ID: 1168524567

View in Genome Browser
Species Human (GRCh38)
Location 19:57078685-57078707
Sequence CCACCTTGGTAGCAGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168524563_1168524567 -9 Left 1168524563 19:57078671-57078693 CCTGAACCAGGTGACCACCTTGG No data
Right 1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG No data
1168524560_1168524567 -3 Left 1168524560 19:57078665-57078687 CCCCTACCTGAACCAGGTGACCA No data
Right 1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG No data
1168524561_1168524567 -4 Left 1168524561 19:57078666-57078688 CCCTACCTGAACCAGGTGACCAC No data
Right 1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG No data
1168524558_1168524567 20 Left 1168524558 19:57078642-57078664 CCAGGAATTGACATTTCGACAAG No data
Right 1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG No data
1168524562_1168524567 -5 Left 1168524562 19:57078667-57078689 CCTACCTGAACCAGGTGACCACC No data
Right 1168524567 19:57078685-57078707 CCACCTTGGTAGCAGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168524567 Original CRISPR CCACCTTGGTAGCAGACCCC AGG Intergenic
No off target data available for this crispr