ID: 1168535723

View in Genome Browser
Species Human (GRCh38)
Location 19:57167768-57167790
Sequence GGCTCCCCCAACCCCCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168535718_1168535723 12 Left 1168535718 19:57167733-57167755 CCATGCCAACTCACATACACAGA No data
Right 1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG No data
1168535719_1168535723 7 Left 1168535719 19:57167738-57167760 CCAACTCACATACACAGAGTCAT No data
Right 1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG No data
1168535717_1168535723 13 Left 1168535717 19:57167732-57167754 CCCATGCCAACTCACATACACAG No data
Right 1168535723 19:57167768-57167790 GGCTCCCCCAACCCCCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168535723 Original CRISPR GGCTCCCCCAACCCCCTTGT GGG Intergenic
No off target data available for this crispr