ID: 1168536423

View in Genome Browser
Species Human (GRCh38)
Location 19:57174101-57174123
Sequence CACCTGAGGTGGGCCCGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168536423_1168536436 17 Left 1168536423 19:57174101-57174123 CCACGCCGGGCCCACCTCAGGTG No data
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
1168536423_1168536428 -8 Left 1168536423 19:57174101-57174123 CCACGCCGGGCCCACCTCAGGTG No data
Right 1168536428 19:57174116-57174138 CTCAGGTGATCCACCCCCCTCGG 0: 161
1: 22333
2: 53342
3: 74828
4: 80038

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168536423 Original CRISPR CACCTGAGGTGGGCCCGGCG TGG (reversed) Intergenic
No off target data available for this crispr