No data
1168515588_1168515594 19 Left 1168515588 19:57008117-57008139 CCACAAACATACCTTTAAATACT No data
Right 1168515594 19:57008159-57008181 TCCAATCCCTGCACTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168515594 Original CRISPR TCCAATCCCTGCACTTTAGG AGG Intergenic
No off target data available for this crispr