ID: 1168524229

View in Genome Browser
Species Human (GRCh38)
Location 19:57075959-57075981
Sequence GGAAACTGCATCGAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168524229_1168524236 23 Left 1168524229 19:57075959-57075981 CCCATCTCCTCGATGCAGTTTCC No data
Right 1168524236 19:57076005-57076027 GCATCCCAGACCCCCAGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168524229 Original CRISPR GGAAACTGCATCGAGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr