ID: 1168536819

View in Genome Browser
Species Human (GRCh38)
Location 19:57177729-57177751
Sequence CTACCTCAGTGGCCTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168536819_1168536828 9 Left 1168536819 19:57177729-57177751 CCCCTCCCAGGCCACTGAGGTAG 0: 1
1: 0
2: 1
3: 26
4: 335
Right 1168536828 19:57177761-57177783 CTCAGCTTACCTATTTGTGAGGG 0: 1
1: 1
2: 0
3: 19
4: 148
1168536819_1168536827 8 Left 1168536819 19:57177729-57177751 CCCCTCCCAGGCCACTGAGGTAG 0: 1
1: 0
2: 1
3: 26
4: 335
Right 1168536827 19:57177760-57177782 GCTCAGCTTACCTATTTGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168536819 Original CRISPR CTACCTCAGTGGCCTGGGAG GGG (reversed) Intergenic
900155867 1:1203070-1203092 CTCCCTCAGCTGCCGGGGAGTGG - Intergenic
900487672 1:2931154-2931176 CTCCCACACAGGCCTGGGAGGGG + Intergenic
900614594 1:3559588-3559610 CAAACCCAGTGGCTTGGGAGTGG + Intronic
900879535 1:5370768-5370790 CTGAGTCAGTGGACTGGGAGAGG + Intergenic
901206573 1:7500971-7500993 CTACCTCAGTCCCCTGGGGATGG - Intronic
901493846 1:9610315-9610337 CTCCCTCAGGTGCCTGGTAGAGG + Intronic
902121960 1:14173830-14173852 CCACCTCAGGGACTTGGGAGTGG + Intergenic
902918428 1:19652501-19652523 CCTCCCCAGTGGGCTGGGAGTGG + Intronic
905449822 1:38048718-38048740 CTACCTCCCAGGCCTGGGAAAGG - Intergenic
905519844 1:38589294-38589316 CTCCCCCAGGGCCCTGGGAGTGG + Intergenic
906493941 1:46289955-46289977 CATCCTCAGTGGGCTGGTAGGGG + Intronic
907489634 1:54800761-54800783 CGACCTCATGGGCCTGGCAGAGG - Exonic
909412741 1:75373936-75373958 CTCCCTCAGTGTTCTGAGAGTGG - Intronic
909692549 1:78425021-78425043 GAAACTGAGTGGCCTGGGAGAGG + Intronic
910937300 1:92494873-92494895 CCATCTCAGAGGCCTGGGATAGG - Intergenic
913320075 1:117581906-117581928 CAAGCTCAGTGGCCTTGGGGAGG + Intergenic
918940043 1:190981899-190981921 TTCAGTCAGTGGCCTGGGAGAGG - Intergenic
919639728 1:200036333-200036355 CTAGCTCAGTGACCTTGGACGGG - Intronic
920373252 1:205492761-205492783 CTATCTGAGTGGCCAGGCAGTGG - Intergenic
922200123 1:223394029-223394051 CTTCCTCAGTTCCCTCGGAGCGG + Exonic
922615455 1:226958578-226958600 CTAGCCCAGAGCCCTGGGAGAGG + Intronic
922860492 1:228811894-228811916 ATGCCTCAGTGCCCTGGCAGAGG + Intergenic
923243711 1:232110715-232110737 CTGACTCAGTGGCCTGGCATGGG + Intergenic
923416985 1:233772408-233772430 TTGACTCAGTGGACTGGGAGAGG - Intergenic
923536412 1:234855507-234855529 CTATCTCAGAGGACTGGGAGAGG + Intergenic
923800011 1:237199584-237199606 CTGAGTCAGTGGACTGGGAGAGG - Intronic
924952372 1:248896850-248896872 CGGCCTCCCTGGCCTGGGAGCGG - Intergenic
1064177902 10:13091173-13091195 TTGCTTCAGTGGACTGGGAGAGG - Intronic
1065941969 10:30573097-30573119 CTACCTCAGCGGATTGTGAGAGG - Intergenic
1069577549 10:69541584-69541606 CTTCCTCAGTGTCCTAGCAGAGG + Intergenic
1069623546 10:69852753-69852775 AGACCCCAGTGGGCTGGGAGGGG + Intronic
1069624460 10:69859379-69859401 ACCCCTCAGAGGCCTGGGAGGGG - Intronic
1071281308 10:84106521-84106543 TTAAGTCAGTGGACTGGGAGAGG - Intergenic
1071456046 10:85852423-85852445 CCACCTCAGGTGCCTGAGAGAGG - Intronic
1071785676 10:88897161-88897183 ATCCATAAGTGGCCTGGGAGGGG - Intronic
1073299462 10:102461999-102462021 ACTCCTCAGTGGCTTGGGAGGGG + Intronic
1073585263 10:104704003-104704025 CTACTTCAGTGGCCTTTGGGTGG + Intronic
1074078810 10:110151860-110151882 CTCCAGCTGTGGCCTGGGAGGGG + Intergenic
1076160795 10:128242939-128242961 CTCCCTCCCTGGCCTGAGAGTGG + Intergenic
1076491776 10:130866664-130866686 CTACAGCCGTGCCCTGGGAGGGG - Intergenic
1077275529 11:1705521-1705543 CTGTCTCACTGGGCTGGGAGAGG - Intergenic
1077332068 11:1988185-1988207 CTCCCGCAAAGGCCTGGGAGTGG + Intergenic
1077340618 11:2024790-2024812 CTCCCGCAGGGCCCTGGGAGGGG - Intergenic
1077363452 11:2151485-2151507 CTGCCTCTTAGGCCTGGGAGAGG + Intronic
1077438130 11:2554517-2554539 CCTCCTCAGTGCCCTGAGAGGGG + Intronic
1077852255 11:6084860-6084882 CTGTCTCAGTGCCCTGAGAGTGG + Intergenic
1078717222 11:13851697-13851719 CTACCTCACAGGCTTGGGTGGGG - Intergenic
1080436459 11:32249432-32249454 GTACCTCAGTGACCTGGTAAGGG + Intergenic
1081567622 11:44269757-44269779 CTTTATCAGTGGCCTGGGATGGG + Intronic
1083712706 11:64559013-64559035 CTACCTCTGTGACCTGGCACTGG + Intronic
1083891025 11:65595808-65595830 CCACCTCAGGCACCTGGGAGGGG + Exonic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084456379 11:69270266-69270288 CTAACTCAGAGGCCTGGGACAGG - Intergenic
1084557410 11:69883311-69883333 ATGCCTCAGCGGCCTGGTAGAGG - Intergenic
1084774038 11:71363947-71363969 CCAGCTCAGTGGCTTGGGGGAGG + Intergenic
1085231029 11:74970756-74970778 CAGCTTCAGTGGCCTGGTAGAGG - Intronic
1088743327 11:112784727-112784749 CGACCTCAGAGCCCTGGGATGGG + Intergenic
1089094726 11:115910152-115910174 CTGCCTCAGTTGTCTGGAAGGGG + Intergenic
1089095275 11:115915062-115915084 CTTCCTCAGTGACCTGCCAGTGG - Intergenic
1089641996 11:119853826-119853848 CTGCCTCTGTGGCCTGTGAGTGG + Intergenic
1090069622 11:123532275-123532297 CTACCGCAGTGGTCAGGGTGGGG + Intronic
1202815049 11_KI270721v1_random:43361-43383 CTCCCGCAAAGGCCTGGGAGTGG + Intergenic
1202823603 11_KI270721v1_random:79979-80001 CTCCCGCAGGGCCCTGGGAGGGG - Intergenic
1092138545 12:6166975-6166997 CTGCCTCAGTGGCCAGCGTGGGG - Intergenic
1092944904 12:13443642-13443664 CCTTCACAGTGGCCTGGGAGGGG + Intergenic
1093124185 12:15308013-15308035 CTAACTCAGTGTCCTTGCAGGGG + Intronic
1097801474 12:63919163-63919185 CCACCTCAGTCTCCTGGGACTGG + Intronic
1098307228 12:69114426-69114448 TTGAGTCAGTGGCCTGGGAGAGG + Intergenic
1101275075 12:103190367-103190389 TTGACTCAGTGGGCTGGGAGAGG - Intergenic
1101735518 12:107460039-107460061 CTACATCAGTGTTCTGGGAATGG + Intronic
1102763464 12:115410119-115410141 TTAACTCAGTGCACTGGGAGAGG + Intergenic
1102939333 12:116925230-116925252 CTGCCTTAGTGGGGTGGGAGGGG + Intronic
1102966451 12:117131406-117131428 CATCCTCAGTGGGCTGAGAGGGG + Intergenic
1103036894 12:117664164-117664186 CTACTCCCCTGGCCTGGGAGTGG - Intronic
1103721471 12:122977817-122977839 CTATCTCAGCTGCCGGGGAGTGG - Intronic
1104683868 12:130771616-130771638 TCACCACAGTGGCCAGGGAGAGG - Intergenic
1105020178 12:132811020-132811042 CTACCTCAGCTGCCAGGCAGGGG + Intronic
1105214750 13:18277706-18277728 CTCCCCCAGTGGCCTGGGGGTGG + Intergenic
1106423459 13:29603237-29603259 CTGAGTCAGTGGACTGGGAGAGG - Intergenic
1107058092 13:36128477-36128499 CTAGCTCAGTGACCTTGGACAGG + Intronic
1108466458 13:50721018-50721040 CTGAGTCAGTGGACTGGGAGAGG + Intronic
1108732218 13:53246843-53246865 TTGCGTCAGTGGACTGGGAGAGG - Intergenic
1110223744 13:73098376-73098398 CAGCCTCAGTGACGTGGGAGTGG - Intergenic
1110626678 13:77661595-77661617 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1112441154 13:99426052-99426074 CCACCCCAGAGCCCTGGGAGGGG + Intergenic
1112826047 13:103393516-103393538 CTTGCTCTCTGGCCTGGGAGGGG + Intergenic
1113733524 13:112658995-112659017 CTGCCTAAGAGGCCTGGGAAGGG - Intronic
1114216023 14:20658389-20658411 GTGCCTCAGTGGTCTCGGAGTGG - Intergenic
1114416013 14:22544951-22544973 CTTCCTCAGTGGGCTCTGAGAGG + Intergenic
1114484208 14:23053492-23053514 CTACCTGATTGGGCTGGCAGGGG + Exonic
1114660536 14:24340720-24340742 TTACCACAATGCCCTGGGAGTGG - Intergenic
1115747443 14:36451942-36451964 CAAACTCAGGAGCCTGGGAGCGG + Intergenic
1117441686 14:55766154-55766176 CTTCCGCAGCCGCCTGGGAGAGG - Intergenic
1118182448 14:63507114-63507136 CTGCAGCAGTGGCCTGGGATAGG - Intronic
1118491703 14:66267366-66267388 TGACATCAGTGGCATGGGAGGGG - Intergenic
1118558305 14:67050888-67050910 CTACCTCCCTTGGCTGGGAGTGG - Intronic
1121060625 14:90905912-90905934 CTCCCTCAATGGAGTGGGAGTGG - Intronic
1121180732 14:91926522-91926544 CTGCCTCTGTGGCCTGTGTGAGG + Intronic
1121489914 14:94350430-94350452 CTGAGTCAGTGGACTGGGAGAGG - Intergenic
1121841994 14:97142333-97142355 CAACCTCAGGGTCCTGGGAGAGG - Intergenic
1122172656 14:99889604-99889626 CTACAGCAGTGGCCTGAGAGTGG + Intronic
1122574328 14:102732161-102732183 CTACTTCTGTTGCCTGGGATTGG + Intergenic
1122834246 14:104423359-104423381 CGTTCTCAGAGGCCTGGGAGGGG + Intergenic
1128013821 15:64324315-64324337 TTGAGTCAGTGGCCTGGGAGAGG + Intronic
1128783894 15:70380618-70380640 CTTCCTGTGTGGCCTGGGAAAGG - Intergenic
1128941397 15:71790625-71790647 CCACCTCAGTGACCTCAGAGGGG + Intergenic
1129789529 15:78331510-78331532 GCAGGTCAGTGGCCTGGGAGGGG + Intergenic
1130109575 15:80953563-80953585 CTCCCTCACCAGCCTGGGAGGGG + Intronic
1130416028 15:83695474-83695496 CCACCTCACTGACCTAGGAGGGG + Intronic
1133987362 16:10678633-10678655 TTTCCTCAGTGTCCTGGGATGGG - Intronic
1135530312 16:23247356-23247378 CTAGCTCAGTGAGCTGGAAGAGG - Intergenic
1138448112 16:57077482-57077504 CAACCTCAGTGTCCAGGCAGTGG + Intronic
1138493494 16:57392465-57392487 TTGACTCAGTGGACTGGGAGAGG + Intergenic
1138551092 16:57748894-57748916 CAAGCTGAGTGGGCTGGGAGCGG + Intronic
1138829329 16:60358674-60358696 CCACCTCAGTTGCAGGGGAGGGG + Exonic
1140052022 16:71489689-71489711 CTTCCTCAATGGCCCGTGAGTGG - Intronic
1141244192 16:82291138-82291160 CCAAATCAGTGGACTGGGAGAGG + Intergenic
1141431689 16:83973449-83973471 CTTCCCCAGAGGCCTGGGAGTGG - Intronic
1141432508 16:83977704-83977726 CTGCATCTGTGGCCTGGGAGAGG + Intronic
1142125808 16:88409807-88409829 CTCGCTCAGTGGCCTGTGAGCGG + Intergenic
1142412222 16:89922718-89922740 CTTCCGCAGTGGGCGGGGAGGGG - Intronic
1143277900 17:5727316-5727338 CTGAGTCAGTGGACTGGGAGAGG + Intergenic
1143727913 17:8862548-8862570 CTACCTCTGTCACCTGGGGGTGG + Intronic
1144062702 17:11598376-11598398 CTACCTTATTAGCCTGGAAGGGG + Intergenic
1144784735 17:17825308-17825330 CTTCCTCAGTGGGATGGGAGGGG - Intronic
1144831078 17:18131541-18131563 CCAACACAGAGGCCTGGGAGGGG - Intronic
1145231658 17:21177622-21177644 CAACCTCACTGGCTGGGGAGGGG - Intronic
1145794559 17:27648078-27648100 CTGCCTCATTGGCCTGGGCTGGG - Intronic
1145825129 17:27871163-27871185 CTTCCTGAGGGGCCTGGCAGAGG + Intronic
1146774156 17:35597082-35597104 CTGCCTCAGTGGCCCCGGAGCGG - Intronic
1147912076 17:43861818-43861840 CCCCCTCAGGGGCCTGGGAAGGG - Exonic
1149076582 17:52602526-52602548 CTCTGTCAGTGACCTGGGAGTGG - Intergenic
1149362718 17:55911413-55911435 ATGCCTCAGGGGCCTGGGACAGG - Intergenic
1152323931 17:79624755-79624777 GAACCTCAGTGACATGGGAGAGG - Intergenic
1152497381 17:80683148-80683170 CCTCCGCACTGGCCTGGGAGCGG + Intronic
1152745296 17:82036058-82036080 CTACCTCTGTGGGCAGGGCGGGG + Exonic
1152936346 17:83139714-83139736 CTCGCTCAGTGGCTTGGCAGGGG + Intergenic
1153984517 18:10340619-10340641 CAACCACAGGGGCCTGGGACAGG + Intergenic
1157021463 18:43787916-43787938 CTGAGTCAGTGGACTGGGAGGGG - Intergenic
1158456054 18:57608817-57608839 TTAAGTCAGTGGTCTGGGAGAGG + Intronic
1159085181 18:63782117-63782139 TGTCCTCAGTGGCCTGTGAGTGG - Intronic
1160262679 18:77309805-77309827 TTGACTCAGTGGACTGGGAGAGG + Intergenic
1162398914 19:10432890-10432912 CTAGGCCAGTGGCCTGGGAGTGG - Intronic
1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG + Exonic
1163012413 19:14433960-14433982 CTGGCGCAGTGCCCTGGGAGGGG + Intronic
1164147135 19:22518955-22518977 CTCCCTCAGTGCCCTGGTGGTGG + Intronic
1164159497 19:22617374-22617396 CTCCCTCAGTGCCCTGGTGGTGG - Intergenic
1164435493 19:28224989-28225011 CTGGCTCAGTGTCCTGGGGGAGG + Intergenic
1165324195 19:35104661-35104683 CACCCTCTGTGGCCTGGGCGGGG + Intergenic
1166130863 19:40744786-40744808 CTCCCTCGCTGGCCTGGGAGAGG - Intronic
1166817747 19:45557063-45557085 CTAGCACAGTGGCCAGAGAGTGG + Intronic
1166979741 19:46625370-46625392 CTCCCTCTCTGGCCTGGGTGGGG + Intergenic
1168318577 19:55494906-55494928 CCAGCTCAGTGTCCTGGGCGAGG - Intronic
1168536819 19:57177729-57177751 CTACCTCAGTGGCCTGGGAGGGG - Intergenic
925118376 2:1398911-1398933 CTTCCTCAGGGGCCTGGCAGTGG - Intronic
925168836 2:1738385-1738407 CCACATCAGTGCTCTGGGAGGGG - Intronic
926529570 2:14027015-14027037 ATACCTCAGTGTACTGGGGGAGG + Intergenic
927138719 2:20115405-20115427 TGACCACAGTGGCCTGTGAGTGG - Intergenic
927145760 2:20164603-20164625 CTGCCGCTGTGGCCTGGCAGAGG - Intergenic
927206327 2:20613367-20613389 CTACCTCGGAGGCCAGCGAGAGG + Intronic
927662167 2:25002253-25002275 CTGCCCCAGAGGCCTGGGTGGGG - Intergenic
928087627 2:28355840-28355862 CATCCTCAGTGGGCTGGGTGAGG - Intergenic
929778491 2:44942939-44942961 CAGCCTCAGAGGCCTGGGAAGGG + Intronic
930656248 2:54009907-54009929 CTAGCTGAGTGGCCAGGGACAGG - Intronic
930731175 2:54729496-54729518 CTATCTCACTGGACTGTGAGAGG - Intronic
931721847 2:65072433-65072455 CTCCCTCTCTGGCCTGGGCGAGG - Exonic
931817810 2:65921838-65921860 CCATCTCAGTGGCCAGGGATAGG - Intergenic
932063234 2:68528433-68528455 CCACCTCAGTTGCAGGGGAGGGG + Intronic
932380589 2:71278094-71278116 CTAACCCAGGGGCCTGGGAAAGG - Intronic
932422986 2:71612350-71612372 CTCCCTCACTGGCTGGGGAGCGG - Intronic
932447250 2:71788424-71788446 CTACAACAGAGGCCAGGGAGGGG - Intergenic
933523939 2:83411752-83411774 CTACCTAAGTGGCTTTGAAGAGG - Intergenic
933823486 2:86137030-86137052 CTACTTCAATGGCCTGGGAAGGG - Exonic
934299572 2:91769032-91769054 CTCCCCCAGTGGCCTGGGGGAGG - Intergenic
935444282 2:103139783-103139805 CTTCTTCAGTCACCTGGGAGAGG + Intergenic
935698447 2:105789795-105789817 CTGCCTCAGTGGTCTGGGGTGGG + Intronic
935781811 2:106515042-106515064 CTGAGTCAGTGGACTGGGAGAGG - Intergenic
936236599 2:110747665-110747687 CTACCTCAGAATCCTGGCAGGGG + Intronic
936615027 2:114039777-114039799 CTCCATCAGTGGCATGGAAGGGG + Intergenic
937272181 2:120660087-120660109 TTGCCACAGTGGCCTGGAAGGGG - Intergenic
937876086 2:126826528-126826550 CTTCCTCTGTGGCCTTGCAGGGG + Intergenic
937984052 2:127630678-127630700 CAGCCTCAGTGACTTGGGAGGGG - Intronic
940841162 2:158583344-158583366 CTGCTTCAGTGTCCTTGGAGTGG - Intronic
943298221 2:186164457-186164479 CTACCTCAGTGTGGAGGGAGAGG - Intergenic
945333060 2:208561577-208561599 TTAAGTCAGTGGACTGGGAGAGG - Intronic
946059622 2:216930528-216930550 CAATCTCAGTGGCCAGGGAGAGG + Intergenic
947208809 2:227686667-227686689 ATTTCCCAGTGGCCTGGGAGAGG - Exonic
948097058 2:235343668-235343690 GGACCTCAGGGGGCTGGGAGTGG + Intergenic
948823723 2:240564251-240564273 CCACCTCAGTGGCCCTGAAGTGG + Intronic
1168890668 20:1293775-1293797 CTTCCTCCCTGGCCTGGGGGAGG - Intronic
1169372793 20:5041583-5041605 CTGAGTCAGTGGCCTGGGATGGG + Intergenic
1170603555 20:17859666-17859688 CTCCCTCAGGAGCCTGGGCGCGG - Intergenic
1170786990 20:19476111-19476133 CTAGCTCTCCGGCCTGGGAGTGG - Intronic
1170948382 20:20911996-20912018 CCACTTCAGTGGCCTGAAAGGGG - Intergenic
1172890354 20:38260066-38260088 CTGCCTGGCTGGCCTGGGAGGGG + Intronic
1173433436 20:43011773-43011795 ATAAGTCAGTGGACTGGGAGAGG + Intronic
1173883702 20:46438607-46438629 CTGTCTCAGAGGCCAGGGAGGGG - Intergenic
1173912769 20:46682579-46682601 CTAACTGAGTGGCCTGGGGCAGG + Intronic
1175288024 20:57850867-57850889 CTCCCACAGGGGCCTGGGAGAGG + Intergenic
1175754882 20:61523142-61523164 CCACCTCTGTGGCTAGGGAGAGG - Intronic
1175755237 20:61525434-61525456 CATCCTCAGTATCCTGGGAGGGG - Intronic
1176386646 21:6141326-6141348 CTGCCTGCGCGGCCTGGGAGCGG + Intergenic
1177198697 21:17930097-17930119 CTCCCTCCTTGGCCTGGCAGTGG - Intronic
1177424501 21:20904970-20904992 CTAAGTCAGTGGACTGGAAGAGG + Intergenic
1177581071 21:23022097-23022119 CTGAGTCAGTGGACTGGGAGAGG + Intergenic
1178053834 21:28776915-28776937 TTGAGTCAGTGGCCTGGGAGAGG - Intergenic
1178098171 21:29237580-29237602 CTAAGTCAGTGGCCTTGGGGGGG - Intronic
1178404838 21:32315731-32315753 TTTCCTCAGTGGCATGGGTGAGG + Intronic
1178759834 21:35391798-35391820 CTACCTCTGGGAACTGGGAGAGG + Intronic
1179678655 21:43002313-43002335 CAGCTTCTGTGGCCTGGGAGGGG - Intronic
1179736827 21:43396926-43396948 CTGCCTGCGCGGCCTGGGAGCGG - Intergenic
1181635468 22:24172371-24172393 CTCCCTCAGGGCACTGGGAGGGG + Intronic
1181697929 22:24603131-24603153 CTCCCCTAGTGGCCTGGGGGCGG - Intronic
1181700982 22:24621080-24621102 TAACCTCAGGGGCCTGGGTGAGG + Intronic
1183162064 22:36121142-36121164 TTGAATCAGTGGCCTGGGAGAGG - Intergenic
1185140454 22:49097957-49097979 GTACCTCCGGGGGCTGGGAGAGG + Intergenic
949697475 3:6715799-6715821 CTGCCTCAGTCCCCTGGGACTGG + Intergenic
950115221 3:10446456-10446478 CTACCTCACAGGGCTGGGGGAGG - Intronic
950190818 3:10975000-10975022 CTACCTCAGGGGTCTGGGCTGGG - Intergenic
950463335 3:13138605-13138627 CTAACACAGAGGCCAGGGAGGGG + Intergenic
952086813 3:29832673-29832695 TTACCTCAGTATCCTGGGTGGGG - Intronic
953897477 3:46813242-46813264 TTACCTCACAGGCCTGGGTGAGG - Intergenic
953983114 3:47422597-47422619 CAACCTCATGGGCCTCGGAGTGG + Intronic
954396667 3:50296795-50296817 CTTCCTGGGTGGCCGGGGAGAGG + Exonic
954532918 3:51336451-51336473 CAACCTGAGAGGCCTGGGAAAGG - Intronic
954555075 3:51511220-51511242 TTACCTCAGTGGCAAGGGTGTGG + Intergenic
955032199 3:55232383-55232405 TTGACTCAGTGGACTGGGAGAGG + Intergenic
955592916 3:60557134-60557156 ATACCTCAGAGGCTTTGGAGAGG - Intronic
959943913 3:112107656-112107678 CTAGCACAGTGACCTGGGACAGG + Intronic
961647746 3:128401406-128401428 CTCCCCCAGTGGCCTGTGAGGGG - Intronic
961746389 3:129066082-129066104 CTACATCAGTGGCTTGCCAGGGG + Intergenic
964791885 3:160460479-160460501 CATCCTCAGGGGCCTGGGAAGGG - Intronic
964862188 3:161215216-161215238 TTGAGTCAGTGGCCTGGGAGAGG + Intronic
966272269 3:178121533-178121555 CTGAGTCAGTGGACTGGGAGAGG - Intergenic
966571949 3:181453761-181453783 GTTTCTCGGTGGCCTGGGAGAGG - Intergenic
966782102 3:183592805-183592827 CTTCCTCAGGGTCCTGGCAGAGG + Intergenic
966884828 3:184371376-184371398 CTTCCTCAGGGGTCGGGGAGAGG + Intronic
968624634 4:1621626-1621648 CTGCCTCCGTGACCTGGGACAGG - Intronic
969437998 4:7199601-7199623 CTCACTCTGTGGCCTGGGTGGGG + Intronic
971721832 4:30255278-30255300 CTTCCCCACTGGCCTGGCAGGGG - Intergenic
972121439 4:35709456-35709478 CTGAGTCAGTGGACTGGGAGAGG - Intergenic
973038831 4:45445265-45445287 CTGAGTCAGTGGACTGGGAGAGG + Intergenic
974115849 4:57578485-57578507 TTGAGTCAGTGGCCTGGGAGAGG + Intergenic
974565264 4:63572870-63572892 TTGAGTCAGTGGCCTGGGAGAGG + Intergenic
974700821 4:65443553-65443575 CTACCTTAGAAGCCTGGGGGAGG + Intronic
975982092 4:80172526-80172548 CTGCCTCACTGAGCTGGGAGGGG + Intergenic
976030672 4:80749826-80749848 TTAAGTCAGTGGACTGGGAGAGG - Intronic
980792134 4:137633357-137633379 TTAAGTCAGTGGACTGGGAGAGG + Intergenic
980926685 4:139144782-139144804 TTACCCCAGTGGCCAGGGAATGG + Intronic
984226755 4:177044493-177044515 CAATCTCTGTGGCCTGTGAGAGG + Intergenic
984860454 4:184233030-184233052 TTATGTCAGTGGACTGGGAGAGG + Intergenic
985838344 5:2287539-2287561 CTCCCTCAGTCTCCTGTGAGCGG - Intergenic
987089505 5:14498510-14498532 GTGCCGCAGTGACCTGGGAGAGG + Exonic
987189329 5:15458206-15458228 TTATGTCAGTGGACTGGGAGAGG + Intergenic
987905431 5:24069874-24069896 CTAAGTCAGTGGACTGGGAGAGG - Intronic
988195002 5:27993565-27993587 TTGCGTCAGTGGACTGGGAGAGG - Intergenic
988248835 5:28727075-28727097 CTGAGTCAGTGGACTGGGAGAGG + Intergenic
988679279 5:33469009-33469031 TTGAGTCAGTGGCCTGGGAGAGG + Intronic
988880070 5:35492583-35492605 CTACCTATGTGGCCTTGGACAGG + Intergenic
989656752 5:43753323-43753345 CTTCCTCACTGCCCTGGCAGAGG + Intergenic
990931099 5:61093228-61093250 TTAAGTCAGTGGACTGGGAGAGG - Intronic
992030800 5:72719658-72719680 ATTGCTCAGTGGCTTGGGAGGGG - Intergenic
994344080 5:98664414-98664436 CTACCTCCCTTGGCTGGGAGTGG - Intergenic
994741027 5:103619168-103619190 CTACCTGAGTGTCCTTGGAAAGG + Intergenic
995660079 5:114472098-114472120 CTACCTCAGGGGTCTGTGAAAGG - Intronic
996787773 5:127259226-127259248 CTAGGTCTTTGGCCTGGGAGTGG - Intergenic
997823488 5:137086375-137086397 CTGCCTTTGTGGCCTGGGTGCGG - Intronic
999196778 5:149786836-149786858 CTACTTCTGAGGCCTGGGAGAGG - Intronic
999758430 5:154682572-154682594 CTGCCTCTGTGGGATGGGAGGGG - Intergenic
1000052482 5:157575166-157575188 CTGCCCGTGTGGCCTGGGAGCGG - Intronic
1003125878 6:3355639-3355661 CTAGCTCTGGAGCCTGGGAGTGG - Intronic
1003139006 6:3456280-3456302 CTTCCTCGGGGGCCTGGGCGGGG - Exonic
1003370617 6:5522356-5522378 CTTCCTCTGTGACCAGGGAGAGG + Intronic
1003474172 6:6466182-6466204 ACACCTCTGTGGCCTGGAAGAGG - Intergenic
1005243306 6:23855219-23855241 CCACCTCAGTTGCAGGGGAGGGG - Intergenic
1005387119 6:25296248-25296270 CTATCTCCCTGTCCTGGGAGAGG + Intronic
1007144716 6:39616777-39616799 CTACGTCTATTGCCTGGGAGAGG + Intronic
1007376491 6:41460317-41460339 CCTCCTCAGAGCCCTGGGAGGGG - Intergenic
1007378800 6:41473486-41473508 CTACCTCTGTGCCCTGGGGAAGG + Intergenic
1007422762 6:41729321-41729343 CTACATCTCTGGTCTGGGAGAGG + Intronic
1009398537 6:63229305-63229327 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1010563837 6:77384323-77384345 CTGAGTCAGTGGACTGGGAGAGG - Intergenic
1014403014 6:121014651-121014673 CTACCTGAGTAGCTCGGGAGTGG - Intergenic
1015152259 6:130053343-130053365 CTATCTGAGTGGGCTGGGCGTGG + Intronic
1015748729 6:136538678-136538700 CTACCTCAGGGGGCTGAGATGGG + Intronic
1019140459 6:169939213-169939235 CTGCCTGAGGGGCCTGGGGGAGG - Intergenic
1019161195 6:170067929-170067951 TTGCCACAGTGGCCAGGGAGAGG - Intergenic
1019227285 6:170523733-170523755 TTGCCTCTGTGGCCTGGGAATGG - Intergenic
1019743884 7:2688793-2688815 CTCCCTCAGTCTCCTGGGGGAGG - Intronic
1019747815 7:2710268-2710290 CTCCCTCTGTCGCCTGGGTGGGG + Intronic
1023283739 7:38596811-38596833 CTACCTCAGGGTGCTGGCAGTGG - Intronic
1023715318 7:43037946-43037968 GTACATCAGTGAGCTGGGAGTGG - Intergenic
1024333265 7:48177922-48177944 GGCCCTCAGTGGCCTGGCAGTGG - Intronic
1024563360 7:50662536-50662558 TGACCTCAGAGGTCTGGGAGGGG + Intronic
1025875779 7:65478686-65478708 CCACCACAGAGGCCTGGGAAGGG - Intergenic
1026620124 7:71942852-71942874 CTATCTCAGTGGGCAGAGAGGGG - Intronic
1026852662 7:73734948-73734970 CTTCCTCCTTGGCCTGGCAGGGG + Intergenic
1027631883 7:80617021-80617043 CAACCTCTGTAGCTTGGGAGAGG + Intronic
1027922824 7:84418119-84418141 TTAAGTCAGTGGACTGGGAGAGG + Intronic
1028559313 7:92156002-92156024 CTGAGTCAGTGGACTGGGAGAGG - Intronic
1029450911 7:100641399-100641421 CAGCCTCAGGGGCTTGGGAGGGG + Intronic
1032990209 7:137386191-137386213 AAATCTCAGTGTCCTGGGAGAGG + Intronic
1033280870 7:140005538-140005560 CTGCCCCAGTGGCCTGTGATGGG + Intronic
1033504911 7:141990176-141990198 TTACCCCAGTGGCTTGGGAAAGG + Intronic
1035818974 8:2571365-2571387 CTACATAAGTGGCCTGGGCAAGG + Intergenic
1036669500 8:10771991-10772013 TTACCACAGTTGCCTTGGAGGGG + Intronic
1036710322 8:11074331-11074353 TTACCACAGTGACCTGGCAGTGG - Intronic
1037619562 8:20551488-20551510 CCATCCCAGTGGTCTGGGAGGGG - Intergenic
1037751388 8:21684621-21684643 CCACCCCAGTGGCTGGGGAGGGG - Intergenic
1037974470 8:23199934-23199956 TTCCCTTAGTGGCCAGGGAGGGG + Intronic
1038010569 8:23472583-23472605 GTGCCTCAGTGGCCAGGGACAGG + Intergenic
1038310247 8:26440937-26440959 TCACCGCAGTGGCCTGGCAGTGG + Intronic
1038372914 8:27011340-27011362 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1040005936 8:42620980-42621002 CTGCCTTAGTGGCATGGGAATGG + Intergenic
1042855269 8:73260840-73260862 TTAAGTCAGTGGACTGGGAGAGG + Intergenic
1043569621 8:81588122-81588144 TTGCGTCAGTGGACTGGGAGAGG - Intergenic
1044051221 8:87507477-87507499 CTAAATCAGTGAACTGGGAGTGG + Intronic
1046217672 8:111170997-111171019 TTACCTCAGTAGCCTTGGATGGG + Intergenic
1047449274 8:124949229-124949251 TTAAGTCAGTGGACTGGGAGAGG + Intergenic
1047881958 8:129204534-129204556 GTGACTCAGTGGCCTGTGAGTGG - Intergenic
1048095157 8:131283994-131284016 CTACCTCAGCTCCCTGGCAGAGG - Intergenic
1048601415 8:135922636-135922658 TTGCGTCAGTGGACTGGGAGAGG + Intergenic
1048895092 8:138985122-138985144 TTGACTCAGTGGACTGGGAGAGG + Intergenic
1049202449 8:141346955-141346977 CTTCCTGACCGGCCTGGGAGAGG - Intergenic
1049564208 8:143329658-143329680 CGACCACAGTGATCTGGGAGCGG + Intronic
1049696806 8:143988050-143988072 CTGCCTCAGTAGCCTGGGACTGG + Intronic
1050357835 9:4799773-4799795 CTACCTCCCTGGGTTGGGAGTGG + Intronic
1050588286 9:7135895-7135917 ATACATCAGTGGGCTGGGATGGG - Intergenic
1050888475 9:10794290-10794312 TTGAGTCAGTGGCCTGGGAGAGG - Intergenic
1050912027 9:11083254-11083276 CTTACTCATTAGCCTGGGAGTGG + Intergenic
1051907090 9:22107602-22107624 CCACATCAGGGGCCTTGGAGCGG + Intergenic
1052413425 9:28148995-28149017 CCACCTCAGTTGCAGGGGAGGGG - Intronic
1052811164 9:33061872-33061894 ATACTGCTGTGGCCTGGGAGTGG - Intronic
1053179030 9:35951940-35951962 CTTCCTGAGAGGCCTGGAAGAGG - Intergenic
1056020182 9:82432108-82432130 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1056576323 9:87858244-87858266 CCACCTCAGTTGCAGGGGAGGGG + Intergenic
1057071718 9:92105210-92105232 CCACCTCAGTTGCAGGGGAGGGG - Intronic
1057805380 9:98216161-98216183 CTACCTCATGTGGCTGGGAGAGG + Intronic
1060432717 9:123564267-123564289 CAACTTCTGGGGCCTGGGAGTGG + Intronic
1060443220 9:123661225-123661247 CTAGCTCATTGAGCTGGGAGAGG - Intronic
1060704446 9:125785283-125785305 TTGAGTCAGTGGCCTGGGAGAGG + Intronic
1060855893 9:126914924-126914946 CTTCCTCATGGCCCTGGGAGCGG - Exonic
1062189812 9:135242229-135242251 CTGCCTGGGTGGCCTTGGAGGGG - Intergenic
1062381385 9:136288466-136288488 CTGGCTCAGAGGCCAGGGAGGGG - Intronic
1062405986 9:136396904-136396926 CTTCCAAAGTAGCCTGGGAGGGG - Intronic
1187927629 X:24264393-24264415 CTGAGTCAGTGGACTGGGAGAGG - Intergenic
1188669681 X:32868136-32868158 CTACCTCCCTTGGCTGGGAGTGG - Intronic
1190379822 X:49829003-49829025 CTACCTCAGTGGCCCTTAAGAGG - Intergenic
1190770577 X:53510769-53510791 AAACCTCACTGGGCTGGGAGCGG - Intergenic
1191741055 X:64435291-64435313 TTACCTCACAGGCCTGGGTGAGG - Intergenic
1192143889 X:68667698-68667720 CTGCCTGACTGGCCTGGGGGTGG + Intronic
1192177592 X:68895509-68895531 CTAGCTCAGTGGGAGGGGAGTGG + Intergenic
1192213307 X:69141300-69141322 CAACCTCAGTGGCATCAGAGTGG - Intergenic
1192728831 X:73781650-73781672 CTGAGTCAGTGGACTGGGAGGGG - Intergenic
1193940657 X:87677615-87677637 TTAAGTCAGTGGACTGGGAGAGG - Intergenic
1193979180 X:88159869-88159891 TTCACTCAGTGGCCTGGGAGAGG + Intergenic
1194214271 X:91109288-91109310 CTCCCTCACTGGCATGGTAGTGG + Intergenic
1195863735 X:109407913-109407935 CTTCCTCAGTGCCCTAGCAGAGG - Intronic
1197151039 X:123220145-123220167 CCACCTGAGTGCCCTGGGAGTGG + Intronic
1198728336 X:139700646-139700668 GAACCACAGTGGCCTGGGAGAGG - Intronic
1199040563 X:143110917-143110939 TTAAGTCAGTGGACTGGGAGGGG + Intergenic
1200098437 X:153674994-153675016 CTTCTGCAGTGTCCTGGGAGGGG - Intronic
1200834346 Y:7718219-7718241 CTAAGTCACAGGCCTGGGAGAGG + Intergenic