ID: 1168535171

View in Genome Browser
Species Human (GRCh38)
Location 19:57163078-57163100
Sequence TGGAAGTTAGATATCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168535171_1168535173 -6 Left 1168535171 19:57163078-57163100 CCTGCCATGATATCTAACTTCCA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 1168535173 19:57163095-57163117 CTTCCATCTGACCCCCAACCCGG 0: 1
1: 0
2: 0
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168535171 Original CRISPR TGGAAGTTAGATATCATGGC AGG (reversed) Intronic
902723360 1:18319236-18319258 TGGAATGTAGATGTAATGGCTGG - Intronic
902924551 1:19687609-19687631 TGGAATTCAGATGTGATGGCTGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904873938 1:33639118-33639140 TGGAACTCAGACATGATGGCTGG + Intronic
905478434 1:38245066-38245088 GGGAAGTGAGATGTCAGGGCTGG + Intergenic
905748316 1:40438511-40438533 TTGAAGTTAGCTACCATCGCAGG + Intergenic
906808685 1:48804625-48804647 TAGAAGGGAGATATCATGGTGGG + Intronic
908925785 1:69252993-69253015 TGGAAGTTAGATTTCAAAGGAGG + Intergenic
910927768 1:92413737-92413759 TGGAACATGGATATGATGGCTGG + Intergenic
912281325 1:108317561-108317583 TGAAACTTAGATGTCATTGCTGG - Intergenic
913228841 1:116724225-116724247 TGGAATTCAGACATGATGGCTGG + Intergenic
915593203 1:156882143-156882165 TGGAAGTTAGATGTACTGGTAGG + Intergenic
922592436 1:226787454-226787476 TAGAAGTTAAATACCCTGGCTGG - Intergenic
1065177326 10:23091603-23091625 TGGAAATTAGTCATGATGGCTGG - Intergenic
1067968410 10:50941227-50941249 TGGCAATTAGATATCATCTCTGG + Intergenic
1069678365 10:70265976-70265998 TAGAAGACAGATATCATTGCTGG - Intronic
1069696726 10:70391941-70391963 AGGAAGTTAGATATCTGAGCTGG + Intergenic
1070785240 10:79158742-79158764 GGGAAGGTAGATATGATGGGGGG + Intronic
1071293773 10:84204783-84204805 TGGCTGTTGGATATCATGACAGG - Intronic
1074844952 10:117389482-117389504 TGGAATTCAGATGTGATGGCTGG + Intergenic
1075005826 10:118829503-118829525 TGGAATGTAGATGTGATGGCTGG + Intergenic
1075679809 10:124323938-124323960 TGGAAGTTACACAGCAGGGCTGG + Intergenic
1079049707 11:17143385-17143407 TGGAAGTTAGATTTCAGGTTGGG - Intronic
1079838584 11:25366230-25366252 TGGTATTTATATACCATGGCTGG - Intergenic
1080264340 11:30385883-30385905 TAGAAGTTAGCTGGCATGGCAGG - Intronic
1080840232 11:35977217-35977239 TGGAATTCAGATGACATGGCTGG - Intronic
1081235020 11:40636709-40636731 TGGAAATAAGATCTCATGACTGG + Intronic
1083714338 11:64567195-64567217 TGGAAGATGGGAATCATGGCAGG - Intronic
1085159891 11:74330833-74330855 TGGAAATTATATATAATGCCTGG - Exonic
1085709936 11:78820101-78820123 TGGAAACTAGATAGCATAGCTGG + Intronic
1086076649 11:82861624-82861646 TGGAAATTAGATCTAAAGGCTGG - Intronic
1092622478 12:10287449-10287471 TTGAAGTTAGGTTTCATGGGAGG - Intergenic
1093983511 12:25501285-25501307 TGAAAGTTCGATCTCATGGCTGG - Intronic
1095748323 12:45683958-45683980 TGGAATGTAGATGTGATGGCTGG + Intergenic
1098774769 12:74598924-74598946 TTCAAGATAGATATCATGACTGG + Intergenic
1099480697 12:83162433-83162455 TGAAATGTAGATATCATAGCAGG - Intergenic
1101210276 12:102528626-102528648 TGGAAGGTGGATGTGATGGCTGG + Intergenic
1101228466 12:102713779-102713801 TGGTATTTACATATCATGGTGGG + Intergenic
1102405586 12:112671400-112671422 TGGAATGTAGATGTGATGGCAGG - Intronic
1102633925 12:114305959-114305981 TGGAACTCAGACATAATGGCAGG - Intergenic
1102925717 12:116824568-116824590 TGGAACTTGGATGTGATGGCTGG - Intronic
1104423518 12:128656408-128656430 GGGAATATAGATATAATGGCTGG - Intronic
1105384508 13:19917290-19917312 TAGAAGTTAGCTATCACGGCCGG + Intergenic
1105957379 13:25296810-25296832 TGGAACTTAGACACAATGGCTGG - Intergenic
1106293314 13:28386345-28386367 TTGAAGTAGTATATCATGGCAGG + Intronic
1108837256 13:54567016-54567038 TAGGAGTCAGATATGATGGCTGG + Intergenic
1112027481 13:95424750-95424772 TAGAAGTTAGATATTCTGGATGG + Intergenic
1116118374 14:40688480-40688502 TAGAAGTTAGAGATCAAGGGAGG + Intergenic
1116248502 14:42451564-42451586 GGGGAGTTAGATATCATGTAAGG - Intergenic
1116462997 14:45199413-45199435 TGGAAGTCTGAGATCATGGCTGG + Intronic
1118886884 14:69874857-69874879 TGGAAAATAGATATGATGGCTGG + Intronic
1118947788 14:70404086-70404108 TGGATGTTAGCTACCATGCCTGG - Intronic
1120317582 14:82915736-82915758 TTGAAGTTAGATAGCCTGGTGGG - Intergenic
1123497747 15:20846006-20846028 TGGAAGTTTGATATTAAGGATGG + Intronic
1123554978 15:21419637-21419659 TGGAAGTTTGATATTAAGGATGG + Intronic
1123591223 15:21856965-21856987 TGGAAGTTTGATATTAAGGATGG + Intergenic
1125983800 15:44029243-44029265 TGTAAGTTAAATATGGTGGCAGG - Intronic
1127521791 15:59750242-59750264 TGGAAGGGAGATAGCATGTCAGG - Intergenic
1127784805 15:62346356-62346378 TGGAACATAGATGTGATGGCTGG - Intergenic
1128105540 15:65041959-65041981 TGGAACTTGGATATAATGGCAGG + Intergenic
1129622167 15:77157809-77157831 TGGTAGTTAGATACTATTGCAGG - Intronic
1202963323 15_KI270727v1_random:146843-146865 TGGAAGTTTGATATTAAGGATGG + Intergenic
1134679762 16:16116252-16116274 TGAAATATAGATATAATGGCTGG - Intronic
1135719643 16:24804635-24804657 TGGAAGGGAGAAATCATTGCAGG - Intronic
1137259373 16:46811611-46811633 TGTAAGTTAGATCTAAGGGCTGG - Intronic
1137484838 16:48882325-48882347 TGGAAGTCAGATAGCTGGGCAGG - Intergenic
1137934293 16:52619277-52619299 TGGAAGTCAGATGTGATGGCAGG + Intergenic
1138346489 16:56323503-56323525 TGGAACTTGGATGTGATGGCTGG - Intronic
1139614167 16:68079093-68079115 CAGAAGTTAGATGTCCTGGCAGG + Exonic
1140252764 16:73308956-73308978 AGGAAGTTAGATCCCATGACAGG + Intergenic
1140301714 16:73764401-73764423 TGGACGTTAGAGAGCCTGGCAGG - Intergenic
1141204917 16:81926127-81926149 TGGAAGCTAGGCAGCATGGCAGG + Intronic
1141803390 16:86325646-86325668 TGGGATGTAGATATGATGGCTGG + Intergenic
1142017762 16:87760175-87760197 TGAAAGTCAGATTTCATGTCAGG - Intronic
1142436289 16:90060346-90060368 TGGAAGAAAGAGCTCATGGCAGG - Exonic
1143424030 17:6818722-6818744 TGGAATGTAGACATAATGGCTGG + Intronic
1146456521 17:33013698-33013720 TGGCAGTGAGATGTGATGGCAGG + Exonic
1150180171 17:63111014-63111036 ATTAAGTAAGATATCATGGCCGG + Intronic
1154165177 18:12009300-12009322 GGGAAGTCAGATACCAGGGCAGG + Intronic
1154455754 18:14522427-14522449 TGGAAGTTTGATATTAAGGATGG + Intronic
1157329983 18:46696601-46696623 TGTAAGTTGGATATAACGGCTGG + Intronic
1157340114 18:46770919-46770941 TGGAATGTGGACATCATGGCAGG - Intergenic
1158391276 18:57047138-57047160 TGGAATTTAGATCTGATGGTAGG - Intergenic
1159824177 18:73185953-73185975 TGGAATTTAGATAGCCTTGCAGG - Intronic
1159880323 18:73852890-73852912 TGGAATTTAGCTATCAGGGGAGG - Intergenic
1160089850 18:75816557-75816579 TGGAAGTCTGAGATCAAGGCAGG + Intergenic
1160583441 18:79900344-79900366 TGGAGGTTAGAGGTCAGGGCTGG - Intergenic
1162580402 19:11526371-11526393 TGGCAGTTAGGTATAAAGGCTGG - Intronic
1163347677 19:16754145-16754167 TGGAAGATAGAGATGATGGACGG - Intronic
1163347697 19:16754292-16754314 TGGAAGATAGACATGATGGGTGG - Intronic
1163347710 19:16754376-16754398 TGGAAGATAGAGATGATGGGTGG - Intronic
1163347733 19:16754500-16754522 TGGAAGATAGAGATGATGGATGG - Intronic
1163417667 19:17196171-17196193 TGGAAGATAGAGATGATGGAAGG + Intronic
1165483758 19:36082794-36082816 TGGAACTCAGATATGATAGCAGG - Intronic
1168535171 19:57163078-57163100 TGGAAGTTAGATATCATGGCAGG - Intronic
925323036 2:2991686-2991708 TGAAAGATAGGTATAATGGCTGG - Intergenic
927639281 2:24836567-24836589 TGGAAGTGAGATATCAGACCTGG - Intronic
927906418 2:26861743-26861765 CAGGAGTTAGAGATCATGGCCGG - Intronic
929434235 2:41915220-41915242 TGGAAGGTGAATATGATGGCTGG + Intergenic
930440724 2:51402174-51402196 TGGAAGTGAGCTACCATGCCCGG - Intergenic
931164870 2:59735293-59735315 TGGAAATTAGATATGGTGTCAGG - Intergenic
933109023 2:78373719-78373741 TTGAAGGAAGATATCAGGGCAGG + Intergenic
933152890 2:78935959-78935981 TGGAAGGTAGACATAATGGCTGG + Intergenic
933800575 2:85957204-85957226 TGGGAGTCTGATATCATAGCTGG + Intergenic
935132724 2:100273041-100273063 TGGAAGTTAAATCTAATGACTGG + Intergenic
937262961 2:120598112-120598134 TGGAATGTAGAAAGCATGGCTGG + Intergenic
938059549 2:128241493-128241515 TGGAACATACATATGATGGCTGG - Intronic
938749310 2:134313662-134313684 TTCAAGTTACATATCTTGGCAGG + Intronic
944207896 2:197176056-197176078 TGGAATTTGGATGTGATGGCTGG + Intronic
944298000 2:198089516-198089538 TGGAATGCAGATATTATGGCTGG - Intronic
944523431 2:200594550-200594572 TGGAATTCAGATATGAGGGCTGG - Intronic
944677326 2:202044574-202044596 TGTTAGTTAGATATCATGGAGGG + Intergenic
945197765 2:207253204-207253226 TGGCAGTGTGATGTCATGGCAGG - Intergenic
946537759 2:220649778-220649800 TAGATGTTAGATATCATGTTTGG - Intergenic
948303130 2:236923924-236923946 TGTAAATTAGATATGAAGGCAGG + Intergenic
1170526529 20:17243749-17243771 TTGAAGTGATGTATCATGGCAGG - Intronic
1173060759 20:39658509-39658531 TGGAAGGAAGAGATCATGTCAGG + Intergenic
1173618337 20:44417466-44417488 TGGATGTTAGGTCTCAGGGCTGG - Intronic
1173748971 20:45461308-45461330 TGGAAGTTGAGAATCATGGCAGG + Intergenic
1176818412 21:13630912-13630934 TGGAAGTTTGATATTAAGGATGG - Intronic
1177534493 21:22406298-22406320 TGGAAGTTAGAGAACAAGGCCGG - Intergenic
1178006916 21:28232239-28232261 TGGAAGTTATATATTATGGAAGG + Intergenic
1178377593 21:32080392-32080414 TGGAATGTAGACATCAAGGCTGG - Intergenic
1183340654 22:37279056-37279078 TGGAATTTAGACATGATAGCTGG + Intergenic
1184372411 22:44090815-44090837 TGGAAGTTCCATGTCCTGGCTGG - Intronic
950164908 3:10789334-10789356 TGAAAGTTAGAAAACATGACTGG + Intergenic
950550029 3:13660671-13660693 TAGAACTTAGATGTGATGGCTGG - Intergenic
950918178 3:16666389-16666411 TGGAATTTAGAAAGCATGGACGG + Intronic
952832841 3:37579393-37579415 TGGAATTTGGATGTGATGGCTGG - Intronic
953337716 3:42107969-42107991 TGGAATTCAGACATGATGGCTGG - Intronic
953739011 3:45520543-45520565 GGGAAGTTAGATGACATGTCTGG + Intronic
954589843 3:51774066-51774088 TGGAATGTAGACATGATGGCTGG + Intergenic
958254276 3:91307278-91307300 TGGAAGGAAGGTTTCATGGCTGG + Intergenic
959861722 3:111223884-111223906 TGGAATGTATATATAATGGCTGG + Intronic
959870692 3:111324071-111324093 TGAAAATTAGCTATCATGACAGG - Intronic
966003659 3:174981863-174981885 TGGAAATTAGATCTGATGGCTGG - Intronic
967114099 3:186321068-186321090 TGGAATTTAGAAATCAGTGCAGG - Intronic
969982864 4:11176820-11176842 TGGAAGTGAGCTAGCAAGGCTGG - Intergenic
970381565 4:15513219-15513241 GGGAAGTTAGCTGTCATGTCAGG - Intronic
971830116 4:31681336-31681358 TGGAAGTTATATATGAGGTCAGG + Intergenic
972015283 4:34235628-34235650 TGGAAGTTTGAGAACAAGGCAGG + Intergenic
973026103 4:45273720-45273742 TGAAAATTAGATTTCATGGAAGG + Intergenic
973147042 4:46840162-46840184 TGGAAGGTAGACATGATGACTGG - Intronic
974238935 4:59218277-59218299 TGGAAGTTAGATACGTTTGCAGG - Intergenic
982639324 4:157937318-157937340 TGGAAATTAGTTATCAAGCCAGG + Intergenic
982641233 4:157964238-157964260 TGGAACATAGATGTGATGGCTGG - Intergenic
984157652 4:176211196-176211218 TGGAATTTAGATGTCATTCCAGG + Intergenic
986774018 5:10997120-10997142 TGGTAGGTAGGTATCACGGCAGG + Intronic
987864751 5:23524500-23524522 TGGAAGAAAGAGCTCATGGCAGG + Exonic
990458033 5:56006762-56006784 TGTGTGTTAGATGTCATGGCAGG + Intergenic
991222477 5:64232869-64232891 TGGAAGTTAGATATTTTGTCTGG + Intronic
991962272 5:72057061-72057083 TGGAAGGTAGTTATGGTGGCTGG - Intergenic
992987717 5:82250719-82250741 TGGAACTTAGATTTCAGTGCAGG - Intronic
994383948 5:99105705-99105727 TGGAAATTAGATAACAAGGAAGG + Intergenic
996601828 5:125273315-125273337 TGGAAGTTAGATATTATCTTTGG - Intergenic
997774461 5:136588390-136588412 TGGAAAATAGATAACAAGGCTGG + Intergenic
999316342 5:150586425-150586447 TGGGGGTTAGGTATCAGGGCGGG - Intergenic
1001085570 5:168697917-168697939 TGGCAGTGAGATATGGTGGCTGG + Intronic
1001486570 5:172123786-172123808 TGGAATTCAGATGTGATGGCTGG + Intronic
1001585134 5:172828839-172828861 TGTAACTTAGATCTCATAGCAGG - Intergenic
1004930593 6:20459386-20459408 TGGTAGTTAGTTTTCATAGCTGG - Intronic
1007072380 6:39047280-39047302 TGGAATTTGGATATCGTGGCTGG + Intergenic
1007556329 6:42769504-42769526 TGGAAGTTAGTTACCATATCTGG + Intronic
1007665804 6:43512363-43512385 AAGAAGCTAGATATGATGGCTGG - Intronic
1008066749 6:47058291-47058313 TGGAAGTTACACATCATCTCTGG - Intergenic
1008700815 6:54097291-54097313 TGGAATTTGGATGTGATGGCTGG - Intronic
1008938378 6:57017989-57018011 TAAAAGTTAGAGAACATGGCTGG + Intronic
1008938537 6:57019795-57019817 TAAAAGTTAGAGAACATGGCTGG + Intronic
1009335212 6:62479712-62479734 TGAAAGCTAGATATCATGATTGG - Intergenic
1010190578 6:73191778-73191800 AGTAAATTAGATGTCATGGCAGG + Intronic
1012837008 6:104281664-104281686 TGGAGGTCAGAAATGATGGCAGG + Intergenic
1012884355 6:104827988-104828010 TGTAAGTTAGATTACATGGCAGG - Intronic
1016147891 6:140698782-140698804 TGGAAAATAGACATCATGACAGG - Intergenic
1017213168 6:151879470-151879492 TGGAAGTTAGAGAGCATGTGGGG + Intronic
1020404382 7:7815603-7815625 TGGAAAATAGATATGATGGCTGG - Intronic
1020557119 7:9684168-9684190 TTGGAGTTTGATATGATGGCTGG + Intergenic
1021061852 7:16122630-16122652 TGGAAATAAGTCATCATGGCAGG + Intronic
1021514064 7:21463630-21463652 AGGAAGTTAAATATCGTGGTTGG + Intronic
1022034054 7:26517363-26517385 TGGGTGTTAGCTATCATGCCTGG + Intergenic
1024128346 7:46323732-46323754 TGGAAGGTGGATGTGATGGCTGG + Intergenic
1026130124 7:67613386-67613408 TGGAACCTAGATATGGTGGCTGG - Intergenic
1028354034 7:89884968-89884990 TGCTACTTAGATATTATGGCAGG + Intergenic
1028694742 7:93695796-93695818 TGGATCTTAGATATGATGGGTGG + Intronic
1030323918 7:108199824-108199846 TGGGATGTAGACATCATGGCGGG + Intronic
1033267285 7:139897274-139897296 TGGGAGTGAGAGATCATGGAGGG + Intronic
1033305333 7:140221264-140221286 TAGAAGTCAGATGTGATGGCTGG + Intergenic
1036275637 8:7349132-7349154 TGGAAGTGAGATTTCCTGGAAGG + Intergenic
1036921548 8:12860246-12860268 GGCAAGTTAGAAATCATGGAAGG - Intergenic
1037757097 8:21717931-21717953 TAGAAATTGGATCTCATGGCTGG - Intronic
1039346910 8:36714791-36714813 TGGAAGTTAGTTCTAAAGGCTGG - Intergenic
1040407662 8:47122380-47122402 TGGAAGTTTGATATTAAGGATGG + Intergenic
1040441183 8:47444286-47444308 CTGGAGTTAGATTTCATGGCAGG - Intronic
1041326043 8:56665649-56665671 TGCAAATTAGAAATTATGGCAGG - Intergenic
1044555053 8:93553927-93553949 TAGAAGTTGGGGATCATGGCTGG - Intergenic
1046654899 8:116882676-116882698 TGGAATATAGATAAAATGGCTGG + Intergenic
1051113896 9:13672742-13672764 TGGAAGTTCAAAATCACGGCGGG + Intergenic
1055750900 9:79503782-79503804 TGGAATATAGATATGAGGGCTGG - Intergenic
1056106873 9:83355591-83355613 TGGAAGGTAGACATGATGGCTGG - Intronic
1056797209 9:89666770-89666792 TGGAGTTTAGGAATCATGGCTGG + Intergenic
1059530543 9:115031508-115031530 TCAAAGTTAGATCTCAAGGCTGG + Intronic
1059821085 9:117972969-117972991 TAGAAGTTAGAAAACCTGGCCGG + Intergenic
1060559632 9:124532228-124532250 TAGAAGTTAGAGATCCTGGATGG - Intronic
1203528947 Un_GL000213v1:118595-118617 TGGAAGTTTGATATTAAGGATGG + Intergenic
1186132172 X:6479581-6479603 GGGAAGCTAGATATCAAGGCTGG - Intergenic
1186907077 X:14122449-14122471 TGGAATTTAGATCTAATAGCTGG + Intergenic
1187932420 X:24305532-24305554 TAGAAGTCAGATAAAATGGCTGG - Intergenic
1189370232 X:40422185-40422207 TGGAATGTAGATGTGATGGCTGG + Intergenic
1192834253 X:74782434-74782456 TGGAAGTTTGAAATCATGGCAGG - Intronic
1193390357 X:80919866-80919888 AGGAAGCTTAATATCATGGCAGG - Intergenic
1194602849 X:95944523-95944545 TGGAACATAAATATGATGGCAGG - Intergenic
1197403341 X:126021225-126021247 TTGAAGTCAGATAGCATGACTGG - Intergenic
1197737994 X:129866888-129866910 GGTAAGGTAGATAGCATGGCTGG - Intergenic