ID: 1168516958

View in Genome Browser
Species Human (GRCh38)
Location 19:57016859-57016881
Sequence AGTGATATGAAAATTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168516956_1168516958 3 Left 1168516956 19:57016833-57016855 CCGTTGAGGATGAGGAGGATGGA No data
Right 1168516958 19:57016859-57016881 AGTGATATGAAAATTGTGGATGG No data
1168516951_1168516958 20 Left 1168516951 19:57016816-57016838 CCAGAGTGACTTGGATGCCGTTG No data
Right 1168516958 19:57016859-57016881 AGTGATATGAAAATTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168516958 Original CRISPR AGTGATATGAAAATTGTGGA TGG Intergenic
No off target data available for this crispr