ID: 1168523253

View in Genome Browser
Species Human (GRCh38)
Location 19:57069183-57069205
Sequence CCTCCCATGGAGAAGGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168523253_1168523262 -10 Left 1168523253 19:57069183-57069205 CCGCTCCCCTTCTCCATGGGAGG No data
Right 1168523262 19:57069196-57069218 CCATGGGAGGAAAAGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168523253 Original CRISPR CCTCCCATGGAGAAGGGGAG CGG (reversed) Intergenic
No off target data available for this crispr