ID: 1168536436

View in Genome Browser
Species Human (GRCh38)
Location 19:57174141-57174163
Sequence TCCCAAAGTGTTGAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 749265
Summary {0: 1587, 1: 40620, 2: 330951, 3: 247333, 4: 128774}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168536423_1168536436 17 Left 1168536423 19:57174101-57174123 CCACGCCGGGCCCACCTCAGGTG No data
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
1168536426_1168536436 6 Left 1168536426 19:57174112-57174134 CCACCTCAGGTGATCCACCCCCC No data
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
1168536424_1168536436 12 Left 1168536424 19:57174106-57174128 CCGGGCCCACCTCAGGTGATCCA No data
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
1168536425_1168536436 7 Left 1168536425 19:57174111-57174133 CCCACCTCAGGTGATCCACCCCC 0: 46
1: 3986
2: 9334
3: 12060
4: 11586
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
1168536421_1168536436 20 Left 1168536421 19:57174098-57174120 CCACCACGCCGGGCCCACCTCAG No data
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
1168536429_1168536436 -8 Left 1168536429 19:57174126-57174148 CCACCCCCCTCGGCCTCCCAAAG 0: 563
1: 70563
2: 167025
3: 181980
4: 130672
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774
1168536427_1168536436 3 Left 1168536427 19:57174115-57174137 CCTCAGGTGATCCACCCCCCTCG 0: 94
1: 12228
2: 47458
3: 81893
4: 94782
Right 1168536436 19:57174141-57174163 TCCCAAAGTGTTGAGATTACAGG 0: 1587
1: 40620
2: 330951
3: 247333
4: 128774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168536436 Original CRISPR TCCCAAAGTGTTGAGATTAC AGG Intergenic
Too many off-targets to display for this crispr