ID: 1168545033

View in Genome Browser
Species Human (GRCh38)
Location 19:57243053-57243075
Sequence TCTACCAAAAAGAAATAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 629}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168545029_1168545033 3 Left 1168545029 19:57243027-57243049 CCTGGGCAACATAGCAAGATCCC 0: 366
1: 3590
2: 14198
3: 49247
4: 118396
Right 1168545033 19:57243053-57243075 TCTACCAAAAAGAAATAGTTGGG 0: 1
1: 0
2: 4
3: 74
4: 629
1168545028_1168545033 7 Left 1168545028 19:57243023-57243045 CCAGCCTGGGCAACATAGCAAGA 0: 5370
1: 36977
2: 98936
3: 206535
4: 250422
Right 1168545033 19:57243053-57243075 TCTACCAAAAAGAAATAGTTGGG 0: 1
1: 0
2: 4
3: 74
4: 629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168545033 Original CRISPR TCTACCAAAAAGAAATAGTT GGG Intronic
901089320 1:6630872-6630894 TCTACAAAAAAAAAAAAGTGGGG - Intronic
901299734 1:8190895-8190917 TCTACCAAAAAAAAATAGCTGGG - Intergenic
901338367 1:8471464-8471486 TCTACCAAAATACAAAAGTTAGG - Intronic
901608933 1:10481600-10481622 TCTACAAAAAATAATTAGCTGGG - Intronic
903082660 1:20823539-20823561 TCTACTAAAAAAAAATAGCTAGG - Intronic
903151050 1:21409110-21409132 TCTACTAAAAATAGAAAGTTAGG + Intergenic
903160774 1:21487697-21487719 TCTACAAAAAAAAATTAGTCGGG - Intergenic
903523300 1:23972242-23972264 TCTACAAAAAATAATTAGCTGGG + Intronic
903580991 1:24370784-24370806 TCTACAAAAAAAAAAAAGCTGGG - Intronic
903739216 1:25548819-25548841 TCTACAAAAAATAATTAGCTGGG - Intronic
903859867 1:26358174-26358196 TCTACAAAAAATAAAAAGATTGG + Intergenic
904008617 1:27377281-27377303 TCTACAAAAAATAAAAATTTAGG - Intergenic
904193316 1:28764572-28764594 TCTACTAAAAATAAAAAATTGGG - Intronic
905330822 1:37195485-37195507 TCTACTAAAAATAAAAAATTAGG - Intergenic
905432467 1:37934568-37934590 TCTAGTAAAATGAAAGAGTTGGG + Intronic
905776636 1:40671921-40671943 TCTACCAAAAATAATTAGCTGGG - Intergenic
906437271 1:45806871-45806893 TCTACAAAAAATAAAAAATTAGG - Intronic
906764216 1:48412025-48412047 TCTACTAAAAATATATAGCTAGG - Intronic
906981758 1:50638742-50638764 TCTATGAAAAAGCAATAGCTAGG - Intronic
907095037 1:51770441-51770463 TCTACAAAAAATAAAAAATTAGG - Intronic
907582107 1:55581802-55581824 TCTACAAAACAGAAATAATAAGG + Intergenic
907611852 1:55879221-55879243 TCTTCGAAAAAAAAAGAGTTGGG - Intergenic
907618394 1:55949135-55949157 TCTACAAAAAGGAATTAGATTGG - Intergenic
908045457 1:60163419-60163441 ACTACAAAAAAGAAATAGCCAGG - Intergenic
908453741 1:64281692-64281714 TCTTTCAACAAGAAAGAGTTTGG + Intergenic
908537094 1:65088489-65088511 TATGGGAAAAAGAAATAGTTTGG + Intergenic
908856808 1:68439288-68439310 TCCACAAAAACGATATAGTTGGG + Exonic
908886846 1:68798971-68798993 TTAACCAAAAAGAAATTTTTTGG - Intergenic
909331446 1:74416848-74416870 TCTTCCACAAAGATATATTTTGG - Intronic
910006792 1:82407060-82407082 TCTACCAAAAAATATTAGCTGGG + Intergenic
910448509 1:87324012-87324034 TCTACCAAAAAAAATTAGCTGGG + Intergenic
912213092 1:107576594-107576616 TCTATCAAAATGTAAAAGTTTGG - Intronic
912320358 1:108707102-108707124 GATATCAAAAAGAAATATTTAGG - Intergenic
912981111 1:114374081-114374103 TCTACTAAAAATACAAAGTTAGG - Intergenic
913157150 1:116111094-116111116 TCTGTGAAAAACAAATAGTTTGG + Intergenic
913257160 1:116963943-116963965 TCTACCAAAAAAAAATAGCCAGG - Intronic
913365707 1:118036025-118036047 TCTACCAAAAATAATTAGCCAGG + Intronic
914791189 1:150878682-150878704 TCCACCCAAAAGAAATACATTGG + Intergenic
914906685 1:151751974-151751996 TCTACTAAAAAAAATTAGCTGGG + Intergenic
915308601 1:154995318-154995340 TCTACTAAAAATAATTAGCTGGG + Intergenic
915322961 1:155066034-155066056 TCTACCATAAATAAATAAATAGG - Intronic
915415797 1:155741714-155741736 TCTACCAAAAAAAAGTTGTTTGG - Intergenic
915477884 1:156163869-156163891 TCTACCAAAAAAAATGAGCTGGG + Intronic
915894776 1:159803265-159803287 TATACCTAAAAGAAATAATTTGG + Intronic
916895300 1:169156150-169156172 TCTACAAAAAAAAATTAGTGGGG + Intronic
917876083 1:179288525-179288547 TCTACAAAAAAAAAAAAATTTGG + Intergenic
917936146 1:179869139-179869161 TCTACTAAAAATACACAGTTGGG - Intronic
918867117 1:189916396-189916418 TGTATCAAAAAGAAATAATTTGG - Intergenic
919406060 1:197185747-197185769 TCCCCCAAAATGAAATATTTAGG + Intronic
920045989 1:203132684-203132706 AATACCAAAAACAAATAGCTGGG + Intronic
920134602 1:203759472-203759494 TCTACCAAAAATACAAAGCTGGG - Intergenic
921068257 1:211638199-211638221 TCTACAAAAAAAAAATAGCCGGG - Intergenic
921105217 1:211970021-211970043 TCTACAAAAAAAAATTAGCTGGG - Intronic
921289166 1:213639082-213639104 TCAAACAAAATGAAATACTTAGG - Intergenic
921445596 1:215243262-215243284 TAAAACCAAAAGAAATAGTTTGG - Intergenic
921470755 1:215545731-215545753 TCAACCAAAAAAGAATAATTAGG + Intergenic
921709421 1:218358707-218358729 TCTACTAAAAAAAATTAGCTGGG - Intronic
922145434 1:222939520-222939542 ACTACCATAAAGAAATACCTGGG + Intronic
923220870 1:231891783-231891805 TCTACCAGGAAGAAATAGTCTGG - Intronic
923677786 1:236095335-236095357 TCTACAGAAAAAAAATAGCTGGG - Intergenic
923789220 1:237097167-237097189 TCTACCAAAGGGACATAGTTTGG - Intronic
1063007624 10:1988980-1989002 TCAATTAAAAAGAAATAGATTGG + Intergenic
1063012082 10:2032804-2032826 CCTCCCAAAATGAAATACTTAGG - Intergenic
1064335273 10:14434938-14434960 TGTACCAGAAAAAAATAATTTGG + Intronic
1064388098 10:14916676-14916698 TCCCCCAAAATGAAATACTTAGG + Intronic
1065161665 10:22928620-22928642 TTTATCCTAAAGAAATAGTTGGG + Intronic
1065526191 10:26623282-26623304 TCTACAAAAAATAAAAAATTAGG + Intergenic
1065551444 10:26871912-26871934 TCTAACAAAAGGAACTAGTATGG + Intergenic
1066775512 10:38882719-38882741 TCTAACGGAAAGAAATAGTATGG + Intergenic
1067100509 10:43330770-43330792 TCTACAAAAAATAATTAGCTGGG + Intergenic
1068995911 10:63203850-63203872 TCAATCAAAAAGAATGAGTTAGG - Intronic
1069172250 10:65246872-65246894 ATTACCAAAAAGAAAAAATTAGG + Intergenic
1070146910 10:73781222-73781244 TCTACAAAAAATAATTAGCTGGG + Intergenic
1070298663 10:75186881-75186903 TCTACAAACAAAAAAGAGTTTGG + Intergenic
1071015175 10:80988470-80988492 TCTTCAAAAAACATATAGTTAGG - Intergenic
1071300962 10:84255887-84255909 TCTACCAAAAATACAAAATTAGG - Intronic
1072124640 10:92434619-92434641 TCTACAAAAAATAAAAAATTAGG + Intergenic
1072130056 10:92485284-92485306 TCTACTAAAAAAAATTAGCTGGG - Intronic
1072921635 10:99581976-99581998 TCTACCAAAAATACAAAATTAGG - Intergenic
1072940048 10:99754687-99754709 TCTCCCAAATAGAAAAACTTTGG + Intronic
1075042514 10:119119440-119119462 TCTACCAAAAATACAAAATTAGG - Intronic
1075143056 10:119857574-119857596 TCTTTTAAAAAGTAATAGTTTGG - Intronic
1075217401 10:120548542-120548564 TCTACCATAAAGACATAGCATGG - Intronic
1075637500 10:124039257-124039279 TCTAACAAAGAGAAAGAGCTGGG + Intronic
1075999099 10:126901580-126901602 TCTACTAAAAAAAAATATCTGGG - Intergenic
1077619883 11:3711271-3711293 TCTAGCAAAAAGAGGTAGTAAGG - Intronic
1078149286 11:8745080-8745102 TCTACCAAAAATAAAAAAGTTGG - Intronic
1078477818 11:11647571-11647593 TCTAATAAAAAGAAAGAGATGGG + Intergenic
1079990744 11:27243850-27243872 TCTAACAAAAATACATAATTGGG - Intergenic
1080479396 11:32630506-32630528 TCTACCAAAATGCAAAACTTAGG - Intronic
1080506047 11:32915075-32915097 TCTACAAAAAATAATTAGCTGGG - Intronic
1080576777 11:33606988-33607010 TCACCCAAAAAGAATTTGTTGGG + Intronic
1080611880 11:33911468-33911490 TCTACAAAAAAAAATTATTTGGG - Intergenic
1080657831 11:34271571-34271593 TCTACAAAAAATAATTAGCTGGG + Intronic
1081386440 11:42478686-42478708 TCTTCTGGAAAGAAATAGTTTGG - Intergenic
1081933827 11:46890754-46890776 ACTACAAAAAAAAATTAGTTAGG - Intronic
1083246513 11:61432095-61432117 TCTACTAAAAAAAATTAGTCAGG + Intronic
1083858577 11:65406493-65406515 TCTACTAAAAACAAAAAATTAGG - Intronic
1083916870 11:65752070-65752092 TCTACCAAAAAAAATTAGCTGGG - Intergenic
1084842964 11:71872565-71872587 AATACCAAAAAAAAATAGCTGGG + Intronic
1085009730 11:73130039-73130061 TCTACTAAAAAAAATTAGCTGGG - Intronic
1085185863 11:74575763-74575785 TCTACAAAAAAAAATTAGCTGGG - Intronic
1085225559 11:74917565-74917587 TATACCAATTAGATATAGTTAGG + Intronic
1085647235 11:78233198-78233220 TCTACCAAAAACAATTAGCCAGG - Intronic
1085670879 11:78463862-78463884 ACTATCAAATAGAAATAGTGAGG - Intronic
1086876281 11:92099619-92099641 TCTACCACAGAAAAATGGTTTGG + Intergenic
1087394074 11:97574184-97574206 TCTACTAAAAAAAAAAAGCTGGG - Intergenic
1088664255 11:112078716-112078738 TCTACAAAAAAAAAGTAGCTAGG - Intronic
1089439086 11:118499617-118499639 TCTACTAAAAAAAATTAGCTGGG + Intronic
1089718957 11:120394359-120394381 TCTACTAAAAAAAATTAGTGGGG - Intronic
1090692186 11:129195553-129195575 TCTACTAAAAATAAAAAATTAGG - Intronic
1090789357 11:130077009-130077031 CTTACTAAAAAGAAAAAGTTGGG + Intronic
1090851322 11:130573036-130573058 CTTACCAAAAAGAAAACGTTTGG - Intergenic
1091469700 12:715997-716019 TCTCCAAAAAAAAAAAAGTTTGG - Intergenic
1093040038 12:14367611-14367633 TCCAGAAAAATGAAATAGTTTGG + Intronic
1093055351 12:14550577-14550599 TCTACTAAAAATAAAAAATTAGG + Intronic
1093678645 12:21974391-21974413 TCTCCCAAAAAGGAAGAGTCAGG + Intergenic
1094314647 12:29125610-29125632 TCACCAAAAAAGAAATACTTAGG - Intergenic
1095995660 12:48081729-48081751 TCTACAAAAAAAAATTAGCTGGG - Intronic
1096048009 12:48581419-48581441 TCAAAAAAAAAAAAATAGTTGGG - Intergenic
1096659604 12:53115953-53115975 TCCAACAAAAAGAAAAAGTATGG + Intronic
1096821192 12:54236228-54236250 TGTTCAAAAAAAAAATAGTTTGG - Exonic
1096962831 12:55597914-55597936 TCTACAAAAAAAAAATAGTGGGG + Intergenic
1097552586 12:61094074-61094096 GCTACCAAACAGAAATATGTAGG - Intergenic
1097859483 12:64504470-64504492 TCTACTAAAAATAAAAAATTAGG + Intergenic
1098274023 12:68795799-68795821 TCTACTAAAAAAAATTAGCTGGG - Intergenic
1099087570 12:78264044-78264066 TGTATAAAAAAAAAATAGTTTGG - Intergenic
1099496256 12:83350621-83350643 TCTACCAAAGATATCTAGTTAGG - Intergenic
1099546313 12:83985277-83985299 TCTGCCAAAATCAAATATTTTGG - Intergenic
1099909919 12:88817310-88817332 TCTCCCAAAAAGAAATCTCTAGG + Intergenic
1100395338 12:94181230-94181252 TCTACTAAAAAAAATTAGCTGGG + Intronic
1100534352 12:95492723-95492745 TCTACCAAAAAAAATTAGCTGGG - Intronic
1101281354 12:103260192-103260214 TCTGCTAAAAAGAAATAGACAGG + Intronic
1101315366 12:103623981-103624003 TCTCCCAAAAAGGAATATATTGG + Intronic
1101653783 12:106701854-106701876 TCTACAAAAAAAAATTAGCTGGG + Intronic
1102118430 12:110421363-110421385 TCTACCAAAAAAAATTAGCCAGG - Intergenic
1102134279 12:110559891-110559913 CCTACAAAAAATAAATAGCTGGG - Intronic
1103101010 12:118175731-118175753 TCTACAAATAAGAAATACTAAGG + Intronic
1103626141 12:122221561-122221583 TCTACAAAAAATAATTAGCTAGG - Intronic
1103778004 12:123380733-123380755 AATACAAAAAAGAAATAGCTGGG + Intergenic
1103788564 12:123452297-123452319 TCTACTAAAAAAAATTAATTGGG + Intergenic
1103790914 12:123470310-123470332 TCTACAAAAAATAATTAGCTGGG + Exonic
1104201851 12:126597416-126597438 TATTTCAAAAAGAAATATTTAGG + Intergenic
1105752130 13:23431025-23431047 TTTACTAATAAGAAATACTTGGG + Intronic
1107262100 13:38505133-38505155 TTGACCAAAAAAAAAAAGTTCGG - Intergenic
1108417711 13:50216739-50216761 TCTATAACAAAGAAAGAGTTTGG + Intronic
1108726334 13:53185976-53185998 TCTACAAAAAAAAAGTGGTTGGG - Intergenic
1108808432 13:54188437-54188459 ACTAAAACAAAGAAATAGTTGGG + Intergenic
1108864704 13:54909189-54909211 TCTTCCAAAAAAAAAAAGTTTGG - Intergenic
1108871855 13:54997495-54997517 TATGCCAAAAAGACATATTTTGG - Intergenic
1109778065 13:67069685-67069707 TTTACCATAAAGAAATATTGTGG - Intronic
1109989226 13:70031684-70031706 TCTGTCAAAAAGCAATAATTAGG - Intronic
1110080778 13:71308040-71308062 TCTAGTAAAAAGGAACAGTTGGG - Intergenic
1110206023 13:72914743-72914765 TCTACAAAAAATAATTAGTTGGG - Intronic
1110813401 13:79835593-79835615 TCTACCAATAAGACAAATTTTGG - Intergenic
1110856710 13:80304634-80304656 TCTACCAAAAATACAAAATTAGG - Intergenic
1112019405 13:95358616-95358638 TATGCCAAAGAGGAATAGTTTGG - Intergenic
1112959964 13:105112040-105112062 TCTACCAAAAATACAAAATTAGG + Intergenic
1113076223 13:106470358-106470380 TCTTCAAATAAGAAAAAGTTGGG - Intergenic
1113330835 13:109325907-109325929 TCTACCAAATAGAAAAGTTTTGG - Intergenic
1115272858 14:31573547-31573569 TCCACCAAAAAAACATAGATAGG - Intronic
1115327463 14:32156854-32156876 ACTTCCAAATAGAAATAGTCAGG - Exonic
1115683561 14:35768710-35768732 ACTACAAAAAATAAATAGGTAGG + Intronic
1116778434 14:49208530-49208552 TCCAACATTAAGAAATAGTTTGG + Intergenic
1116937880 14:50760832-50760854 TCTACCAAGAAAAAAAAATTAGG - Intronic
1117533656 14:56684025-56684047 CATACCAAAAAAAAATACTTAGG - Intronic
1117649545 14:57888887-57888909 TATACCAAATATAAATAATTTGG + Intronic
1117680428 14:58198034-58198056 ACAAACAAAAAAAAATAGTTGGG + Intronic
1117794225 14:59375146-59375168 ACCACCAAAATGAAATACTTAGG + Intergenic
1117923899 14:60755440-60755462 TCTACAAAAAATAAAAAATTAGG - Intronic
1118432095 14:65729184-65729206 TCTACCATAAAAAATTAGCTGGG - Intronic
1119664484 14:76474920-76474942 TCTACCAAAAAAAAAAAGAAAGG + Intronic
1121073329 14:91044985-91045007 TCTACCAACAAAAATGAGTTTGG + Intronic
1121113081 14:91325737-91325759 TCTACGAAAACTAAATAATTGGG - Intronic
1121202277 14:92128320-92128342 TCTACCAAAAAGAATTAGCTGGG + Intronic
1121552061 14:94810275-94810297 TCTACAAAAAAGAAAAAGCCAGG + Intergenic
1121614897 14:95307147-95307169 TCCACCAAAAAGACATGGTCGGG + Intronic
1122197629 14:100101182-100101204 TCTACTAAAAAGACAAAATTAGG + Intronic
1122433359 14:101673352-101673374 TCTACTAAAAAGTTATAGTATGG + Intergenic
1122590089 14:102843040-102843062 TCTACTAAAAAAAATTAGCTGGG + Intronic
1122850267 14:104524361-104524383 TCTACTAAAAAGACAAAATTAGG - Intronic
1123022458 14:105407531-105407553 TCTACAAAAAATAATTAGCTGGG - Intronic
1125063855 15:35458252-35458274 TCCATCAAAATGAAAGAGTTAGG - Intronic
1125128525 15:36253596-36253618 TCTAGCTAGAAGAAATAATTAGG - Intergenic
1125192567 15:37010541-37010563 TCTACCAAAAAAAATTAGGAAGG - Intronic
1125244407 15:37618304-37618326 TCTACCAAAAAGACACATATAGG - Intergenic
1125311907 15:38388754-38388776 TCTACAAAAAAGAAAAGATTAGG - Intergenic
1125479746 15:40071973-40071995 TCTACAAAAAATAAAAAATTAGG - Intergenic
1125497498 15:40210668-40210690 TCTACAAAAAATAATTAGCTGGG - Intronic
1127106066 15:55617204-55617226 TTTACCAAAAATAAATACTTTGG - Exonic
1127576430 15:60296463-60296485 TCTACCAAAGCGATATTGTTTGG - Intergenic
1128104669 15:65034716-65034738 TCTACAAAAAAAAATTAGCTGGG - Intergenic
1128312337 15:66638924-66638946 TCTACTAAAAATAATTAGTTGGG + Intronic
1128321005 15:66694301-66694323 TATAGCAAAAAGAAAGAGATTGG - Intergenic
1128917892 15:71582229-71582251 TTTACAAAAATGAAATACTTAGG - Intronic
1129281053 15:74485298-74485320 TCTACCAAAAAAACCTAGCTGGG - Intergenic
1129358499 15:75009639-75009661 TCTACAAAAAATAAAAAATTAGG - Intronic
1130611725 15:85367348-85367370 TCTACCAAAAAAAAAAAGCCAGG + Intergenic
1130670060 15:85904115-85904137 TCTACCAAAAAAAAAAAAATTGG + Intergenic
1130950277 15:88581139-88581161 TCTACCAAGAAGAAATTGAAGGG + Intergenic
1131104603 15:89724039-89724061 AATACCAAAAAAAAATAGCTGGG + Intronic
1132795451 16:1719132-1719154 TCTACAAAAAATAATTAGCTGGG - Intronic
1133846252 16:9456681-9456703 TCTACCAAAAAGAAATTAACTGG + Intergenic
1133986082 16:10669296-10669318 TATACAAAAAAAAAATAGCTGGG + Intronic
1134317569 16:13133372-13133394 TCTTGAAAAAAGTAATAGTTTGG + Intronic
1134647819 16:15884660-15884682 AATACAAAAAAGAAATAGTTGGG - Intronic
1135370987 16:21900099-21900121 TCTCCAAAAAAAAAAGAGTTGGG + Intergenic
1135536050 16:23295378-23295400 TCTACAAAAAATAAATTGCTGGG - Intronic
1135708185 16:24693284-24693306 TCTACAAAAAAAAAAAAATTAGG + Intergenic
1135739925 16:24966329-24966351 TCTACTAAAAATAAAAAGCTGGG + Intronic
1135748996 16:25041451-25041473 TCTGCCAAAAAGAAAAAATTAGG + Intergenic
1137967909 16:52955129-52955151 TCTACCAAAAAAAATAAATTAGG + Intergenic
1138532091 16:57639951-57639973 TCAACTACAAGGAAATAGTTGGG + Intronic
1138748152 16:59387591-59387613 TTTACATAAAAGAAACAGTTGGG - Intergenic
1139553966 16:67694295-67694317 TCTACAAAAAATAAAAAATTAGG - Intronic
1139868497 16:70083792-70083814 TTTACAAAAAAAAAATAGCTGGG + Intergenic
1140109756 16:71993933-71993955 TCTACTAAAAATAAAAAATTAGG - Intronic
1140144724 16:72295485-72295507 TCTGGCAAAAAGAAGTAGATGGG + Intergenic
1140358715 16:74327219-74327241 TCTACAAAAAATAAAAAGTCAGG + Intergenic
1140499667 16:75422978-75423000 TCTACAAAAAATAAAAAATTAGG + Intronic
1141106390 16:81237223-81237245 TCTACCAAAAAAAATTAGCTGGG - Intergenic
1141868666 16:86769247-86769269 TCCACTAAAAAGAAATACTTTGG + Intergenic
1142546944 17:711044-711066 TCTACAAAAAAAAATTAGCTGGG + Intronic
1143952583 17:10645486-10645508 TCTACTAAAAAAAATTAGCTGGG - Intronic
1144502930 17:15805278-15805300 TCTACTAAAAATAAAAAGCTGGG - Intergenic
1144961998 17:19049641-19049663 TCTACCAAAAATACAAAATTAGG + Intergenic
1144973163 17:19124881-19124903 TCTACCAAAAATACAAAATTAGG - Intergenic
1145086088 17:19941856-19941878 TGTGCCAAAACGAAACAGTTGGG + Exonic
1145368302 17:22284727-22284749 TTTACTAATAAGAAATAATTTGG + Intergenic
1146004220 17:29150593-29150615 GCTCCCAGAAAGAAATAGTTGGG - Intronic
1146385542 17:32369154-32369176 TCTGGCAAAAGTAAATAGTTGGG + Intronic
1146736654 17:35243921-35243943 CCTAACAAAAAGAAGTAGTGGGG + Intronic
1146889573 17:36497584-36497606 TCTAAAAAAAAAAAAAAGTTTGG - Intronic
1147233187 17:39034653-39034675 TCTACAAAAAATAAAAAATTAGG - Intergenic
1147789030 17:43001458-43001480 TCTACTAAAAAAAATTAGCTGGG + Intronic
1147846966 17:43411338-43411360 TCTACAAAAAGTAATTAGTTGGG - Intergenic
1147858949 17:43505108-43505130 TCTACAAAAAATAAAAAATTTGG + Intronic
1148162534 17:45458965-45458987 TCTACAAAAAATAACTAGCTGGG + Intronic
1148609876 17:48957889-48957911 TCTACTAAAAATAAAAAATTAGG + Intergenic
1148773871 17:50082475-50082497 TCTACTAAAAATAAAAAATTAGG - Intronic
1148788653 17:50160685-50160707 TCTACTAAAAATAATTAGCTGGG - Intergenic
1149171265 17:53814614-53814636 CCTTCTAAAAAGAAATAATTTGG - Intergenic
1149787727 17:59450310-59450332 TCTATAAAAAATAATTAGTTGGG - Intergenic
1149864662 17:60144541-60144563 TCTACAAAAAATAAAAAATTAGG - Intergenic
1150011461 17:61508429-61508451 TCTCTTAAAAAAAAATAGTTGGG + Intergenic
1150217483 17:63478498-63478520 TCTACAAAAAAAAAATAGCTGGG + Intergenic
1150393764 17:64805629-64805651 TCTACAAAAAATAACTAGCTGGG + Intergenic
1150424173 17:65064213-65064235 TCTACAAAAAATAATTAGTCGGG - Intergenic
1150456742 17:65312404-65312426 GCTAGAAAAAAAAAATAGTTTGG - Intergenic
1150589888 17:66552909-66552931 TCTACTAAAAAGACATACTTGGG - Intronic
1152513688 17:80808127-80808149 TCTACCAAAAAAAAAAAGTTAGG + Intronic
1153579715 18:6560674-6560696 TCTACTAAAAAAAAATAGCCAGG - Intronic
1153621866 18:6986917-6986939 TCTACTAAAAAAAATTAGCTGGG - Intronic
1155591852 18:27436384-27436406 TCTACTAAAAATAATTAGCTGGG - Intergenic
1155649906 18:28128879-28128901 TCTACCAGAAAAAAATAAATAGG - Intronic
1155653193 18:28165354-28165376 TCTACAAAAAATAACTAGCTGGG - Intronic
1156229514 18:35140024-35140046 CCTTCCAAAACAAAATAGTTGGG + Intronic
1156549671 18:38002593-38002615 TCTACCAATAAAAAATAAATAGG - Intergenic
1156703512 18:39852822-39852844 TCTAGCAAACAGAAATATTTGGG - Intergenic
1156745937 18:40391134-40391156 TCTACAAAAAATAATTAGTCAGG - Intergenic
1156816533 18:41317867-41317889 TATCCCAAAAAGGCATAGTTGGG - Intergenic
1157177400 18:45464136-45464158 TCTACCCAACAGAAGTAGTGGGG + Intronic
1157272917 18:46290364-46290386 TCTACAAAAAATAAAAAGATGGG + Intergenic
1157855905 18:51105453-51105475 TCTACAAAAAATAAAAAATTAGG - Intergenic
1158149396 18:54350493-54350515 AAAACCAAAAATAAATAGTTGGG - Intronic
1158914471 18:62108256-62108278 TCTATCAAAAAGATAAAGATAGG + Intronic
1158921427 18:62195859-62195881 TCTACCAAAAATAAAAAAATTGG - Intronic
1158986440 18:62822440-62822462 ACTACAAAAAAAAAATAGCTGGG - Intronic
1159391488 18:67798413-67798435 TCTAATAAAAATAAATACTTAGG - Intergenic
1159406821 18:68013769-68013791 TCTACCAAAAAAAAAAAGTCTGG + Intergenic
1159436537 18:68425383-68425405 TCTCCCTATAAGAAATAGTTTGG - Intergenic
1159760715 18:72422267-72422289 TCTAATATAAAGAAATATTTCGG - Intergenic
1160216585 18:76938222-76938244 TCTACAAAAAATAAAAAATTTGG + Intronic
1160256588 18:77252494-77252516 TCTACCTAGATGAAATAGGTGGG - Intronic
1161308745 19:3582024-3582046 TCAACCACAAAGAAACAGCTGGG - Intergenic
1161665961 19:5577140-5577162 TCTGCTAAAAAAAAATAGCTGGG - Intergenic
1161754572 19:6122616-6122638 TCTACTAAAAACAAAAAATTAGG + Intronic
1161922891 19:7279807-7279829 TCTACCAAAAAAAAAAAAATTGG + Intronic
1162298771 19:9831737-9831759 TCTACTAAAAAAAATTAGCTGGG - Intergenic
1162807038 19:13143107-13143129 TCTACAAAAATGAAATAGCCAGG + Intergenic
1163069107 19:14823285-14823307 TCTACTAAAAATAAAAAATTAGG + Intronic
1163172345 19:15540917-15540939 TCTACAAAAAACAAATAAGTTGG + Intronic
1163173611 19:15549662-15549684 TCTACCAAAAAGGAAAAAGTTGG + Intronic
1163269728 19:16245059-16245081 TCTACCAAAAATACAAAGTTAGG - Intronic
1163495356 19:17643482-17643504 TCTACTAAAAATAAAAAATTAGG - Intronic
1164626272 19:29730405-29730427 TCTTCCAACAAGTAATTGTTGGG - Intergenic
1165207426 19:34202326-34202348 TCTACAAAAAAAAAAAAATTAGG + Intronic
1165398020 19:35577758-35577780 TCTACAAAAAATAAATAAATAGG - Intergenic
1165904769 19:39187195-39187217 TCTACAAAAAAGAAAAAAATTGG - Intergenic
1166620298 19:44292356-44292378 TTTACCAAAGAGAAAGAGATAGG + Intronic
1167343618 19:48931367-48931389 TCTACCAAAAAAAAAAAGTGGGG - Intergenic
1167933241 19:52885414-52885436 TCTACCAAAAATACAAAATTAGG + Intronic
1168390338 19:56001883-56001905 TCTACCACAAAGTAATGGTGGGG + Intronic
1168477717 19:56689183-56689205 TCTACAAAAAACAATTAGCTCGG + Intergenic
1168545033 19:57243053-57243075 TCTACCAAAAAGAAATAGTTGGG + Intronic
925187197 2:1856687-1856709 TCTTTCAAAAGGAAATAGTATGG + Intronic
925228312 2:2206141-2206163 TCTACTAAAAAAAATTAGCTGGG - Intronic
925453600 2:3993506-3993528 TCTCCCAAAATTAAATACTTAGG - Intergenic
925816821 2:7761277-7761299 GCTAACAAAAAGAAATAGCTGGG - Intergenic
926337126 2:11872186-11872208 TCTACAAAAAATAATTAGCTGGG + Intergenic
926848001 2:17163107-17163129 TCTAACAAAAAGCAAGAATTAGG + Intergenic
927763422 2:25781827-25781849 TCTACTAAAAATAAATAGCTGGG - Intronic
927870724 2:26621532-26621554 TCTACAAAAAATAAATAAATAGG + Intronic
927941829 2:27108941-27108963 TCTACCAAAAAAAAAAAGCTGGG - Intronic
929512073 2:42572416-42572438 TCTACCAAAAAAAAATAGCCGGG + Intronic
929644135 2:43610442-43610464 TCTACAAAAAAAAATTAGCTGGG + Intergenic
929812540 2:45202944-45202966 TCTACCAAAAAGATACAGACTGG + Intergenic
930083078 2:47470173-47470195 TCTACTAAAAATACAAAGTTAGG - Intronic
930425234 2:51204727-51204749 TCTACCAAAAAGAGAGAGAGGGG - Intergenic
930780444 2:55219899-55219921 TCTACCAAAAAAGAAAAGGTGGG - Intronic
931373377 2:61685394-61685416 TCCACAAAAATGAAATACTTAGG - Intergenic
931646664 2:64428417-64428439 TCAACAAAAGAGAAATATTTAGG - Intergenic
932151746 2:69379356-69379378 TCTACCAAAAATAAAAAATTAGG + Intronic
932256881 2:70295170-70295192 TCTACAAAAAAAAATTAGCTGGG - Intergenic
932541429 2:72657678-72657700 ACTGACAAAAAGAAAAAGTTGGG + Intronic
932971111 2:76543543-76543565 TCAATAAAAAAGAAATATTTGGG + Intergenic
933231771 2:79815991-79816013 GCTACAAAAAAAAAATACTTAGG - Intronic
933288068 2:80406188-80406210 TCTACTAAAAATACAAAGTTAGG + Intronic
933872392 2:86580377-86580399 ACTCCCAAAAAGAAATCTTTAGG + Intronic
934516324 2:94990000-94990022 TCCCCCAAAATGAAATACTTAGG + Intergenic
934648753 2:96074859-96074881 ACTACCCAAAAGAAATAGAAAGG - Intergenic
935518930 2:104079191-104079213 TTTCCCAAAATGAAATACTTAGG - Intergenic
935602498 2:104937181-104937203 TCTGCTAAAAAGCAAAAGTTAGG - Intergenic
936473046 2:112815837-112815859 TCTACTTAAAAGAAATAATCAGG - Intergenic
936594655 2:113836305-113836327 TACACCAAAAAGAAATATTAAGG - Intergenic
937064772 2:119009638-119009660 TCTACCAAAGAGAAACATTTTGG - Intergenic
937417000 2:121723391-121723413 TCTACCAAAAATAGTTAATTGGG + Intergenic
937672482 2:124553201-124553223 TGTTCCAAGAAGAAATAGTTGGG + Intronic
938040642 2:128073218-128073240 TCTACCAAAAATACAAAGCTGGG - Intergenic
938204371 2:129405316-129405338 TCTGCAAAAAAGAAAGATTTTGG + Intergenic
938371868 2:130774417-130774439 TCTACTAAAAAAAATTAGCTGGG + Intergenic
938507365 2:131900443-131900465 TCTACAAAAAATAAAAAATTAGG + Intergenic
939040608 2:137184895-137184917 TCTCCCAAAATGAAATTATTGGG + Intronic
939130703 2:138232830-138232852 TATATCAACTAGAAATAGTTTGG + Intergenic
939247190 2:139640829-139640851 TATACAAAACAGATATAGTTGGG - Intergenic
939661218 2:144892396-144892418 TCTACCAAAGAGAATTTGCTAGG + Intergenic
939695542 2:145319092-145319114 TTTACCAATAAAAAATATTTTGG - Intergenic
940738131 2:157476962-157476984 TGTAACAAAAATAAATAGATTGG - Intronic
941315163 2:163982882-163982904 TCTACCTAAAAGAATTATTTTGG + Intergenic
941386394 2:164857837-164857859 TCAACCACAAAGAAGTTGTTGGG - Intergenic
941524446 2:166589171-166589193 TCAAGAAAAGAGAAATAGTTTGG - Intergenic
941559028 2:167021658-167021680 TCTACAAAAAATAAAAAATTAGG + Intronic
941853031 2:170203327-170203349 TCTACTTAAAAGAAATGGTTTGG + Intronic
942180074 2:173371998-173372020 TCTACAAAAAATAAAAAATTAGG + Intergenic
942307077 2:174619112-174619134 TCTAAAAAAAAGAAACAGCTGGG - Intronic
942437015 2:175989878-175989900 TCTACCATAAAGAATAATTTTGG + Intronic
942752692 2:179305713-179305735 TCTACAAAAAAAAAATAGCGGGG + Intergenic
942840646 2:180357275-180357297 TCTACTTAAAAGATATAGATTGG - Intergenic
942883859 2:180897980-180898002 TCTACAAAAAAGAATTAGTAAGG + Intergenic
943574349 2:189613676-189613698 TCAACTGAAAAAAAATAGTTTGG - Intergenic
944248547 2:197558070-197558092 TCTACTAAAAATAAAAAATTAGG - Intergenic
944717339 2:202388625-202388647 AATACAAAAAAGAATTAGTTGGG + Intronic
944979560 2:205100448-205100470 TCTGCAAAAAAAAAACAGTTGGG - Intronic
945081537 2:206090911-206090933 TCTACCTAAAATAAAGATTTTGG + Intergenic
945442629 2:209897847-209897869 TCTCCCATAAAGAAATTTTTAGG - Intronic
945777977 2:214131206-214131228 TCTACCAAAAAAAAGTAGCTGGG + Intronic
947216859 2:227757724-227757746 TCTACCATAGAGAAATATTCAGG - Intergenic
947532692 2:230922867-230922889 TCTACAAAAAATAAAAAATTAGG - Intronic
1169827974 20:9790664-9790686 TCTACAAAAAATAAAAAATTAGG - Intronic
1169869863 20:10238742-10238764 TCTACTAAAAATAAAAAATTAGG + Intronic
1170045255 20:12078330-12078352 TCTTCCAAAAAGAAATAGAGAGG - Intergenic
1170224955 20:13982207-13982229 ACTACTAGAAAGAAATAGATGGG + Intronic
1172241867 20:33418413-33418435 TCTACAAAAAATTAATAGCTGGG - Intronic
1172425518 20:34853108-34853130 TCTACTAAAAAAAATTAGCTAGG - Intronic
1172461941 20:35125682-35125704 TCTACAAAAAATAAAAAATTAGG - Intronic
1172609947 20:36243016-36243038 TCAACCAAAAATAATTAGCTGGG - Intronic
1172708090 20:36898031-36898053 TCAAAAAAAAAGGAATAGTTAGG - Intronic
1173233405 20:41220852-41220874 TCTACAAAAAAAAAATAGCTGGG - Intronic
1174014536 20:47477151-47477173 TCTACAAAAAATAAAAAATTAGG + Intergenic
1174144316 20:48440430-48440452 TCTTGGAAAAAAAAATAGTTTGG + Intergenic
1174214265 20:48904075-48904097 AATACCAAAAAAAATTAGTTGGG + Intergenic
1174313775 20:49681053-49681075 TCTACCAAAAACAATTAGCCAGG + Intronic
1174496890 20:50951902-50951924 CATACCAAATAGAAATAGTTTGG - Intronic
1174690128 20:52495900-52495922 TCTAGAAAAAAAAAATAGCTGGG + Intergenic
1174798436 20:53541797-53541819 TCTAAAAAAAAAAAATAGGTGGG + Intergenic
1175464421 20:59180250-59180272 TCTACAAAAAATAAATAATTAGG - Intergenic
1175882244 20:62267082-62267104 TCTACAAAAAAGAATTAGCCGGG + Intronic
1176786262 21:13259884-13259906 TCTACAAAAAATAAAAAATTAGG - Intergenic
1177035416 21:16036988-16037010 TCTACAAAAAAAAATTAGCTGGG - Intergenic
1177476842 21:21634312-21634334 GCATCCAAAAAGAGATAGTTTGG - Intergenic
1178527492 21:33343988-33344010 TCTACTAAAAATAATTAGCTGGG + Intronic
1179351397 21:40614583-40614605 TCTACCACCAAGATATAGTCTGG + Intronic
1180115553 21:45701723-45701745 TCTACTAAAAATAAAAAATTAGG - Intronic
1180637411 22:17272100-17272122 TCTACCAAAAATATAAAATTTGG - Intergenic
1180974422 22:19839575-19839597 TCTACAAAAAATAATTAGCTGGG + Intronic
1181095588 22:20503170-20503192 TCTACTAAAAATAAAAAGTAAGG + Intronic
1181946645 22:26522908-26522930 TTTACAAAAAATAAAAAGTTAGG + Intergenic
1182449970 22:30413994-30414016 TCTACCAAAAATAAAAATTTAGG - Intronic
1182563772 22:31182765-31182787 TCTACAAAAAATAAATAGCATGG - Intronic
1183367271 22:37413399-37413421 TCTACAAAAAAAAAAAAGCTTGG + Intronic
1183443189 22:37835195-37835217 TCTACTAAAAATAAAAAATTAGG + Intronic
1184352024 22:43950775-43950797 TCTACAAAAAAAAACTAGCTGGG - Intronic
949537770 3:5009052-5009074 TCTACCAAAAAAAAAAAGCCAGG - Intergenic
949774338 3:7614517-7614539 TCTACTTAAAACATATAGTTGGG + Intronic
949925843 3:9040722-9040744 TCTACTAGAAAAAAATAGCTGGG - Intronic
950063953 3:10096181-10096203 TCCATCAAACAGGAATAGTTTGG - Intronic
950690772 3:14655148-14655170 TCTACAAAAAAAAATTAGTCAGG + Intronic
950971891 3:17197535-17197557 TCTACCAAAAAAAATTAGCTGGG - Intronic
951211677 3:19982074-19982096 TCTACCAAAAAAAAAAAGCCAGG + Intronic
952949500 3:38508877-38508899 CTTAACAAAAAGAAGTAGTTGGG - Intronic
953336007 3:42094535-42094557 GCTACCAAAAAAAAATAGCCAGG - Intronic
953965081 3:47298212-47298234 TCTACCAAAAATAAAAAAATTGG + Intronic
954786190 3:53094216-53094238 TCTACCAAAAAGAAAAAAGAAGG + Intronic
954908423 3:54083000-54083022 TCTACCAAAAAAAATTACTTAGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955324816 3:58001825-58001847 TCTACCAAAAATACAAAATTAGG + Intergenic
956139895 3:66135600-66135622 TTTACCAAAAATAAAAAATTAGG + Intronic
957075027 3:75595339-75595361 CCTACCAAAAAGAATTAGCCAGG - Intergenic
957466567 3:80600788-80600810 GCTACAAAAATGAAATAATTAGG + Intergenic
957678951 3:83406453-83406475 TCTACCAAAAATACAAAATTAGG + Intergenic
957816904 3:85311980-85312002 TCTGGCAAATAGAAATATTTTGG - Intronic
957981538 3:87517743-87517765 TCTACAAATGAGAAGTAGTTTGG - Intergenic
958130805 3:89419499-89419521 TTTACCAAAAAGAAAAGTTTAGG + Intronic
958705805 3:97653750-97653772 TCATTCAAAAAGAAATATTTAGG - Intronic
958714826 3:97766918-97766940 TCTACCACAAAGTAATGGTTTGG + Intronic
958869997 3:99547119-99547141 TTTAACAAAAAGACATGGTTTGG - Intergenic
959002679 3:100982699-100982721 TCTTGTAAAAAGGAATAGTTAGG + Intronic
960635180 3:119777896-119777918 TCTACCAGAAAAAAATAGCTGGG + Intergenic
960701347 3:120442477-120442499 TCTATGAAAAAGACAGAGTTAGG + Intronic
961704922 3:128776850-128776872 ACTACCAAAAAGACAAAGATTGG - Intronic
961760877 3:129166567-129166589 TCTACTAAAAAAAATTAGCTGGG + Intergenic
961997224 3:131258852-131258874 TACACCAAAATTAAATAGTTGGG - Intronic
962166267 3:133052216-133052238 TCTCCAAAAATGAAATACTTAGG - Intronic
962793562 3:138832524-138832546 TCTACCAAAAATACAAAGATTGG + Intronic
963982907 3:151560089-151560111 TATACCAAAAAGGCATATTTTGG - Intergenic
964081559 3:152764795-152764817 TCTAAAAAAAAAAAATAGTGGGG + Intergenic
964922494 3:161914308-161914330 TCAACCAAGAAAAAATAATTTGG + Intergenic
966745703 3:183274556-183274578 TCTACCATAAACAAATAATTCGG - Intronic
967245419 3:187481892-187481914 TGTAACAAAAACAAATACTTGGG - Intergenic
967469377 3:189844062-189844084 ACTACCAAAAATAAAAAGTAGGG - Intronic
968828257 4:2915338-2915360 TCTACCAAAAATACAAAATTAGG + Intronic
968981408 4:3851902-3851924 TCTATCTAAAAGATATAATTTGG + Intergenic
970273789 4:14375428-14375450 TCTACAAAAAAAAATTAGCTGGG + Intergenic
970280713 4:14451891-14451913 TCAAGCAAAAACAAACAGTTTGG + Intergenic
970755218 4:19417696-19417718 TCTACCAAAAAAAAAAAATGTGG + Intergenic
970864891 4:20746924-20746946 TCTAGAAAATAGAAATGGTTAGG - Intronic
971117786 4:23668102-23668124 TCCAGGAAAAGGAAATAGTTAGG + Intergenic
971210794 4:24614239-24614261 TCTACCAAAAAAAAAAAAATTGG + Intergenic
971297864 4:25415243-25415265 GTAACCAAAAAGAAATAATTGGG + Intronic
971558640 4:28045909-28045931 AATACAAAAAAAAAATAGTTGGG - Intergenic
972296327 4:37742790-37742812 TCTACAAAAAAAAAATAGCTGGG - Intergenic
972407566 4:38761447-38761469 TCTACTAAAAATAAAAAATTAGG + Intergenic
972463497 4:39329333-39329355 TCTACCAAAAAAAATTAGCTGGG + Intronic
972530963 4:39960986-39961008 TCTACAAAAAATAAAAAATTAGG - Intronic
974213348 4:58811782-58811804 CCTATTAAAAAGACATAGTTTGG - Intergenic
974393361 4:61303141-61303163 TCTTCCAAAAAGCAAATGTTTGG - Intronic
974808433 4:66914112-66914134 TCTAAGAAAAAGAGATATTTTGG + Intergenic
975208181 4:71668299-71668321 TATCTCAAAAAGAAATATTTTGG - Intergenic
975567051 4:75768179-75768201 TCTACAAAAAATAAAAATTTAGG - Intronic
976197134 4:82543970-82543992 TCTTGCAAAATGATATAGTTAGG - Intronic
976986043 4:91299378-91299400 ACTACCAAAAAGGTATAGTTGGG - Intronic
977228873 4:94427863-94427885 TCTACAAAAAATTAATAATTAGG + Intergenic
977639470 4:99340251-99340273 TCTACCCAAAAAAATTAGCTGGG + Intronic
977659959 4:99573472-99573494 CCTAGCAAAAATAAATTGTTTGG - Intronic
977790189 4:101090475-101090497 TCTACTAAAAATAAAAAATTAGG + Intronic
977962609 4:103103068-103103090 TCTACCAAAAAAAAACAATTTGG - Intergenic
977989556 4:103424449-103424471 TCCCCCAAAAAGAAATAACTGGG - Intergenic
978652116 4:111018426-111018448 TCCACAAAAAAGGAAAAGTTGGG - Intergenic
979633560 4:122931557-122931579 TCTACCAGAAAGAATTACTTTGG - Intronic
979914675 4:126415494-126415516 TGTATGAAAAAGAAATACTTGGG - Intergenic
980341218 4:131549541-131549563 TCTACCAAGAGGAGATGGTTGGG + Intergenic
981191084 4:141864470-141864492 TCTAATAATAAAAAATAGTTGGG - Intergenic
981906263 4:149924742-149924764 TCTACTAAACAGAAATTGTGAGG + Intergenic
982024872 4:151242024-151242046 TCTACAAAAAACAAAAAATTTGG + Intronic
982865914 4:160511692-160511714 GCTTGCAAAAAGAAACAGTTGGG - Intergenic
984811549 4:183799788-183799810 TTAACCAAAGAGAAATATTTTGG + Intergenic
985004160 4:185516200-185516222 TCTGCCAAATAGAAAGATTTGGG - Intronic
985311872 4:188611033-188611055 TCTACAAAAAAGAGATACTGGGG + Intergenic
987239326 5:15977941-15977963 TCTCCAAAAAATACATAGTTGGG + Intergenic
987676533 5:21081133-21081155 TCACCCAAAATGAAATAATTAGG + Intergenic
988462160 5:31449560-31449582 TCTACAAAAAATAAAAAATTAGG + Intronic
989214980 5:38894743-38894765 ACAACCACAAAAAAATAGTTGGG + Intronic
989335211 5:40308324-40308346 TCTACTAAGAAGAAATAAATTGG - Intergenic
989548576 5:42704557-42704579 GCTAGCATCAAGAAATAGTTTGG + Intronic
991010278 5:61875137-61875159 TCTACCAATAAGACCTACTTTGG - Intergenic
991023800 5:62008427-62008449 AATACAAAAAAGAAATAGCTGGG + Intergenic
991379269 5:66002607-66002629 TCAACTAAAAAGAAATACCTTGG - Intronic
991497085 5:67237198-67237220 TGTGCCATAAAGAAAAAGTTAGG + Intergenic
992052068 5:72950315-72950337 TCTACAAAAAATAAAAAATTAGG + Intergenic
992272526 5:75079935-75079957 TCTACAAAAAAAAATTAGCTGGG + Intronic
992805828 5:80336834-80336856 TCTACAAAAAATAAAAAATTAGG - Intergenic
992980273 5:82163091-82163113 TTGACCAAAAAGAAAGAATTTGG + Intronic
992995486 5:82328567-82328589 TATGCCAAAGAGAAATAGATGGG - Intronic
994030943 5:95142105-95142127 TATAATAAAAAGAAATAGTGGGG - Intronic
994169414 5:96642371-96642393 TCTTCCAAGAAGAAATAGCCTGG + Intronic
994547772 5:101188301-101188323 TCTACTTAAAAGATATAGATTGG + Intergenic
994675863 5:102821435-102821457 TGGCCCAGAAAGAAATAGTTTGG - Intronic
994701842 5:103143349-103143371 TCTACAAAAAATAATTACTTGGG - Intronic
996209718 5:120792985-120793007 TCTACAAAAAATAAAAAATTAGG + Intergenic
996588305 5:125116355-125116377 TCCAGGAAAAAGAAAAAGTTTGG - Intergenic
996884470 5:128339447-128339469 TCTACAAAAAAAAAATTATTGGG + Intronic
997575333 5:134971258-134971280 TCTATTAAAAAAAAAAAGTTGGG + Intronic
997948349 5:138222003-138222025 TCTACCAAAAACACAAAGATTGG + Intergenic
997971021 5:138402087-138402109 TCTACCAAAAAAAATTAGCTGGG - Intronic
998256148 5:140590597-140590619 AATACCAAAAAAAAATAGTCAGG - Intronic
998737014 5:145153594-145153616 ACTACCAAAAGGAAATATTGGGG - Intergenic
998861191 5:146445997-146446019 TCTACTAAAAACAAATAGCCCGG - Intergenic
999182185 5:149677516-149677538 TCTATCAAAAAAAATTAGCTGGG + Intergenic
999885973 5:155923256-155923278 TTTACCAAAAAGACATATATTGG + Intronic
999984609 5:156991428-156991450 TCTACCAAAAAAAAATTGCCAGG - Intergenic
999990302 5:157043893-157043915 TCTATCAAATGGAAATACTTAGG + Intronic
1000436765 5:161220531-161220553 TCTACCACGAGGAAATAGTAGGG - Intergenic
1000638563 5:163672908-163672930 TCTTCCAAAGTGAAATACTTAGG + Intergenic
1000873589 5:166607100-166607122 TATAACAAAAAGAAAAAGCTGGG - Intergenic
1000881753 5:166705971-166705993 TCTACCAAGATGATACAGTTTGG + Intergenic
1002340171 5:178511129-178511151 TTTAGCAAAATGAAAAAGTTGGG - Intronic
1002530223 5:179840103-179840125 TCTACTAAAAATAATTAGCTGGG - Intronic
1002767456 6:254731-254753 TCTACAAAAATTAAATAGCTGGG - Intergenic
1003069116 6:2930558-2930580 TCTTCCAAAAAGAAGAGGTTTGG - Intergenic
1003704223 6:8506475-8506497 TCTACCAAGAAGGAATTGTTTGG + Intergenic
1003834784 6:10059107-10059129 ACTACCTAAAAGAAATATTCAGG + Intronic
1003942283 6:11042145-11042167 TCTACCAAAAATACACAGATTGG + Intronic
1004253502 6:14042165-14042187 TATGCCCAAAAGAAATAGTCAGG + Intergenic
1004588230 6:17024032-17024054 TCCCCCAAAATGAAATACTTAGG - Intergenic
1004714094 6:18200037-18200059 TCTACCAGAAATACATAGTCGGG - Intronic
1004929055 6:20444044-20444066 TCTACAAAAAAAAATTAGTCAGG + Intronic
1005022964 6:21435164-21435186 TCTACCAAAAATACAAAGTCAGG + Intergenic
1005518880 6:26580923-26580945 TCTACCAAAAATACAAAATTAGG - Intergenic
1005655938 6:27937636-27937658 TTTGCCAAAAAGAAATACATTGG - Intergenic
1006197310 6:32253531-32253553 TCTTCCAAAAAGAGAAAGTTGGG - Intergenic
1006527478 6:34619518-34619540 TCTACAAAAAGTAAATAGTCAGG - Intronic
1006660459 6:35638202-35638224 TCTACCAAAAATGATTAATTTGG - Intronic
1006688953 6:35862988-35863010 TCTACTAAAAAAAATTAGCTGGG + Intronic
1007678315 6:43616426-43616448 TCTACTAAAAAAAATTAGCTGGG + Intronic
1007865914 6:44970502-44970524 ATTACTTAAAAGAAATAGTTTGG - Intronic
1008135442 6:47770876-47770898 TCTACCTAAAAGAAATCAGTAGG - Intergenic
1008555531 6:52670248-52670270 TCTACAAAAAAAAAATAGTCGGG + Intergenic
1009818954 6:68774850-68774872 TCTAGCAAAAAAAAATACTCAGG + Intronic
1010242786 6:73632136-73632158 TCTACAAAAAATAATTAGCTAGG + Intronic
1010736428 6:79449158-79449180 TCTACTAAAGAGAAATAATTTGG + Intergenic
1010800275 6:80167405-80167427 TCTATTAAAAAAAAATAGTAAGG - Intronic
1011096490 6:83671373-83671395 TCTACCAAAAAGAACTGATAAGG - Intronic
1011689658 6:89854836-89854858 TGTACCATCAAGAAATTGTTTGG + Exonic
1011930967 6:92712173-92712195 TCTAAAAAAAAAAAATAGCTGGG + Intergenic
1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG + Intergenic
1012043084 6:94235056-94235078 TCCAACAAAATGAAATACTTAGG + Intergenic
1012919264 6:105204230-105204252 TCTACCACAAAGAAAAATCTAGG + Intergenic
1013095587 6:106941856-106941878 TCTACTAAGAAGTGATAGTTTGG - Intergenic
1013209654 6:107975036-107975058 TCTACAAAAAAGAAAAAGATTGG - Intergenic
1013823740 6:114185897-114185919 TCTACTAATAAAAATTAGTTTGG - Intronic
1013895866 6:115086877-115086899 TCTCAGAAAAAGAAAGAGTTGGG - Intergenic
1014493422 6:122090412-122090434 TCTACTAAAAATAAAAAATTAGG + Intergenic
1015518791 6:134111483-134111505 TCTACAAAAAAGAATTAGCGAGG - Intergenic
1015620275 6:135124858-135124880 TCTCCAAAAGAGAAAAAGTTAGG + Intergenic
1015687516 6:135881505-135881527 TCAAAAAAAAAGAAATAGTAAGG + Intronic
1015817767 6:137228403-137228425 TACACCAAAAAGGGATAGTTAGG + Intergenic
1016138616 6:140580258-140580280 ACCTCCAAAAAGAAATAATTTGG + Intergenic
1016684944 6:146870612-146870634 TCTACAAAAAAAAATTAGCTGGG - Intergenic
1017523951 6:155226502-155226524 TCTACTAAAAAAAATTAGCTGGG + Intronic
1017545142 6:155442593-155442615 TCAACCACAAAGAAAGAGGTAGG + Intronic
1017808180 6:157964535-157964557 TCTACAAAAGATAAAAAGTTAGG + Intergenic
1017833928 6:158159336-158159358 TCTACCAAAAAGAATTAGCCAGG + Intronic
1017872738 6:158500897-158500919 TCTACTAAAAATACATAGCTGGG + Intronic
1018014149 6:159696874-159696896 TCTACCAAAAAACAGTAGCTGGG + Intronic
1020258799 7:6518764-6518786 ACTAGCAAAAATAAAAAGTTGGG + Intronic
1020430182 7:8110559-8110581 TCTACTAAAAGAAATTAGTTGGG - Intergenic
1021363306 7:19744510-19744532 TGTAGCAAAAAGAAATAATTTGG + Intronic
1021875990 7:25049801-25049823 CCTAACAAAAAGACATAGATAGG - Intergenic
1022221922 7:28322132-28322154 TCTACCCAAAAGCATTAGATGGG + Intronic
1022271657 7:28813552-28813574 TCTACCAAAACAAAAAAGCTGGG + Intronic
1022374340 7:29799647-29799669 TCTTTCAAAAAATAATAGTTAGG - Intergenic
1022482843 7:30755233-30755255 TCTCCCAAAGAAAAATGGTTAGG - Intronic
1022894102 7:34732013-34732035 TCTACCAAAAAAAATTAGCCAGG + Intronic
1022999707 7:35795972-35795994 ACAACAACAAAGAAATAGTTTGG + Intergenic
1023246464 7:38210216-38210238 TCTACCAAAAAAAACTATATGGG + Intronic
1023264189 7:38388964-38388986 TCTACCACAATAAAATAGATTGG - Intronic
1023322664 7:39015138-39015160 TCTAAGAATAAGAAATTGTTAGG - Intronic
1024417880 7:49129120-49129142 ACTACCAATAAGAAATTGTGTGG - Intergenic
1024484434 7:49901463-49901485 ATCACCAAAAAGAAATACTTAGG + Intronic
1024831171 7:53459859-53459881 TCTACCAAAAATAAATTAGTTGG + Intergenic
1025073508 7:55922375-55922397 TCCACCAAAAATATATAGCTGGG + Intronic
1025074624 7:55932361-55932383 TCTACCAAAAAAAAAAAGGCAGG + Intronic
1026788269 7:73315518-73315540 TCTACAAAAAATAATTAGTGGGG - Intronic
1026928850 7:74211755-74211777 TCTACTAAAAATAAAAAATTAGG - Intronic
1026963582 7:74425174-74425196 TCTACAAAAAATAAAAAATTAGG + Intergenic
1027164843 7:75827092-75827114 TCTACCAAAAATTAAAAATTTGG + Intergenic
1027469168 7:78552346-78552368 TCTACCAAAAATACAAAATTAGG - Intronic
1027894243 7:84020610-84020632 TTTACCAAAATGAAAAAGGTAGG - Intronic
1027899838 7:84098321-84098343 TTTACCAAAAGGAAAAAGTTAGG - Intronic
1027974252 7:85129049-85129071 TCTACAAAAAAAAATTAGCTGGG - Intronic
1028273883 7:88826892-88826914 TCTAACAGAAAGGAATATTTTGG + Intronic
1028972270 7:96872171-96872193 TCTACTAAAAAAAATTAGCTGGG + Intergenic
1029344576 7:99969106-99969128 TCTACCAAAAATATAAAATTAGG + Intronic
1029387040 7:100249961-100249983 TCTACAAAAAATAAAAAATTAGG - Intronic
1029650208 7:101886352-101886374 ACTACAAAAAAAAATTAGTTGGG - Intronic
1029715436 7:102322902-102322924 TCTACCAAAAAAAATTAGCTAGG - Intergenic
1030224846 7:107138842-107138864 TCTACCAAAAAAAATAAGCTGGG - Intronic
1030720196 7:112862088-112862110 TCTACAAAAAATAAAAAATTAGG + Intronic
1030799562 7:113832897-113832919 TCCAGAAAACAGAAATAGTTAGG - Intergenic
1031045149 7:116879326-116879348 CCTAATAAAAAGAAACAGTTTGG - Intronic
1031602220 7:123723831-123723853 TCAACCAAAAAGGAATTTTTTGG - Intronic
1031791047 7:126104938-126104960 TTCACCAAAAAGATATAGATGGG + Intergenic
1031810429 7:126361136-126361158 TCTCCCAAAAAGACCTAGTAAGG + Intergenic
1032016790 7:128385223-128385245 TCTACAAAAAAAAAATAGGCAGG - Intergenic
1032304543 7:130720448-130720470 TCTACTAAAAATACAAAGTTGGG - Intergenic
1032864039 7:135908329-135908351 TCTACAAAAAAAAATTAGCTGGG - Intergenic
1032963230 7:137065185-137065207 TCTACCTAGAAGCCATAGTTTGG + Intergenic
1033105422 7:138516939-138516961 TCTACAAAAAAAAATTAGCTGGG + Intronic
1033342431 7:140502558-140502580 TCTACAAAAAACAAAAAATTAGG + Intergenic
1033356643 7:140605887-140605909 TCTATCAGGAATAAATAGTTTGG - Intronic
1033556053 7:142489293-142489315 AATACCAAAAAGAATTAGCTGGG - Intergenic
1033607343 7:142936997-142937019 TCTACAAAAAAAAATTAGCTGGG + Intergenic
1033857826 7:145586897-145586919 TCTACTAAAAAAAATTAGCTGGG + Intergenic
1033944240 7:146695569-146695591 ACAATCAAAAACAAATAGTTGGG - Intronic
1034537062 7:151731996-151732018 TCTACAAAAAATAGTTAGTTGGG - Intronic
1035134639 7:156689640-156689662 TCTACCTTAAAAAAATATTTTGG - Intronic
1035215064 7:157359656-157359678 TTGACCAAAAAAAAATAGTTGGG + Intronic
1036034539 8:5004554-5004576 TGTACCAGAAAGAAAAAATTTGG + Intergenic
1036181815 8:6592310-6592332 TCTACCAAAAATAATTAGCCGGG - Intronic
1036412729 8:8517801-8517823 TCTAACAAAAGGCAATTGTTGGG + Intergenic
1036635365 8:10546844-10546866 TCTACAAAAAATAATTAGCTAGG - Intronic
1036775537 8:11609610-11609632 GCTACCAAAAAGAAAAGGCTAGG + Intergenic
1037112688 8:15183728-15183750 TCTAGCAATTATAAATAGTTGGG - Intronic
1037176374 8:15951170-15951192 TCTACCAAAAATAAATTTTAAGG + Intergenic
1037481224 8:19307726-19307748 TCTACAAAAAATAAAAAATTAGG + Intergenic
1037972739 8:23185749-23185771 AATACCAAAAAGAAAAAATTAGG + Intergenic
1038174417 8:25167083-25167105 AATACAAAAAAAAAATAGTTGGG - Intergenic
1039296730 8:36164421-36164443 TATACAAAAAAAAAATAGCTGGG + Intergenic
1039651732 8:39348264-39348286 CCTACCAAAAAGAAATGGAAGGG + Intergenic
1039674781 8:39650544-39650566 TCTACAAAAAATAAATACTTGGG + Intronic
1039700969 8:39961485-39961507 TCTACTAAAAATAAAAAATTAGG - Intronic
1040517853 8:48148905-48148927 TACAAAAAAAAGAAATAGTTGGG + Intergenic
1041091264 8:54303144-54303166 TTTATTAAAAAGAAAAAGTTGGG + Intergenic
1041266634 8:56072075-56072097 TCTACAAAAAACAATTAGCTGGG + Intronic
1041441282 8:57899516-57899538 TCTACCAAAATAAATTAGCTAGG + Intergenic
1041534548 8:58911401-58911423 TATAACAATAAGAAATAGTATGG - Intronic
1041995282 8:64048577-64048599 ACCACCAAAAAGAAATTGGTTGG + Intergenic
1042610594 8:70595683-70595705 TCTACCAAAATGACAAATTTGGG + Intronic
1042626133 8:70759185-70759207 TCTACCAAATAGAAAACATTTGG - Intronic
1042653031 8:71063843-71063865 TCTAAAAAATAGACATAGTTAGG + Intergenic
1043075990 8:75699973-75699995 TCTACCATATTGTAATAGTTTGG - Intergenic
1043320418 8:78977963-78977985 TCCCCCAAAATGAAATACTTAGG - Intergenic
1043753603 8:83972308-83972330 TCTACCTCCAAGAAATACTTTGG - Intergenic
1043924723 8:86023998-86024020 TCTACAAAAAATAAAAAATTGGG + Intronic
1043990510 8:86747405-86747427 TCTACTAGAAAGAAACATTTAGG + Intergenic
1044979623 8:97703197-97703219 TCTACAAAAAAAAATTAGCTGGG + Intronic
1045448549 8:102293949-102293971 TCATCCAAAAAGAAAAAGTAAGG - Exonic
1045755751 8:105539138-105539160 CCTACCTCAAAGAGATAGTTTGG + Intronic
1046399059 8:113679496-113679518 TTTACCAAGAAGAAATAGACAGG - Intergenic
1046581034 8:116092636-116092658 TCTAACAAAAAGAGACAGTTGGG + Intergenic
1046725383 8:117668027-117668049 TCTACTAAAAATAAAAAATTAGG + Intergenic
1047164856 8:122426362-122426384 CCTACCAAAAAGAAAAAGCCTGG - Intergenic
1047298728 8:123594280-123594302 TCTGACAAAAAAAAATATTTTGG - Intergenic
1050211317 9:3261004-3261026 TATACCAAAAAGTAACATTTGGG - Intronic
1050337119 9:4600361-4600383 TCTACCGAAAAGAGAAAGTCAGG + Intronic
1050598827 9:7230473-7230495 TCTACAAAAAACAAATACCTGGG + Intergenic
1050660033 9:7874617-7874639 ATTGCCAAATAGAAATAGTTGGG + Intronic
1050982159 9:12034117-12034139 TCTAGGAAAATGAAATGGTTTGG + Intergenic
1051184559 9:14445115-14445137 TATACCAGCAACAAATAGTTGGG - Intergenic
1051212266 9:14757387-14757409 TCTACCAAAAACAAAAAAATTGG + Intronic
1051466431 9:17383351-17383373 TCTACCAAAAAAAAAAAGTTGGG + Intronic
1052169145 9:25372351-25372373 TCTACTAAAAATAAAAAGGTGGG + Intergenic
1052249008 9:26375153-26375175 TCTACCAAAAAACAGTAGCTGGG + Intergenic
1052508701 9:29386421-29386443 TCTTCCAAATAGAAATATCTGGG - Intergenic
1052536117 9:29749644-29749666 TCTACTAAAAATAAAAAATTAGG - Intergenic
1052935716 9:34091336-34091358 ACAACAAAAAAGAAATAGCTGGG + Intronic
1053244701 9:36525221-36525243 TCTATAAAAAAGAAAAAGATGGG - Intergenic
1053402885 9:37843180-37843202 TCTACAAAAAATAAAAAATTAGG - Intronic
1054703182 9:68434638-68434660 TCTACTAAAAACACAAAGTTTGG + Intronic
1054973107 9:71112065-71112087 TCTACCCAACTGAAATATTTTGG - Intronic
1055239941 9:74171538-74171560 TCTCACAACAAGAACTAGTTGGG + Intergenic
1055332039 9:75195065-75195087 TCTATCAAAAAGTTATAGCTCGG + Intergenic
1056225909 9:84495147-84495169 TCCACCAAAAGTAAATAGATAGG - Intergenic
1056350801 9:85746627-85746649 TCTAACAAAAAGAAAGAGTGGGG + Intergenic
1057124982 9:92609899-92609921 TCTACTAAAAAAAATTAGCTGGG - Intronic
1057370805 9:94471386-94471408 TCTACTAAAAAAAAAAAATTTGG + Intergenic
1058127784 9:101215444-101215466 TCTACTAAAAATAAAAAATTTGG - Intronic
1058133025 9:101274882-101274904 TGTACCCAAAAGAAATGGTTAGG + Intronic
1058305012 9:103429183-103429205 TCTCAAAAAAAGAAATATTTTGG + Intergenic
1058325685 9:103694637-103694659 TGTACCCAAAAGAAATAGTCTGG - Intergenic
1059127679 9:111708806-111708828 TCTACCAAAAATAAATTGTGTGG - Intronic
1059808289 9:117828440-117828462 TCTACCCAAAAGGAATAAATTGG - Intergenic
1061124988 9:128669063-128669085 TCTACTAAAAATATATAATTGGG + Intergenic
1061522965 9:131132277-131132299 TCTACTAAAAATACATAGCTGGG - Intronic
1061741482 9:132709387-132709409 TCTCTTAAAAAAAAATAGTTGGG + Intergenic
1062263660 9:135676609-135676631 TCTACGAAAAATAAATAGCTGGG - Intergenic
1062335649 9:136065317-136065339 TCTACAAAAAATAAATAATTAGG + Intronic
1203734713 Un_GL000216v2:125758-125780 TCTACAAAAAAAAATTAGCTTGG + Intergenic
1203677285 Un_KI270756v1:33550-33572 TCTAACGGAAAGAAATAGTATGG - Intergenic
1185615827 X:1421264-1421286 TCTACAAAAAATTAACAGTTAGG - Intronic
1186465700 X:9783002-9783024 TCTACAAAAAATAAAAAATTAGG + Intronic
1187381773 X:18808373-18808395 TGTACTAAAAAGAATGAGTTAGG - Intronic
1187447109 X:19369747-19369769 TCTACTAAAAAAAATTAGCTGGG + Intronic
1188362205 X:29269000-29269022 TCTACCGAAAAGATGTAGCTGGG - Intronic
1190002191 X:46699701-46699723 TCTACCAAACTGAAGCAGTTGGG - Intronic
1190011350 X:46787769-46787791 TCTCCAAAAATGAAATACTTAGG + Intergenic
1190038750 X:47051793-47051815 TCTCCCAAAAAAAAAAAATTAGG + Intronic
1190100840 X:47521802-47521824 GCAACCAATAGGAAATAGTTTGG + Intergenic
1190229463 X:48570910-48570932 TCTAACAAAAAGAAGTAATGAGG - Intergenic
1190724867 X:53182386-53182408 TTTACCACAATGAAAAAGTTTGG - Intergenic
1190768909 X:53498897-53498919 TCTCTCAAAAAGAAAAAGATGGG + Intergenic
1191603377 X:63034657-63034679 ACTACCAAAAAAAATTAGCTGGG + Intergenic
1191938592 X:66453261-66453283 TTTCCCAAAAAGGAATGGTTTGG - Intergenic
1192981229 X:76345055-76345077 TCGAAAAAAAAGAAAAAGTTAGG - Intergenic
1193150364 X:78118415-78118437 TCTACAAAAAAAAATTAGCTGGG + Intronic
1193460098 X:81780604-81780626 TCTCCCAAAATGAAATACTTAGG + Intergenic
1194489135 X:94525374-94525396 TTAACCAAAAAGAAATACCTAGG + Intergenic
1194979029 X:100421603-100421625 TATACCAAAAAAAAAGAGGTTGG + Intergenic
1195642237 X:107188850-107188872 TCTAAAAAAAAGAAATACCTAGG + Intronic
1196040288 X:111195402-111195424 GCTACCCATTAGAAATAGTTTGG + Intronic
1196063589 X:111438103-111438125 TCTACAAAAAATAAAAAGCTGGG + Intergenic
1196645303 X:118111590-118111612 TCCACTAAAAATAAAAAGTTAGG + Intronic
1196915243 X:120527555-120527577 TATACCAAAATGAAAAAGTCAGG - Intronic
1197178242 X:123507096-123507118 TGTACACAAAAAAAATAGTTAGG + Intergenic
1198255905 X:134924303-134924325 TCTACAAAAAATAAAAAATTAGG - Intergenic
1199347542 X:146759684-146759706 TCAACCCAGAAGAAAGAGTTTGG + Intergenic
1201751958 Y:17442313-17442335 TCTACCAACAATAAAAAGTCAGG - Intergenic
1201865475 Y:18648659-18648681 TTTATCAAAAAGGAAGAGTTTGG - Intergenic