ID: 1168538520

View in Genome Browser
Species Human (GRCh38)
Location 19:57191699-57191721
Sequence CGCCGCCCCTGGAGACCGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168538520_1168538533 17 Left 1168538520 19:57191699-57191721 CCCCGCGGTCTCCAGGGGCGGCG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1168538533 19:57191739-57191761 GGTTGCCACCGAGGAGGCGGCGG 0: 1
1: 1
2: 0
3: 15
4: 313
1168538520_1168538536 29 Left 1168538520 19:57191699-57191721 CCCCGCGGTCTCCAGGGGCGGCG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1168538536 19:57191751-57191773 GGAGGCGGCGGCCCTGCGTCTGG 0: 1
1: 0
2: 1
3: 34
4: 251
1168538520_1168538530 8 Left 1168538520 19:57191699-57191721 CCCCGCGGTCTCCAGGGGCGGCG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1168538530 19:57191730-57191752 CTGGAACGCGGTTGCCACCGAGG 0: 1
1: 1
2: 0
3: 2
4: 39
1168538520_1168538527 -4 Left 1168538520 19:57191699-57191721 CCCCGCGGTCTCCAGGGGCGGCG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1168538527 19:57191718-57191740 GGCGCCCTGGGTCTGGAACGCGG 0: 1
1: 0
2: 1
3: 12
4: 137
1168538520_1168538531 11 Left 1168538520 19:57191699-57191721 CCCCGCGGTCTCCAGGGGCGGCG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1168538531 19:57191733-57191755 GAACGCGGTTGCCACCGAGGAGG 0: 1
1: 1
2: 0
3: 2
4: 22
1168538520_1168538532 14 Left 1168538520 19:57191699-57191721 CCCCGCGGTCTCCAGGGGCGGCG 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1168538532 19:57191736-57191758 CGCGGTTGCCACCGAGGAGGCGG 0: 1
1: 1
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168538520 Original CRISPR CGCCGCCCCTGGAGACCGCG GGG (reversed) Exonic