ID: 1168530758

View in Genome Browser
Species Human (GRCh38)
Location 19:57127063-57127085
Sequence CACCTGGGTATCCCCAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3225
Summary {0: 1, 1: 1, 2: 49, 3: 644, 4: 2530}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168530748_1168530758 29 Left 1168530748 19:57127011-57127033 CCTCTTCTGCAGGTCTGCTGCAG 0: 98
1: 281
2: 834
3: 786
4: 4657
Right 1168530758 19:57127063-57127085 CACCTGGGTATCCCCAGCGGAGG 0: 1
1: 1
2: 49
3: 644
4: 2530
1168530747_1168530758 30 Left 1168530747 19:57127010-57127032 CCCTCTTCTGCAGGTCTGCTGCA 0: 104
1: 277
2: 844
3: 793
4: 5968
Right 1168530758 19:57127063-57127085 CACCTGGGTATCCCCAGCGGAGG 0: 1
1: 1
2: 49
3: 644
4: 2530
1168530751_1168530758 -6 Left 1168530751 19:57127046-57127068 CCACTCCAGACCCTTTTCACCTG 0: 6
1: 52
2: 257
3: 3698
4: 2731
Right 1168530758 19:57127063-57127085 CACCTGGGTATCCCCAGCGGAGG 0: 1
1: 1
2: 49
3: 644
4: 2530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168530758 Original CRISPR CACCTGGGTATCCCCAGCGG AGG Intronic
Too many off-targets to display for this crispr