ID: 1168529310

View in Genome Browser
Species Human (GRCh38)
Location 19:57114999-57115021
Sequence ATCATCTTGCTCGTCTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168529310_1168529314 -4 Left 1168529310 19:57114999-57115021 CCAAAAAAGACGAGCAAGATGAT No data
Right 1168529314 19:57115018-57115040 TGATCCAAAGGACAGCGGGCTGG No data
1168529310_1168529317 21 Left 1168529310 19:57114999-57115021 CCAAAAAAGACGAGCAAGATGAT No data
Right 1168529317 19:57115043-57115065 ACCACATCTTCTAAAGCCCAAGG No data
1168529310_1168529313 -8 Left 1168529310 19:57114999-57115021 CCAAAAAAGACGAGCAAGATGAT No data
Right 1168529313 19:57115014-57115036 AAGATGATCCAAAGGACAGCGGG No data
1168529310_1168529312 -9 Left 1168529310 19:57114999-57115021 CCAAAAAAGACGAGCAAGATGAT No data
Right 1168529312 19:57115013-57115035 CAAGATGATCCAAAGGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168529310 Original CRISPR ATCATCTTGCTCGTCTTTTT TGG (reversed) Intergenic
No off target data available for this crispr