ID: 1168517618

View in Genome Browser
Species Human (GRCh38)
Location 19:57021494-57021516
Sequence AGGAACCCCAAGAAGAGCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168517618_1168517621 11 Left 1168517618 19:57021494-57021516 CCGTAGCTCTTCTTGGGGTTCCT No data
Right 1168517621 19:57021528-57021550 TAAAACTCGACTCCCCTACAAGG No data
1168517618_1168517624 24 Left 1168517618 19:57021494-57021516 CCGTAGCTCTTCTTGGGGTTCCT No data
Right 1168517624 19:57021541-57021563 CCCTACAAGGACCAAAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168517618 Original CRISPR AGGAACCCCAAGAAGAGCTA CGG (reversed) Intergenic
No off target data available for this crispr