ID: 1168535718

View in Genome Browser
Species Human (GRCh38)
Location 19:57167733-57167755
Sequence TCTGTGTATGTGAGTTGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168535718_1168535722 11 Left 1168535718 19:57167733-57167755 CCATGCCAACTCACATACACAGA No data
Right 1168535722 19:57167767-57167789 TGGCTCCCCCAACCCCCTTGTGG No data
1168535718_1168535720 -9 Left 1168535718 19:57167733-57167755 CCATGCCAACTCACATACACAGA No data
Right 1168535720 19:57167747-57167769 ATACACAGAGTCATGCTCCTTGG No data
1168535718_1168535723 12 Left 1168535718 19:57167733-57167755 CCATGCCAACTCACATACACAGA No data
Right 1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168535718 Original CRISPR TCTGTGTATGTGAGTTGGCA TGG (reversed) Intergenic
No off target data available for this crispr