ID: 1168516958 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:57016859-57016881 |
Sequence | AGTGATATGAAAATTGTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1168516956_1168516958 | 3 | Left | 1168516956 | 19:57016833-57016855 | CCGTTGAGGATGAGGAGGATGGA | No data | ||
Right | 1168516958 | 19:57016859-57016881 | AGTGATATGAAAATTGTGGATGG | No data | ||||
1168516951_1168516958 | 20 | Left | 1168516951 | 19:57016816-57016838 | CCAGAGTGACTTGGATGCCGTTG | No data | ||
Right | 1168516958 | 19:57016859-57016881 | AGTGATATGAAAATTGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1168516958 | Original CRISPR | AGTGATATGAAAATTGTGGA TGG | Intergenic | ||
No off target data available for this crispr |