ID: 1168536428

View in Genome Browser
Species Human (GRCh38)
Location 19:57174116-57174138
Sequence CTCAGGTGATCCACCCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230702
Summary {0: 161, 1: 22333, 2: 53342, 3: 74828, 4: 80038}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168536418_1168536428 22 Left 1168536418 19:57174071-57174093 CCAAAGTGTTGAGATTACAGGCG 0: 573
1: 17025
2: 163250
3: 290777
4: 207689
Right 1168536428 19:57174116-57174138 CTCAGGTGATCCACCCCCCTCGG 0: 161
1: 22333
2: 53342
3: 74828
4: 80038
1168536421_1168536428 -5 Left 1168536421 19:57174098-57174120 CCACCACGCCGGGCCCACCTCAG No data
Right 1168536428 19:57174116-57174138 CTCAGGTGATCCACCCCCCTCGG 0: 161
1: 22333
2: 53342
3: 74828
4: 80038
1168536415_1168536428 26 Left 1168536415 19:57174067-57174089 CCTCCCAAAGTGTTGAGATTACA 0: 1567
1: 40252
2: 334710
3: 252993
4: 131305
Right 1168536428 19:57174116-57174138 CTCAGGTGATCCACCCCCCTCGG 0: 161
1: 22333
2: 53342
3: 74828
4: 80038
1168536417_1168536428 23 Left 1168536417 19:57174070-57174092 CCCAAAGTGTTGAGATTACAGGC 0: 1153
1: 30907
2: 260548
3: 271928
4: 166408
Right 1168536428 19:57174116-57174138 CTCAGGTGATCCACCCCCCTCGG 0: 161
1: 22333
2: 53342
3: 74828
4: 80038
1168536423_1168536428 -8 Left 1168536423 19:57174101-57174123 CCACGCCGGGCCCACCTCAGGTG No data
Right 1168536428 19:57174116-57174138 CTCAGGTGATCCACCCCCCTCGG 0: 161
1: 22333
2: 53342
3: 74828
4: 80038

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168536428 Original CRISPR CTCAGGTGATCCACCCCCCT CGG Intergenic
Too many off-targets to display for this crispr