ID: 1168552186

View in Genome Browser
Species Human (GRCh38)
Location 19:57305607-57305629
Sequence GGAGGACTGCTTAGGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1062
Summary {0: 1, 1: 1, 2: 28, 3: 192, 4: 840}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168552186_1168552193 10 Left 1168552186 19:57305607-57305629 CCTCCTGGCCTAAGCAGTCCTCC 0: 1
1: 1
2: 28
3: 192
4: 840
Right 1168552193 19:57305640-57305662 TCCCTAGTAGCTGAGACCACAGG 0: 29
1: 1122
2: 17366
3: 140565
4: 255649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168552186 Original CRISPR GGAGGACTGCTTAGGCCAGG AGG (reversed) Intergenic
900127629 1:1075519-1075541 CCAGGACTGCAGAGGCCAGGGGG + Intergenic
900188078 1:1342270-1342292 GGAGGCCTGCCTGGGCCAGTAGG - Intronic
901011038 1:6202257-6202279 GAAGGATTGCTTGAGCCAGGAGG - Intronic
901817324 1:11801832-11801854 GGAGAATTGCTTGAGCCAGGAGG + Intronic
902363385 1:15954758-15954780 GGAGGACAGATTAAGCCAGGAGG + Intronic
903365582 1:22803514-22803536 GGAGGATCACTTGGGCCAGGAGG + Intronic
903433901 1:23331741-23331763 GGAGGGCTGCTTGAGCCAGGAGG + Intronic
903905665 1:26684265-26684287 GGAGGGTTGCTGAGCCCAGGAGG + Intergenic
904113703 1:28146496-28146518 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
904529998 1:31162112-31162134 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
904634976 1:31872940-31872962 GGAGGATAGCTTAAGCCCGGAGG + Intergenic
904685941 1:32260710-32260732 GGAGGATCGCTGAGCCCAGGAGG - Intronic
904738727 1:32655077-32655099 GGAGGATTCCTTGGCCCAGGAGG - Intronic
905054713 1:35083239-35083261 GTAAGACTGCTTAAGCCGGGAGG - Intronic
905099878 1:35510695-35510717 GGAGGATTGCTTGGGCCCGAAGG - Intronic
905678866 1:39851855-39851877 GGAGGACATCTGAGCCCAGGAGG + Intronic
905680422 1:39866899-39866921 GGAGGACTGCTTGAGCCAGGAGG + Intronic
905915195 1:41679560-41679582 GGAGGACTGCTTTGGTATGGAGG + Intronic
905968505 1:42120154-42120176 GGAGGATAGCTTAAGCCAGGGGG + Intergenic
906187047 1:43870363-43870385 GGAGGTCTGCTTAGGCCGCCAGG + Intronic
906322214 1:44823846-44823868 GGAGGATCGCTTGGCCCAGGAGG + Intronic
906474365 1:46158137-46158159 GGAGGACAGCTTAGATCAGCAGG - Intronic
906559438 1:46745412-46745434 GGAAGACTGTTTGAGCCAGGAGG - Intergenic
906691385 1:47794994-47795016 GGAGGATTGCTTGAGCCAGGAGG - Intronic
907128996 1:52078141-52078163 GGAGGATTGCTGAGCCTAGGAGG - Intronic
907204993 1:52762296-52762318 GGAGGATTGCTTGAGCCTGGGGG - Intronic
907240027 1:53076120-53076142 GGAGGACAACTCGGGCCAGGAGG + Intronic
907350297 1:53824142-53824164 GGAGGACTGTTCGAGCCAGGAGG + Intronic
907421535 1:54350913-54350935 GGAGGATTGCTGAGTCCAGGAGG - Intronic
907800824 1:57763586-57763608 GGAGGATTGCTTGAGCCAGGAGG + Intronic
908136983 1:61143478-61143500 GGAGGACTGCTTGAACCTGGGGG - Intronic
908233986 1:62132811-62132833 GGAGGATTGCTTGAGCCCGGGGG + Intronic
908524803 1:64977375-64977397 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
908643935 1:66256084-66256106 GGAGGATTGCTTGAGCCTGGAGG + Intronic
908854249 1:68406463-68406485 GGAGGATTGCTTCAGCCAGGAGG + Intergenic
909071716 1:71002170-71002192 GGAGGATCACTTAAGCCAGGAGG + Intronic
909446388 1:75753884-75753906 GGAGGATCACTTAAGCCAGGAGG - Intronic
910041377 1:82855774-82855796 GGAGAAGTGATTAGGTCAGGAGG + Intergenic
910325278 1:85999530-85999552 GGAGGACTGCTTGAGCCTGGAGG + Intronic
910526035 1:88179467-88179489 GGAGGATTGCTGAGCCCATGAGG + Intergenic
910675883 1:89816124-89816146 GGAGGATTGCTTGAGCCAAGAGG + Intronic
910767195 1:90793486-90793508 TGAGGTCTGCTTAGGAGAGGTGG + Intergenic
910875892 1:91877415-91877437 GGAGGATGGCTTGAGCCAGGAGG - Intronic
911030483 1:93482070-93482092 GGAGGATCACTGAGGCCAGGAGG + Intronic
911032835 1:93508257-93508279 GGAGGATTGCTTGACCCAGGAGG + Intronic
911166805 1:94731540-94731562 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
911357105 1:96835950-96835972 GGTGGTCTGCCCAGGCCAGGAGG - Intergenic
911635552 1:100231601-100231623 TGAGGACTGGTTAGGACAGGAGG - Intronic
911757728 1:101579378-101579400 GGCGGATTGCCTAAGCCAGGAGG + Intergenic
912433262 1:109640957-109640979 GGAGGATTGCTTAAGCCCGAAGG - Intergenic
912526819 1:110289748-110289770 TGAGGATTGCTTGAGCCAGGAGG - Intergenic
912780382 1:112541192-112541214 GGAGGACTGTTGAACCCAGGAGG + Intronic
912910432 1:113753763-113753785 AGAGGATTGCTTAAGCCTGGAGG - Intronic
913014538 1:114719216-114719238 GGAGAATTGCTTAGGCCCAGGGG + Intronic
913253645 1:116934370-116934392 GGAGGACTGCTTGAGCCCAGGGG - Intronic
913600560 1:120417688-120417710 GGAGGATCGCTTGAGCCAGGAGG - Intergenic
913994428 1:143640084-143640106 GGAGGATTGCTTAAGCCAGGAGG + Intergenic
914086495 1:144458948-144458970 GGAGGATCGCTTGAGCCAGGAGG + Intronic
914192391 1:145422896-145422918 GGAGGATCGCTTGAGCCAGGAGG + Intergenic
914311834 1:146473424-146473446 GGAGGATCGCTTGAGCCAGGAGG - Intergenic
914361771 1:146941946-146941968 GGAGGATTGCTTGAGCCAGGAGG - Intronic
914489852 1:148145011-148145033 GGAGGATTGCTTGAGCCAGGAGG + Intronic
914590299 1:149100842-149100864 GGAGGATCGCTTGAGCCAGGAGG + Intronic
914686264 1:149982548-149982570 GGAGGACTGCCTGAGCCTGGGGG - Intronic
914865077 1:151420095-151420117 GGAGGACTGCTTGAGCCCAGGGG + Intronic
914928264 1:151907619-151907641 GGAGGACTGGAGAGGCCATGGGG - Intronic
915153993 1:153859274-153859296 GGAGGATTGCTTGAGCCTGGGGG + Intronic
915608859 1:156974156-156974178 GGAGGACCGCTTAAGCCCAGGGG - Intronic
915833428 1:159152963-159152985 GAAGAATTGCTTAGCCCAGGAGG - Intergenic
915912990 1:159925618-159925640 GGAGGACTGCTTGAGACAGAGGG + Intronic
916101267 1:161395268-161395290 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
916223106 1:162464163-162464185 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
916247770 1:162705690-162705712 GGACGATTGCTTAGGCCCTGGGG + Intronic
916562000 1:165941314-165941336 GGAGGACAGCATACTCCAGGCGG + Intergenic
916640911 1:166728244-166728266 GGAGAACTGCTTGATCCAGGAGG - Intergenic
917103541 1:171469739-171469761 GGAGGACAGCTTGAGCCCGGAGG - Intergenic
917352592 1:174093580-174093602 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
917353309 1:174101192-174101214 GAAGAATTGCTTAAGCCAGGAGG - Intergenic
917382625 1:174430280-174430302 GGAGGATTGCTTGAGCCCGGAGG + Intronic
918762588 1:188431319-188431341 AGAGGATTGCTTGAGCCAGGAGG + Intergenic
919487621 1:198163403-198163425 GGAGGATTGCTTGGGCCTGGAGG + Intronic
919946966 1:202326637-202326659 GGAGGATTGCTTGAGCCCGGGGG - Intergenic
920067100 1:203276771-203276793 GGGGTGCTGCTTGGGCCAGGAGG + Intergenic
920178003 1:204115231-204115253 GGAGGACTGTTTAGGCCCAGGGG - Intronic
920492588 1:206428751-206428773 GGAGGACTGCTTGAGCCCAGAGG - Intronic
921075590 1:211698111-211698133 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
922273473 1:224055684-224055706 GGAGGATTGCTTAGCCCAGGAGG - Intergenic
922332309 1:224587849-224587871 GGAGGATTGCTTGAGCCAGGAGG + Intronic
922421297 1:225462543-225462565 GGAGGACTGCTCTGGCTAAGGGG + Intergenic
922441483 1:225658700-225658722 GGAGGATGGCTTGAGCCAGGAGG + Intergenic
922501440 1:226099606-226099628 GGAGGATTGCTTAAGCCCAGGGG + Intergenic
923534009 1:234834570-234834592 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
923559224 1:235025780-235025802 GGAGGATCGCTTAAGCCTGGGGG + Intergenic
923608810 1:235470486-235470508 GGAGGATTGTTTAAGCCAGGAGG + Intronic
923700630 1:236296808-236296830 GGAGGACTGCTTGAGCCCAGAGG + Intergenic
923757475 1:236805582-236805604 GGAGGACTGCTTGGGCCCAGAGG - Intronic
923842693 1:237690770-237690792 GGAGGATTGCTTGAGCCTGGAGG + Intronic
923992186 1:239451131-239451153 GGAGGATTGCTTGAGCCCGGGGG + Intronic
924229763 1:241953668-241953690 GGAGGACTGCTTGAGCCCGGAGG - Intergenic
924404387 1:243727381-243727403 GGAGGATTGCTTGAGTCAGGAGG - Intronic
924718471 1:246601077-246601099 GGAGGACTGCTTGAGTCAAGGGG + Intronic
924761013 1:246986157-246986179 GGAGGATTGCTTGAGCCTGGAGG - Exonic
1062766914 10:73351-73373 GGAGCACTGACCAGGCCAGGTGG + Intergenic
1063411491 10:5840027-5840049 GGAGGATGGCTTAAGCCTGGTGG - Intronic
1063546708 10:6988335-6988357 GGAGGATTGCTTAGGCCAGGAGG + Intergenic
1063610521 10:7558055-7558077 GGAGGACTGCTTGAGCCCGGAGG - Intergenic
1063704523 10:8418052-8418074 GGAGGATTGCTTGCACCAGGAGG - Intergenic
1064046768 10:12023896-12023918 GGAGGACTGCTTGAGCTGGGAGG + Intronic
1064143379 10:12808423-12808445 GTAGGCCTACCTAGGCCAGGAGG - Intronic
1064143384 10:12808436-12808458 GTAGGCCTACGTAGGCCAGGAGG + Intronic
1064348946 10:14559005-14559027 GGAGGTCAGCTTAGGCCAGTTGG - Intronic
1064740868 10:18432743-18432765 GGAGGATGGCTTGAGCCAGGAGG + Intronic
1064998324 10:21315585-21315607 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
1065125743 10:22572512-22572534 GGAGGACTGCTTGAGCCAGTGGG + Intronic
1065292081 10:24240944-24240966 GGAGGATTGCTTTAGCCGGGAGG - Intronic
1065487539 10:26249528-26249550 GGAAGACTGCCTAGGCCAGCGGG - Intronic
1065517763 10:26542245-26542267 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1065526762 10:26630294-26630316 GGAGGATTGCTTGAGCCCGGGGG - Intergenic
1065704647 10:28460881-28460903 GGAGGATTGCTTGAGCCTGGTGG - Intergenic
1065813550 10:29464209-29464231 GAAGGACTGCTTGAGCCCGGAGG + Intronic
1066089798 10:32006039-32006061 GGAGGACAGCTTGAGCCTGGGGG + Intergenic
1068059548 10:52050165-52050187 GTAGGAGTGCTCAGGCCTGGTGG + Intronic
1068432970 10:56956647-56956669 GGAGAATTGCTTAACCCAGGAGG + Intergenic
1068441699 10:57064294-57064316 GGAGAATTGCTTGAGCCAGGAGG - Intergenic
1068661460 10:59627362-59627384 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1068730410 10:60351761-60351783 GGATCACTGCTTAGGCCATCGGG + Intronic
1069505285 10:68992082-68992104 GAAGGATCGCTTAAGCCAGGAGG - Intronic
1070166666 10:73903855-73903877 GGAGGACTGCTTGAGCCAAGGGG + Intergenic
1070170473 10:73929068-73929090 GGAGGACTATTGAGGCCAGGAGG + Intergenic
1070670446 10:78373988-78374010 GGAGGATAGCTTAGTCCAGGAGG - Intergenic
1071361968 10:84856562-84856584 GGAGAATTGCTTGAGCCAGGAGG + Intergenic
1072117536 10:92378251-92378273 GGAGGATTGCTTAGTCCAGGAGG - Intergenic
1072667515 10:97405065-97405087 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1072696140 10:97604410-97604432 GGAGGATTGCTTGAGCCAGGAGG - Intronic
1072699362 10:97629294-97629316 GGAGAATTGCTTAACCCAGGAGG + Intronic
1072886738 10:99283411-99283433 GGAGGATTGCTTGAGCCAGGAGG + Intergenic
1072893791 10:99348269-99348291 GGAGGACTGCTTGGGCCCAGGGG - Intronic
1072927320 10:99627529-99627551 GGAGGATCGCTTGAGCCAGGGGG - Intergenic
1073185667 10:101613798-101613820 GGAGCACTGCTGCTGCCAGGGGG + Intronic
1073303745 10:102486875-102486897 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1073357453 10:102868730-102868752 GGAGGATCGCTTGAGCCAGGAGG + Intronic
1073384394 10:103111326-103111348 GGAGGACTGCTTCAGCCACTAGG + Intronic
1073472822 10:103733859-103733881 AGAGGACTGCTTGAGTCAGGAGG - Intronic
1073631507 10:105154401-105154423 GGCGGAATGCTGAGTCCAGGTGG - Intronic
1074269989 10:111944579-111944601 GGAGGACAGCTGAATCCAGGAGG + Intergenic
1074551411 10:114445858-114445880 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1074839013 10:117329853-117329875 GGAGGATTGCTTGAGCCTGGCGG + Intronic
1075125995 10:119699295-119699317 GGAGGATTGCTTGAGCCGGGAGG + Intergenic
1075148991 10:119909379-119909401 GGTGGAATGCTTGAGCCAGGGGG + Intronic
1075512009 10:123080154-123080176 GGAGGACTCCTTCGTCCACGTGG + Intergenic
1075608108 10:123830713-123830735 GCAGGACTGCTGATTCCAGGAGG + Intronic
1075751689 10:124777606-124777628 GGAGGATTGATTGAGCCAGGAGG - Intronic
1075792027 10:125091677-125091699 GCAGGACTGCTTGAGCCCGGAGG + Intronic
1076133411 10:128028887-128028909 GGAGGACAGCTGAGGCCAGAGGG - Intronic
1076290191 10:129340127-129340149 GCAGGACTGCTTATGGCATGAGG - Intergenic
1076669904 10:132114303-132114325 GGAGGATTGCTTGAGCCGGGGGG - Intronic
1076784163 10:132741140-132741162 GGAGGATTGCTTGAGCCCGGAGG + Intronic
1076856422 10:133117499-133117521 GGGAGACTGCCTGGGCCAGGAGG + Intronic
1077076384 11:704265-704287 GGTGGACTCCTGAGGGCAGGAGG + Intronic
1077583931 11:3435975-3435997 GGAGAACTGCTTGAGCCCGGGGG - Intergenic
1077625308 11:3766281-3766303 AGAGGATCGCTTAGCCCAGGAGG + Intronic
1078086485 11:8236279-8236301 GGAGGATCGCTTAAGCCGGGAGG - Intronic
1078100483 11:8327699-8327721 GGACAGCTGCTAAGGCCAGGAGG - Intergenic
1078170298 11:8924560-8924582 GAAGGACTGCTCAGCCCATGAGG - Intronic
1078239751 11:9520405-9520427 GGAGGATCACTTAGCCCAGGAGG + Intronic
1078299553 11:10113217-10113239 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1079302894 11:19295077-19295099 GGAGGACTGCTTGAGCCAGGGGG - Intergenic
1079378608 11:19917001-19917023 GGAGAACAACTAAGGCCAGGAGG + Intronic
1080289954 11:30659590-30659612 GGACGATTGCTTGAGCCAGGAGG - Intergenic
1080483949 11:32684888-32684910 GGATGACTGCTTGAGCCCGGGGG + Intronic
1080826342 11:35852256-35852278 GGAGGATTGCTGAGGCCAGCTGG - Intergenic
1080888226 11:36386194-36386216 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1081429068 11:42956143-42956165 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1081799786 11:45850097-45850119 GGAGGATCGCTGAGCCCAGGAGG - Intronic
1081932347 11:46880531-46880553 GGAGGATCCCTTGGGCCAGGAGG + Intronic
1082022961 11:47550438-47550460 GGAGAACTGCTTGAGCCCGGGGG + Intronic
1082754165 11:57056240-57056262 GGAGGATTGCTTAAGCCCGGAGG - Intergenic
1083027908 11:59565920-59565942 CGAGGACTTCTTTGGCCAAGAGG + Intergenic
1083236506 11:61354200-61354222 GGAGGAGTGGTCAGGCAAGGTGG + Intronic
1083425469 11:62582328-62582350 GGAGGATTGCTTGAGCCCGGGGG + Intronic
1083435785 11:62642119-62642141 GGAGAACTGCTTGAACCAGGAGG + Intronic
1083573856 11:63775052-63775074 GGAGGATTGCTTGAGGCAGGGGG - Intergenic
1083992476 11:66255278-66255300 GGAGGATGGCTCAAGCCAGGAGG - Intergenic
1084124606 11:67090865-67090887 GGAGGACTGCCTGAGCCAGGAGG + Intergenic
1084130132 11:67127185-67127207 GGAGGACCACTTGAGCCAGGCGG - Intronic
1084153209 11:67300800-67300822 GGAGGGCAGCTTGGGCCACGTGG + Intronic
1084617629 11:70246927-70246949 GGAGAACTGCTTGAACCAGGAGG + Intergenic
1084794664 11:71497101-71497123 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1084976557 11:72802909-72802931 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1085065580 11:73492549-73492571 GGAGGATTGCTTAAGCCTGGAGG + Intronic
1085089788 11:73701741-73701763 GGTGGATTGCTTGGCCCAGGGGG - Intronic
1085091764 11:73722435-73722457 AGAGGATTGCTTGAGCCAGGAGG - Intronic
1085123920 11:73984604-73984626 GTAGGACTGCTTGTCCCAGGAGG - Intergenic
1085354205 11:75820834-75820856 GGAGGATTGCTTGAGGCAGGAGG + Intronic
1085360580 11:75881640-75881662 GGAGGACTGCTTGAGCCTAGGGG - Intronic
1085415546 11:76317091-76317113 GGAGGATTGCTTGAGCCTGGCGG - Intergenic
1085428579 11:76426599-76426621 GGAGGATTGCTTGGCCTAGGAGG + Intergenic
1085436417 11:76507952-76507974 GGAGGACTGCTTGAGCCAGGAGG - Intronic
1085870619 11:80345304-80345326 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1085969132 11:81565661-81565683 GGAGGATTGATTAACCCAGGAGG - Intergenic
1087044549 11:93833918-93833940 GAAGGACTGATGAGGCCAAGGGG - Intronic
1087489935 11:98812349-98812371 TAAGGAGTGATTAGGCCAGGAGG - Intergenic
1088105376 11:106201175-106201197 GGAGTATTGGTTGGGCCAGGAGG + Intergenic
1088240251 11:107766700-107766722 AGAGGATTGCTTGAGCCAGGAGG + Intergenic
1088285483 11:108183210-108183232 GGAGGACTGCTTGAGCCCAGAGG - Intronic
1088353843 11:108921022-108921044 TGAGGACTGCTTAGGCCAAATGG - Intronic
1088384245 11:109235497-109235519 GGAGGATTGCTTGAGCCAGAGGG - Intergenic
1088437435 11:109830814-109830836 GGAGGATTGCTTGGGCCAGGAGG + Intergenic
1088659512 11:112031662-112031684 GGAGGATGGCTTGAGCCAGGAGG - Intronic
1088688459 11:112304743-112304765 GGAGAATTGCTTAAACCAGGAGG - Intergenic
1089994911 11:122897312-122897334 GGAGGATGGCTTAGCCCAGGAGG - Intronic
1090505285 11:127305286-127305308 GGAGGACCTCTTGGGACAGGTGG - Intergenic
1090724192 11:129508261-129508283 GAAGGATTGCTTGAGCCAGGAGG + Intergenic
1090782196 11:130017357-130017379 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1090799982 11:130164507-130164529 GGAGGATTGCTTGAGCCGGGAGG - Intronic
1090861751 11:130659874-130659896 GGAGGATTGCTTAAGCACGGGGG + Intergenic
1091242880 11:134066028-134066050 GGAGGATTGCTTGAGCCTGGAGG + Intergenic
1091430842 12:432939-432961 GGAGGACTGCTTGAGCCCAGGGG + Intronic
1092219668 12:6704251-6704273 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1092370701 12:7914729-7914751 GGAGGATCGCTTGAGCCAGGAGG - Intergenic
1092411069 12:8253222-8253244 GGAGAACTGCTTGAGCCCGGGGG - Intergenic
1092835638 12:12485599-12485621 GGAGGATTGCTTGAGCCAGGAGG - Intronic
1093463333 12:19426024-19426046 GGAGGATCGCTTGAGCCAGGAGG - Intronic
1094022423 12:25928240-25928262 GGAGGATTGCTTGAGTCAGGAGG + Intergenic
1094562007 12:31564024-31564046 GGAGAACTGCTTAAGCCCAGAGG + Intronic
1094638107 12:32246545-32246567 GGAGGAATGCTTGAGCCTGGGGG + Intronic
1094761563 12:33539341-33539363 GGAGGATTTCTTGAGCCAGGAGG - Intergenic
1094825087 12:34263682-34263704 GGATGTCTCTTTAGGCCAGGTGG - Intergenic
1095443498 12:42261220-42261242 GGAGGATTGCCTAAGCCTGGAGG - Intronic
1095461742 12:42451437-42451459 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1095802156 12:46280842-46280864 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1096163524 12:49401099-49401121 GGAGGACAGCTTATCCCAGGAGG - Intronic
1096275885 12:50207797-50207819 GGAGGATTGCTTGAACCAGGGGG + Intronic
1096624115 12:52883046-52883068 GGAAGAATGCTTAGGCCATTTGG + Intergenic
1096674916 12:53221194-53221216 GGCGGACTGCTCGGGCTAGGAGG - Intronic
1097210273 12:57362909-57362931 GGAGAACTGCTTGAACCAGGAGG - Intronic
1097756863 12:63416323-63416345 GTAGGAATGTTTTGGCCAGGAGG - Intergenic
1097814769 12:64060431-64060453 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1097862530 12:64532595-64532617 GGAGGACTGCTTAAGTCCAGGGG + Intergenic
1098114599 12:67161648-67161670 GGAGGATTGCTTAAGCCCAGGGG + Intergenic
1098222458 12:68284764-68284786 GGAGGACTGCTTGAGCCCAGAGG - Intronic
1098229527 12:68358811-68358833 GGAGGAATTCTGAGCCCAGGGGG + Intergenic
1098410484 12:70177589-70177611 GGAGAATTGCTTGAGCCAGGGGG + Intergenic
1098542795 12:71676995-71677017 GGAAGACTGCTTAAGGCAGTTGG - Exonic
1099296649 12:80836563-80836585 GGAGGATTGCTTAGTCTGGGAGG + Intronic
1100192459 12:92207683-92207705 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
1100249628 12:92804884-92804906 GGAGTACTACCTAGGCAAGGAGG - Intronic
1100297039 12:93272762-93272784 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1100645687 12:96527791-96527813 GGTGGACTGCTTGTCCCAGGAGG - Intronic
1100824847 12:98464967-98464989 GGAGGATCGCTTAAGGCAGGAGG + Intergenic
1100973443 12:100096162-100096184 GGAGAATTGCTTGGCCCAGGAGG + Intronic
1101021457 12:100558446-100558468 GGAGGATCGCTTAAGCCTGGAGG - Intronic
1101105157 12:101433391-101433413 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
1101349926 12:103920097-103920119 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1101372365 12:104141039-104141061 GGAGCAATGCATAGGCCAGTGGG - Intergenic
1101899664 12:108782022-108782044 GGAGGATTGCTTGAGGCAGGAGG + Intergenic
1101931366 12:109016831-109016853 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1101948649 12:109157361-109157383 AGAGGACTGCTTGAGCCCGGAGG - Intronic
1102008640 12:109604741-109604763 GGAGGACTGCTTGAGCCCGGAGG + Intergenic
1102057234 12:109905749-109905771 GGAGGACTCCTTAGCCCTGTTGG + Intronic
1102280536 12:111615356-111615378 GGAGGATTGCTTGAGCCCGGGGG - Intergenic
1102306598 12:111809362-111809384 GGAGGATCGCTTGAGCCAGGAGG + Intronic
1102557567 12:113737736-113737758 GGAGGGCTGATAAGGGCAGGGGG - Intergenic
1102879189 12:116471155-116471177 GGAGGATCACTTGGGCCAGGAGG + Intergenic
1103070221 12:117935223-117935245 GGAGGATTGCTCGAGCCAGGAGG - Intronic
1103083772 12:118045619-118045641 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1103515360 12:121504442-121504464 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1103528539 12:121583479-121583501 GGAGCATTGCTGAGTCCAGGAGG - Intergenic
1103611028 12:122124290-122124312 GGGGGACGGCTGAGGGCAGGGGG - Intronic
1103659718 12:122503989-122504011 GGAGGACTGCTTGAGCCTGGGGG + Intergenic
1103780729 12:123397148-123397170 GGAGGCCCGCATAGGCCAGCTGG - Intronic
1103819135 12:123683368-123683390 GGAGGAATGCTGAAGCCAGGAGG - Intronic
1104796157 12:131520757-131520779 GGAGGATTGGTTGAGCCAGGAGG + Intergenic
1104874046 12:132020638-132020660 GGAGGGCCCCTTTGGCCAGGTGG - Intronic
1104895921 12:132163550-132163572 TGGGGGCTGCTCAGGCCAGGGGG + Intergenic
1104986381 12:132599864-132599886 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
1105306838 13:19174869-19174891 GGAGGATTGCTTGAGCCTGGAGG + Intronic
1105894339 13:24705758-24705780 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1106002507 13:25737587-25737609 GGAGGACTGCTTGAGCCTGGAGG - Intronic
1106233743 13:27843581-27843603 GGAGGATTGCTTAAGCCTGGCGG - Intergenic
1106268806 13:28134722-28134744 GGAGGATTGCTTGGGCCAGGAGG - Intergenic
1106748020 13:32724669-32724691 GGAGGATTGCTTGAACCAGGAGG - Intronic
1107580933 13:41784571-41784593 GGAGGATTGCTTGAGCCTGGAGG + Intronic
1109171708 13:59105976-59105998 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1110216461 13:73029833-73029855 AGAGGATTGCTTGAGCCAGGTGG + Intergenic
1110226470 13:73124782-73124804 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
1110323241 13:74183844-74183866 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1110374137 13:74773177-74773199 GGAAGATTGCTTGAGCCAGGAGG + Intergenic
1110384858 13:74897740-74897762 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1110686915 13:78386296-78386318 GGAGGACTGTTGAGGCCACAAGG + Intergenic
1111021161 13:82454414-82454436 GGAGGATTGCTGAGCCCAGGAGG - Intergenic
1112024495 13:95399763-95399785 GGAGGATTGCTGAGCTCAGGAGG + Intergenic
1112030889 13:95455084-95455106 GGAGGACTGCTTAAGCCCAGGGG + Intronic
1112311228 13:98319051-98319073 GGAGGACTGCTTTAGCCCAGGGG - Intronic
1112473325 13:99709000-99709022 GGAGAACTGCTTGAACCAGGGGG + Intronic
1112747356 13:102541512-102541534 GGAGGACTGCTTGAGCCTGGGGG + Intergenic
1113337857 13:109394025-109394047 GGAGGACTGGAGAGGCCAGAGGG - Intergenic
1113480968 13:110620487-110620509 GGAGAATTGCTTGGACCAGGGGG + Intronic
1113493218 13:110708654-110708676 GGAGGATTGCTTGAACCAGGAGG - Intronic
1113884812 13:113652929-113652951 GCAGAACTGCTCAGGCCTGGCGG - Exonic
1115246706 14:31303019-31303041 GGAGGACTGCTTGAGCCCAGGGG + Intronic
1115697434 14:35914479-35914501 GGAGGACTGCTTGAGCCAGGAGG - Intronic
1116835053 14:49762427-49762449 GGAGGATTGCTTAAGTCAGATGG - Intergenic
1117122222 14:52580450-52580472 GGAGAACTGCTTGGGCCCAGAGG - Intronic
1117129400 14:52670009-52670031 GGAGGATTGCTTGATCCAGGGGG - Intronic
1118223357 14:63876185-63876207 GGAGGATTGCTTGAGCCAAGGGG + Intronic
1119277467 14:73371683-73371705 TAAGGAGTGATTAGGCCAGGAGG + Intronic
1119328507 14:73776669-73776691 GGAGGGCTGCATATGCCAGGTGG - Intronic
1119586803 14:75843375-75843397 GGATGAATGGTTAGGCCAAGAGG - Intronic
1119988985 14:79173439-79173461 GGAGGGCTGCTTGAGCCAGGAGG + Intronic
1120125539 14:80737797-80737819 GGAGGACTGCTTGAGCCTGAGGG + Intronic
1120826969 14:88965051-88965073 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1120922219 14:89765591-89765613 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1120949002 14:90023760-90023782 GGAGGACTGCTTGAGCCTGGTGG - Intronic
1121225470 14:92318733-92318755 GAAGTACTGCTTAGACCATGCGG + Intergenic
1121258682 14:92550501-92550523 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1121290861 14:92773933-92773955 GGAGGATTGCTTGAGCCTGGAGG + Intergenic
1121367173 14:93324330-93324352 GGAGGACTGCTGAACCCAAGAGG + Intronic
1121543790 14:94748690-94748712 GGAGGATTGCTTGAGCCGGGAGG + Intergenic
1121765772 14:96484131-96484153 GGAGGATTGCTTAAGCCTGGAGG + Intronic
1122106089 14:99456063-99456085 GGAGGATTGCTTGAGCCCGGAGG + Intronic
1122331445 14:100918601-100918623 GGAGGATTGCTTAAGCCTAGAGG - Intergenic
1122427861 14:101622190-101622212 GGAGGACTGCTTAAGCCCAGAGG + Intergenic
1122430119 14:101635135-101635157 GGAGGACTGCCTGGGGGAGGCGG - Intergenic
1122550399 14:102546026-102546048 GGAAGACTGCCTAGGCGAGGTGG + Intergenic
1122908097 14:104811848-104811870 GGAAGACTGCTTGAGCCTGGGGG + Intergenic
1122962261 14:105100435-105100457 GGAGGACTGCTGAGCCCAGAAGG - Intergenic
1123013969 14:105364785-105364807 GGAGGACTGCTTGGGCCCAGGGG - Intronic
1123474401 15:20579757-20579779 GGAGGATTGCTTGAGCCCGGGGG - Intergenic
1123643611 15:22420596-22420618 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1123662679 15:22578253-22578275 GGAGAACTGCTTAAACCCGGGGG - Intergenic
1123664898 15:22600200-22600222 GGAGGATTGCTTCAGCCAGGGGG + Intergenic
1123722267 15:23069740-23069762 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1123752871 15:23372412-23372434 GGAGGATTGCTTGAGCCCGGGGG - Intergenic
1124316480 15:28672557-28672579 GGAGAACTGCTTAAACCCGGGGG - Intergenic
1124318727 15:28694629-28694651 GGAGGATTGCTTGAGCCAGGGGG + Intergenic
1124564717 15:30802810-30802832 GGAGGATTGCTTGAGCCAGGGGG - Intergenic
1124825922 15:33095483-33095505 GGAGGATTGCTGAGCACAGGAGG - Intronic
1125620773 15:41059562-41059584 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1125632604 15:41159663-41159685 GGAGGACTGCTTGAGCTGGGGGG - Intergenic
1125686418 15:41566085-41566107 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1125698110 15:41656430-41656452 GGAGGACTGTTTAAGCCCAGGGG - Intronic
1125718478 15:41833643-41833665 GGAGGATTGCTGAGGCCGGGAGG - Intronic
1125733179 15:41905758-41905780 GGAGGATGGCTTAAGCCCGGAGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1125895803 15:43301071-43301093 GGAGGACTGCATGAGCCTGGGGG - Intronic
1126024179 15:44430334-44430356 GGAGGACTGCATAGGCCCAGGGG - Intronic
1126031603 15:44504777-44504799 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1126072544 15:44877710-44877732 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1126077988 15:44931811-44931833 GAAGGGCTGCTTTGACCAGGGGG - Intergenic
1126080149 15:44952543-44952565 GGAGAACTGCTTGAACCAGGGGG + Intergenic
1126085648 15:45008940-45008962 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1126090666 15:45048481-45048503 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1126739463 15:51763023-51763045 GGAGAATTGCTTCAGCCAGGAGG - Intronic
1126783303 15:52156638-52156660 GGAGAACTGCTTGAGCCCGGGGG + Intronic
1127408579 15:58680906-58680928 GGAGGATTGCTGAGCCCAGGAGG - Intronic
1128271178 15:66311270-66311292 GGAGGATTGCTTAAGGCAGGGGG + Intronic
1128484114 15:68068277-68068299 GGAGGATCGCTTGAGCCAGGAGG + Intronic
1128547821 15:68579443-68579465 CAAGGACTGCGGAGGCCAGGGGG + Intronic
1129415173 15:75372728-75372750 GGAGGATCGCTTGAGCCAGGAGG + Intronic
1129533226 15:76287251-76287273 GGAGGATTGCTTGAGCCAGAAGG - Intronic
1129912807 15:79242151-79242173 GGAGAACTGATTAGGGTAGGGGG + Intergenic
1130130668 15:81139212-81139234 GGAGGATTGCTTAAGCCGGAAGG + Intronic
1130163355 15:81425048-81425070 GAAGGACTGATTTGGCCAGATGG - Intergenic
1130528438 15:84726694-84726716 GGAGGATCGCTTGAGCCAGGAGG + Intergenic
1130573913 15:85073829-85073851 GAAAGGCTGCTTAGGCCTGGAGG - Intronic
1130836274 15:87653175-87653197 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1130965239 15:88692822-88692844 GGAGGATCGCTTGAGCCAGGAGG - Intergenic
1131072718 15:89476293-89476315 GGAGGACAGCTTGAGCCTGGGGG - Intronic
1131495842 15:92910095-92910117 GGAGAACTGCTTGAGCCTGGAGG - Intronic
1131812728 15:96189632-96189654 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1132600822 16:772100-772122 GGAGGATTGCTTAAGCCCAGGGG + Intronic
1132754140 16:1474594-1474616 GGAGGGCTGCGTGGGCGAGGCGG - Intronic
1133006841 16:2887234-2887256 GAAGGATTGCTTAAGCCAGTGGG - Intronic
1133252779 16:4494945-4494967 GGAGGATTGTTGAGGCTAGGAGG + Intronic
1133326653 16:4946006-4946028 GGAGGACAGCCCAGGTCAGGAGG + Intronic
1133488061 16:6239586-6239608 GGAGAACTGCTTGAACCAGGTGG - Intronic
1133653289 16:7833596-7833618 GGAGGATTACTTAAACCAGGAGG + Intergenic
1133772463 16:8875253-8875275 GGAGGACTGCTTAAACCTGGAGG - Intergenic
1133800570 16:9081807-9081829 ACAGGACTGCTTAACCCAGGAGG + Intergenic
1133877643 16:9750050-9750072 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1133896526 16:9934588-9934610 GGAGAATTGCTTAATCCAGGAGG + Intronic
1133960336 16:10487452-10487474 GTAGGAATGTTTTGGCCAGGAGG - Intergenic
1134021681 16:10925395-10925417 GGAGGATCACTTAGCCCAGGAGG - Exonic
1134305633 16:13029516-13029538 GGAGGATCACTTGGGCCAGGAGG + Intronic
1134466804 16:14486127-14486149 GGAGGACTGCTTGAGCCCAGGGG + Intronic
1134473755 16:14552564-14552586 GGAGGATTGCTTGACCCAGGAGG - Intronic
1134603730 16:15553382-15553404 GGAGGATTGCTCTAGCCAGGAGG + Intronic
1135028266 16:19015350-19015372 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1135111008 16:19690870-19690892 GGAGGACTGCTTGAGCCTTGAGG + Intronic
1135148829 16:19987744-19987766 GGAGAACTGCTGAACCCAGGAGG - Intergenic
1135309909 16:21397422-21397444 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1135362803 16:21829523-21829545 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1135481917 16:22827800-22827822 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1135802749 16:25513657-25513679 GGAGGATGGCTTGGACCAGGGGG + Intergenic
1136026645 16:27473004-27473026 GGAGGACCGCTTGAGCCAGGAGG - Intronic
1136306654 16:29376546-29376568 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1136461927 16:30416858-30416880 GAGGGACTGCTTGAGCCAGGAGG + Intronic
1136719338 16:32307739-32307761 GGAGAATTGCTTGAGCCAGGAGG + Intergenic
1136837708 16:33514003-33514025 GGAGAATTGCTTGAGCCAGGAGG + Intergenic
1137279494 16:46963608-46963630 GGAGGATTGCTTGGGCCCAGGGG + Intronic
1137293077 16:47065542-47065564 GGAGGATCGCTTGAGCCAGGAGG - Intergenic
1137431678 16:48423139-48423161 GGAGGATTGCTTGAGCCTGGTGG + Intronic
1137667230 16:50258681-50258703 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1138344246 16:56310237-56310259 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1138429379 16:56958835-56958857 GGAGGATTGCTTGAGCCGGGAGG + Intergenic
1138436866 16:57006087-57006109 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1138591759 16:58003135-58003157 GTAGCACTGGCTAGGCCAGGTGG + Intronic
1138964075 16:62062996-62063018 GGAGGATTGCTTAAGCCAAGGGG - Intergenic
1139086937 16:63598429-63598451 GGAGGATTGCTGAGCCCAGGAGG + Intergenic
1139535189 16:67567988-67568010 GGAGGATCGCTTGGGGCAGGTGG - Intronic
1140104722 16:71949440-71949462 GGAGGATTGCTTGGCCCAGGAGG - Intronic
1140502944 16:75450747-75450769 GGAGGATTGCTGGAGCCAGGAGG - Intronic
1140771457 16:78208103-78208125 AGAGCACTGCTGAGGCCAGATGG - Intronic
1140860882 16:79016769-79016791 GAAGGACTGGGTGGGCCAGGCGG - Intronic
1140892363 16:79296019-79296041 GGAGGACTGATTCAGCCAGAGGG - Intergenic
1141472354 16:84247669-84247691 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1141752597 16:85968895-85968917 GGAGGATTGCTTAAGCTGGGAGG + Intergenic
1141926676 16:87174408-87174430 GCAGGACTGCAAAGGCCAGGAGG - Intronic
1141979228 16:87539510-87539532 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
1142113916 16:88346606-88346628 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
1203007093 16_KI270728v1_random:210032-210054 GGAGAATTGCTTGAGCCAGGAGG - Intergenic
1203147891 16_KI270728v1_random:1814281-1814303 GGAGAATTGCTTGAGCCAGGAGG + Intergenic
1142527153 17:551475-551497 GGAGGACTGATGAGCCCAGAGGG + Intronic
1142824213 17:2497815-2497837 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1142997185 17:3767711-3767733 GGAGGATTGCTGAGCCCGGGAGG - Intronic
1142998630 17:3776646-3776668 GGAGGACCACTTGGGCCCGGAGG - Intronic
1143053995 17:4149030-4149052 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1143426134 17:6840062-6840084 GGAGAATTGCTTGAGCCAGGAGG - Intergenic
1143531483 17:7507239-7507261 GGAGGATACCTGAGGCCAGGAGG + Intronic
1143647660 17:8241682-8241704 GGAGGACTGCTTGAGCCTGAGGG + Intronic
1144688645 17:17244127-17244149 GGAGAATTGCTTAAACCAGGAGG + Intergenic
1144795339 17:17887564-17887586 GGAGGATTGCTTGAGCCCGGAGG - Intronic
1144939468 17:18927867-18927889 GGAGGATTGCTTTAGCCAGGAGG - Intronic
1145792325 17:27635347-27635369 GGAGGATTACTTGAGCCAGGGGG + Intronic
1145826623 17:27881895-27881917 GGAGGATTGCTTGAGCCCGGAGG - Intronic
1145967725 17:28932220-28932242 GGAGGACTGCTTGAGCCTAGGGG - Intronic
1146213482 17:30959923-30959945 GGAGGCTTGCTTGGGCCTGGGGG + Intergenic
1146429297 17:32775208-32775230 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1147239593 17:39081850-39081872 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1147297723 17:39497691-39497713 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1147707868 17:42439929-42439951 GGAGGATTGCTGAGCCCAGGAGG - Intergenic
1147755122 17:42762478-42762500 GGAGGGTGGCTCAGGCCAGGGGG + Intronic
1147959599 17:44158571-44158593 GGAGGACTGCTTGAGCCTAGAGG - Intronic
1148001841 17:44392920-44392942 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
1148154285 17:45413780-45413802 GCAGGGCTGCTGGGGCCAGGAGG + Intronic
1148433497 17:47662483-47662505 GGAGGATTGCTTGAGCCTGGTGG + Intronic
1148477043 17:47935509-47935531 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1148781243 17:50123354-50123376 GGAGGACACCTTTGGCCAAGGGG + Intronic
1148864848 17:50623184-50623206 GGAGGATTGCTTGAGCCGGGGGG - Intronic
1149413922 17:56438648-56438670 GGAGGATTGCTTAAGCCCGGGGG - Intronic
1149763214 17:59251915-59251937 GGGGGATTGCTGAGCCCAGGAGG + Intronic
1150045690 17:61911182-61911204 GGAAGATTGCTTAAGCCAGGGGG - Intronic
1150098312 17:62398576-62398598 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1150123510 17:62622014-62622036 AGAGGAATCCTTAGGCCAGGCGG - Intergenic
1150167598 17:62958986-62959008 GGAGGATCACTTAAGCCAGGAGG - Intergenic
1150298674 17:64030228-64030250 GGAGGATTGCTTAAGCCAAGAGG - Intergenic
1150320590 17:64211049-64211071 GGAGAATTGCTTGGGCCTGGGGG - Intronic
1150381039 17:64719687-64719709 GAAGGACTGCTTAAGCCAGGAGG + Intergenic
1150383146 17:64736424-64736446 GGAGGATTGCTGAGGACAGGAGG + Intergenic
1150384519 17:64747774-64747796 GGAGAATTGCTTAAGCCGGGAGG + Intergenic
1150734239 17:67722772-67722794 GGAGGACTGCTTGAGCCAGGAGG - Intronic
1150773095 17:68058351-68058373 GGAGGATTGCTAAGGGCAGGAGG - Intergenic
1150775467 17:68078430-68078452 GAAGGACTCCTTAAGCCAGGAGG - Intergenic
1150868222 17:68877091-68877113 GGAGGATGGCTTGAGCCAGGAGG - Intronic
1151295827 17:73185471-73185493 GGAGGATTGCTTGAGCCTGGAGG + Intergenic
1151325609 17:73378187-73378209 GGAGGATTGCTTGAGCCAGGGGG - Intronic
1151366503 17:73620106-73620128 GGAGGATTGCTTAAGCCCAGGGG + Intronic
1151715616 17:75829679-75829701 GGAGAATTGCTTAACCCAGGAGG - Intronic
1151721800 17:75861092-75861114 GGAGGATTGCTTCGCTCAGGAGG + Intergenic
1151822178 17:76502272-76502294 GGAGGCCTGGCTAGGCCAGGAGG + Intergenic
1151964011 17:77421937-77421959 GGAGGACTGCTGAGCCTAGGAGG - Intronic
1152075260 17:78155540-78155562 GGAGGATTGCTTAAGCCCAGGGG - Intronic
1152308130 17:79532980-79533002 GGAGGAATGCTGAGTCCAGCTGG - Intergenic
1152325353 17:79632823-79632845 GGAGGATGGCTTGGGCCTGGAGG + Intergenic
1152982605 18:292887-292909 GGAGGACGGCTTAAGCCCAGAGG + Intergenic
1153102505 18:1489448-1489470 GGAGGATTGCTTGAGCCCGGGGG - Intergenic
1153280456 18:3409898-3409920 GAAGGTCTGCTTTGTCCAGGAGG + Intergenic
1153465718 18:5386090-5386112 GGAGGATCGCTTGAGCCAGGGGG + Intergenic
1153677669 18:7469785-7469807 GGAGGATTGCTTAAGCCAAGAGG + Intergenic
1153847002 18:9059302-9059324 GGAGGATTGCTTGAGACAGGAGG - Intergenic
1153860018 18:9193227-9193249 GGAGGACTGCTTGAGCTGGGAGG - Intronic
1155267505 18:24107847-24107869 GGAGGATTGCTTGAGCCGGGAGG - Intronic
1155487632 18:26363453-26363475 GGAGGATAGCTTGGCCCAGGAGG + Intronic
1155964483 18:32023070-32023092 GGAGGATTGCTGAGCCCAGGAGG - Intronic
1156300745 18:35833927-35833949 GCAGGAATGTTTTGGCCAGGAGG - Intergenic
1157349353 18:46870820-46870842 GCAGGAATGTTTTGGCCAGGAGG - Intronic
1157439763 18:47701777-47701799 GGAGAACTGCTGAACCCAGGAGG + Intergenic
1158021411 18:52846447-52846469 GGAGGATTGCTTGAGCCAGAAGG + Intronic
1158333245 18:56385974-56385996 GGAGGATCGCTTGAGCCAGGAGG + Intergenic
1158461629 18:57651194-57651216 GGAGGACACCTGAGCCCAGGAGG - Intronic
1158463851 18:57671711-57671733 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1158538614 18:58331302-58331324 AGAGGACTGATTAGGCCTGATGG - Intronic
1158570988 18:58596909-58596931 GGAGAACTGGTTGGGCCTGGGGG - Intronic
1158852157 18:61505425-61505447 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1158937148 18:62375214-62375236 GGAGGACAGCCAAGCCCAGGAGG + Intronic
1158972456 18:62680868-62680890 GGAGGATTGCTTAATCCTGGAGG - Intergenic
1159833147 18:73303222-73303244 GGAGAATTGCTTGTGCCAGGAGG - Intergenic
1159915962 18:74188065-74188087 GGAGGATTGTTTGAGCCAGGAGG - Intergenic
1160317504 18:77860767-77860789 GGAGGACTGCAATGCCCAGGAGG - Intergenic
1160390491 18:78527677-78527699 GCAGGAGTGCTGAAGCCAGGCGG - Intergenic
1160615074 18:80120038-80120060 GGAGGAAGGCTGAGGCCAAGTGG + Intronic
1161006483 19:1939814-1939836 GGAGGATTGCTTCAACCAGGAGG - Intergenic
1161065310 19:2234616-2234638 GGAGGACTGCTTGAGCCAAGGGG + Intronic
1161072511 19:2269911-2269933 AGAGCACTGCTAAGGCCGGGGGG - Intronic
1161145633 19:2676500-2676522 GGAGGATCGCTTGAGCCAGGCGG - Intronic
1161260363 19:3334478-3334500 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1161355686 19:3818374-3818396 GGAGGACAGCTTGAGCCCGGGGG + Intronic
1161514976 19:4691383-4691405 GGAGGACTGCTTGAGCCAGGAGG + Intronic
1161518837 19:4712321-4712343 GGAGGACTGCTTGAGCCTAGGGG + Intronic
1161527491 19:4765795-4765817 GGAGGATTGCCTGAGCCAGGAGG + Intergenic
1161633742 19:5373900-5373922 GGAGGATCGCTTAACCCAGGAGG - Intergenic
1162413004 19:10517649-10517671 GGAGGACAGCCCAGGCCCGGAGG - Intronic
1162522361 19:11189180-11189202 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1162714767 19:12623313-12623335 GGAGGATTGCTTGAGCCGGGAGG + Intronic
1162749691 19:12821289-12821311 GGAGGATTACTTGAGCCAGGAGG - Intronic
1163009766 19:14417772-14417794 GGAGGATCGCTTGAGCCAGGAGG + Intronic
1163129161 19:15261390-15261412 GGAGAACTGCTTGAACCAGGAGG + Intronic
1163137038 19:15319372-15319394 GGAGGATCACCTAGGCCAGGAGG + Intronic
1163161577 19:15468039-15468061 GGAGGATTGCTTGGGCTGGGAGG - Intergenic
1163260963 19:16189764-16189786 AGAGGACTGCTTGACCCAGGAGG - Intronic
1163402337 19:17101687-17101709 GGAGGCATGCTGAAGCCAGGCGG + Exonic
1163422709 19:17223331-17223353 GGAGAATTGCTTGGCCCAGGAGG + Intergenic
1163427885 19:17249008-17249030 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1163512828 19:17746203-17746225 GGAGGATTGCTTTAGCCCGGGGG + Intergenic
1163653775 19:18533612-18533634 GGAGGATTGCTTGAACCAGGGGG + Intronic
1163781889 19:19254850-19254872 GGAGGATTGCTTGAGCCAGAAGG - Intergenic
1164082277 19:21868855-21868877 GGAGGCCTGCTGCTGCCAGGGGG + Intergenic
1164189866 19:22904176-22904198 GGAGGCCTGCTGCTGCCAGGGGG + Intergenic
1164479148 19:28598151-28598173 GGAGGGCTGCTAGGGACAGGAGG + Intergenic
1164982500 19:32624841-32624863 GGAGGATGGCTTGAGCCAGGAGG + Intronic
1165069860 19:33248985-33249007 AGAGGACTGCTTAGGGGAGAAGG - Intergenic
1165298733 19:34952748-34952770 GGAGGATTGCTGAGCCCAGCAGG + Intergenic
1165379234 19:35466313-35466335 GGAGGATCACTTAGCCCAGGAGG + Intergenic
1165597835 19:37025864-37025886 GGAGGATTGCTGAGCCCAGGAGG - Intronic
1165800835 19:38548666-38548688 GGAGGATTGCTTAAGCCAGGAGG - Intronic
1166061368 19:40327781-40327803 GGAAGAGTGCTCAGGCCAAGGGG + Intronic
1166145469 19:40831686-40831708 GGAGGATTGCCTGAGCCAGGGGG + Intronic
1166149576 19:40862582-40862604 GGAGGATTGCCTGAGCCAGGGGG + Intronic
1166336323 19:42110170-42110192 GGAGGATTGCTTCAGCCAGGAGG + Intronic
1166527376 19:43520608-43520630 GGAGGATCGCTTGAGCCAGGAGG + Intronic
1166743600 19:45129387-45129409 GGAGAACTGCTTAACCCAAGAGG - Intronic
1167008568 19:46791088-46791110 GGAGGATCGCTTGAGCCAGGAGG + Intergenic
1167032720 19:46974083-46974105 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1167086993 19:47317100-47317122 GGAGGATTGCTTGAGCCAGAGGG + Intronic
1167118340 19:47501192-47501214 GGAGGACTGCCCAGGCCGGGAGG - Intronic
1167253354 19:48413387-48413409 GGAGGATTGCTTGAACCAGGAGG + Intronic
1167510882 19:49894861-49894883 GGAGGTCTGGTTGGACCAGGTGG + Intronic
1167642079 19:50687551-50687573 GCGGGGCTGCTGAGGCCAGGGGG - Intronic
1167759983 19:51440082-51440104 GGAGGACTGCCTGAGCCTGGAGG + Intergenic
1167864867 19:52316576-52316598 GGAGGATTGCTTAAGCCTAGGGG - Intronic
1168270024 19:55244832-55244854 GGAGGATTGCTTGAGCCGGGAGG - Intronic
1168432132 19:56289702-56289724 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1168552186 19:57305607-57305629 GGAGGACTGCTTAGGCCAGGAGG - Intergenic
1168652423 19:58100178-58100200 GGAGGATTGCTTGAGCCCGGGGG - Intronic
925076586 2:1021700-1021722 GGAGGATTGCTTGAGCCAGGAGG - Intronic
925401518 2:3576267-3576289 GGGAGACTGTTCAGGCCAGGAGG - Intronic
925613695 2:5725285-5725307 GGAGGACTGCTTGAGCCAGGAGG - Intergenic
925938094 2:8787457-8787479 GGAGGACTGCTTAAGCTTCGGGG - Intronic
926017861 2:9470130-9470152 GGAGAATTGCTTAAACCAGGAGG + Intronic
926646772 2:15298117-15298139 GGAGGACTGCTTGAGCCCAGGGG + Intronic
926700894 2:15802597-15802619 GGAGGATTACTTAGCTCAGGAGG + Intergenic
926968044 2:18437742-18437764 GGAGGATTGCTTGAGCCCGGGGG - Intergenic
927942658 2:27114958-27114980 GGAGGATTGCTTGAGCCTGGGGG - Intronic
928507371 2:31967536-31967558 GGAGGATTGCTTGAGCCCGGAGG - Intronic
929036233 2:37694604-37694626 GGAGGATTGCTTAGCCTGGGAGG + Intronic
929067696 2:37996492-37996514 GGAGGATTGTTGAGCCCAGGAGG + Intronic
929193799 2:39164605-39164627 GGAGGATGGCTTGAGCCAGGAGG + Intergenic
929205847 2:39291784-39291806 GGAGGACTGCTTGAGCCAGGAGG + Intronic
929249634 2:39738471-39738493 GGAGGACTGCTTGAGCCCAGGGG + Intronic
929320866 2:40542010-40542032 GGAGGATTGCTTGAGCTAGGAGG + Intronic
929447558 2:42013583-42013605 GGAGGATTGCTTCAGCCTGGGGG + Intergenic
929512598 2:42576537-42576559 GGAGGATTGCTTGAGCCTGGGGG + Intronic
929522465 2:42666438-42666460 GGAGGACTGTTTGGGCAAAGGGG - Intronic
929580093 2:43076588-43076610 GGAGGATCGCTTAAGCCCGGAGG - Intergenic
930029309 2:47048691-47048713 GGAGGATTGCTTAAGCCCAGGGG - Intronic
930077349 2:47417608-47417630 GGAGGATTGTTTAGCCCAGGAGG + Intronic
930643042 2:53874050-53874072 GGAGGATCGCTTAAGCCTGGAGG - Intronic
931261221 2:60621022-60621044 GGAGGATTGCTTGAACCAGGAGG + Intergenic
931401420 2:61934841-61934863 GGAGGACTGCTTGAGCCTAGGGG - Intronic
931413591 2:62059243-62059265 GGAGGATCACTTAGCCCAGGAGG - Intronic
931455039 2:62403271-62403293 GGAGGACTGCTTGAGCCCTGGGG - Intergenic
931456405 2:62412939-62412961 GGAGGACTGCTTAAGGCTAGGGG - Intergenic
931688795 2:64817757-64817779 GGAGAATTGCTTGAGCCAGGAGG - Intergenic
931702696 2:64922024-64922046 GGAGGATCGCTGAGTCCAGGAGG + Intergenic
932230822 2:70082801-70082823 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
932262648 2:70340088-70340110 GGAGGATTACTTGAGCCAGGAGG - Intergenic
932637536 2:73405000-73405022 GGAGGACTGCTTGAGCCTGGAGG - Intronic
932685954 2:73870431-73870453 GGAGGCCTGCTAAGCCCAGATGG - Intronic
932778309 2:74542713-74542735 GGAGAATTGCTGAGCCCAGGAGG - Intronic
933849159 2:86351842-86351864 GGAGGACTGCTTAAGCCTAGAGG - Intergenic
933857269 2:86428020-86428042 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
934056932 2:88258923-88258945 GGAGGATTGCTTGAGCTAGGAGG + Intergenic
934523382 2:95033686-95033708 GGAGGATTGCTTGAGCCTGGAGG + Intronic
935028147 2:99296925-99296947 GGAGGACTGCTTGAGCCCAGAGG + Intronic
935319850 2:101875807-101875829 GGAGAAGTGCTTTGGCCAAGGGG + Intronic
935652543 2:105394480-105394502 GGAGGACTGCTTGAGCCCAGGGG + Intronic
937738851 2:125324222-125324244 GGAGAATTGCTTCAGCCAGGAGG + Intergenic
938052606 2:128188717-128188739 GGAGGATTGCTTGAGCCTGGAGG + Intronic
940910220 2:159203800-159203822 GGAGGACTGCTTGAGCCCAGGGG - Intronic
940966820 2:159847420-159847442 GGAGGCCTGCTTAAGCCCTGGGG - Intronic
941672289 2:168308192-168308214 GGAGAACTGCTTAACCTAGGAGG - Intergenic
941765533 2:169292435-169292457 GGAGTACTGCTTAGGCAGTGAGG - Intronic
941774847 2:169381907-169381929 GGAGGACTGCTTGAGCCTGGTGG + Intergenic
941800210 2:169651302-169651324 GGAGGACTGCTTGAGCCCAGGGG + Intronic
941824215 2:169875417-169875439 GGAGGATGGCTTAAGCCTGGAGG - Intronic
941992531 2:171570881-171570903 GGAGGATTGCTGAGCCGAGGTGG + Intergenic
942117951 2:172747686-172747708 GGAGGATTGCTTAAGCCCAGGGG - Intronic
942445966 2:176079506-176079528 GGAGGTCTGATAAGGCCGGGAGG - Exonic
942897562 2:181075829-181075851 GGAAGATTGCTTGAGCCAGGAGG + Intronic
943069730 2:183126124-183126146 GGAGGATTGCTTGAGCCCGGAGG - Intronic
943331123 2:186560325-186560347 GGAGGAATGCTTGAGCCAGGAGG + Intergenic
943430201 2:187790153-187790175 GGAGAACTGCTTAAGCCAGGAGG + Intergenic
943584879 2:189726370-189726392 GGAGGACTGCTTGAGCCCAGGGG - Intronic
944694994 2:202192839-202192861 GGAGGATTGCTTGGGCCCAGGGG - Intronic
945097586 2:206234033-206234055 GGAGGATTGCTTGAGCCAGGAGG + Intergenic
945122694 2:206473920-206473942 GGAGGATTGCTTCAGCTAGGAGG + Intronic
945658962 2:212660715-212660737 GAAGGACTGCTTAAGCCCAGGGG - Intergenic
945971932 2:216239318-216239340 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
946254382 2:218432307-218432329 GAAGGACTGCTTTGGCTATGAGG + Intronic
946284322 2:218691644-218691666 GGAGGATTGCTTGAGCCCGGAGG - Intronic
946359645 2:219211391-219211413 GGAGGATTGCATGAGCCAGGAGG - Intronic
946744784 2:222834580-222834602 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
946944475 2:224806692-224806714 GGAGGATCGCTTGAGCCAGGAGG - Intronic
947444857 2:230156024-230156046 GGAGGATTGTTTGAGCCAGGAGG - Intergenic
947508479 2:230728698-230728720 GGAGGATTGCTTAAGCCTAGGGG - Intronic
947513786 2:230783587-230783609 GGAGGATTGCTTGAGCCTGGGGG - Intronic
947667124 2:231913190-231913212 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
948049962 2:234972634-234972656 GGAGGATGGCTGAGCCCAGGAGG + Intronic
948384191 2:237571539-237571561 GGAGGATTGCTTAGGCCTCGGGG - Intergenic
948435958 2:237954567-237954589 GAAGGATTGCTTGGGCCAGGAGG + Intergenic
948601208 2:239108368-239108390 GGACGAATGCAGAGGCCAGGCGG + Intronic
949066246 2:241992352-241992374 GGAGGAACCCTAAGGCCAGGAGG - Intergenic
1168856610 20:1013432-1013454 TGAGGACTTCGTGGGCCAGGGGG - Intergenic
1169124617 20:3118380-3118402 GGAGAATTGCTTAGACCAGGAGG + Intronic
1169231900 20:3895372-3895394 GGAGGATTGCTTGAGCCCGGAGG + Intronic
1169450260 20:5704888-5704910 GGAGGATTGCTTGAACCAGGAGG + Intergenic
1170304148 20:14919009-14919031 GGAGGACTCCTTAGGACAAAAGG - Intronic
1170449758 20:16470572-16470594 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1172158589 20:32848134-32848156 GCAGGACTGCTTGACCCAGGAGG - Intronic
1172265583 20:33610197-33610219 GGAGGACACCTGAGTCCAGGAGG + Intronic
1172351531 20:34246553-34246575 GGAGGATTGCTTGAGCCCGGAGG - Intronic
1172524606 20:35591565-35591587 GGAGGACTGCTTGGGCCTCAGGG - Intergenic
1172530544 20:35627917-35627939 GGAGGACTGCTTGAGCCCAGGGG + Intronic
1173501927 20:43560051-43560073 TGAGGGCTGCTTAGGCATGGGGG + Intronic
1173528141 20:43748480-43748502 GGAGGGTTGCTTAAGGCAGGAGG - Intergenic
1173860305 20:46278672-46278694 GGAGGATTGCTTAGCCTGGGAGG - Intronic
1173965771 20:47111538-47111560 GGAACACTTCTTAGGCCACGAGG - Intronic
1174015066 20:47481241-47481263 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1174181580 20:48678378-48678400 GGAGGACTGCCTGAGCCTGGAGG + Intronic
1174469982 20:50751058-50751080 GGAGGACTGCTTGAGCCCAGGGG - Exonic
1174502960 20:50999147-50999169 CTTGGAGTGCTTAGGCCAGGTGG + Intergenic
1174597207 20:51693626-51693648 GGAGGATTGCTTAAGCCTGCGGG - Intronic
1175080898 20:56419515-56419537 GGAGGATCACTTAAGCCAGGAGG - Intronic
1175223204 20:57429241-57429263 GGAGAGCTGCCCAGGCCAGGAGG - Intergenic
1175318898 20:58071619-58071641 GGAGGACTGCTTAGAGGAGGTGG - Intergenic
1175889446 20:62309846-62309868 GGGGGACTCCTGAGGCCAGGTGG + Intronic
1176295663 21:5070776-5070798 GGAGGACTACCTAGGCTCGGGGG + Intergenic
1177076506 21:16582307-16582329 GGAGAATTGCTTGAGCCAGGAGG - Intergenic
1177827148 21:26096684-26096706 GGAGGACAGCTTAAGCGAGGAGG + Intronic
1178276467 21:31242430-31242452 GGAGGATTGCTCAGCCCAGGAGG + Intronic
1179207125 21:39292034-39292056 GGAGGATTGCTTGAGCCAGGAGG - Intronic
1179355621 21:40655960-40655982 GGAGGATTGCTTAGCCCAGGAGG + Intronic
1179519735 21:41934337-41934359 GGAGGACTGTTGAGCCCAGGAGG + Intronic
1179861386 21:44191348-44191370 GGAGGACTACCTAGGCTCGGGGG - Intergenic
1180548523 22:16523373-16523395 GGAGAATTGCTTGAGCCAGGAGG - Intergenic
1180947258 22:19703226-19703248 AGGGGACTGCTTAGCCCAGGAGG - Intergenic
1181169710 22:21001263-21001285 GGAGGACTGCTTTGAGCTGGTGG - Exonic
1181348846 22:22241054-22241076 GGAGGACTGCTTGAGGCCGGGGG + Intergenic
1181385026 22:22538424-22538446 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1181609524 22:24003299-24003321 GAAAGACTGCTTGAGCCAGGAGG - Intergenic
1182210933 22:28677062-28677084 GGAGAATTGCTTGAGCCAGGAGG + Intronic
1182472981 22:30560040-30560062 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1182625142 22:31640286-31640308 GGAGGATTGCTTGAGCCAGGAGG - Intronic
1182899711 22:33887645-33887667 GGAGAACTGCTTGAGCCTGGAGG + Intronic
1183531190 22:38354225-38354247 GGAGGACTGCTTGAGCTCGGGGG + Intronic
1183742618 22:39677313-39677335 GGAGGACAGGTGAGGCCGGGTGG - Intronic
1183836342 22:40456595-40456617 GGAGGATGGTTTGGGCCAGGAGG + Intronic
1183914811 22:41109163-41109185 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1184364976 22:44045011-44045033 GGAGGATTGCTTGAGCCCGGTGG + Intronic
949508696 3:4750027-4750049 AGACAACTGCTTAGGCCTGGAGG + Intronic
949971682 3:9412491-9412513 GGAGGACTGCTTGAGCCCAGTGG - Intronic
949992330 3:9589949-9589971 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
950218955 3:11179859-11179881 GGAGGACTGCTTGAGCCCAGGGG - Intronic
950769526 3:15300621-15300643 GGTGGGCTGCTCAGGCCAGATGG - Intronic
950962246 3:17118987-17119009 GGAGGCCTGCTTTGGCCAGAGGG + Intergenic
951556180 3:23922892-23922914 GGAGGATTGCTTGAGCCAGGAGG - Intronic
951824665 3:26854907-26854929 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
953317163 3:41939668-41939690 GGAGGACCACTTGAGCCAGGGGG + Intronic
953716310 3:45319547-45319569 GGAGGACGACTTAGGCCAAATGG - Intergenic
953875967 3:46667113-46667135 GGAGGGATGCTGAGGCCAGAGGG - Intergenic
953947410 3:47161818-47161840 GGAGGACTGCTTAAGCCCAGAGG + Intronic
953985131 3:47435957-47435979 GGAGGACTGCTTAAGCCTAGAGG + Intronic
954023002 3:47759100-47759122 GGAGGATTGCTTGAGCCAGGTGG - Intronic
954194292 3:48987199-48987221 GGAGGATTGCTTGGGCCTGGGGG + Intergenic
954268815 3:49491399-49491421 GGAGAACTGCTTGACCCAGGAGG - Intronic
954271766 3:49515474-49515496 AGAGGATTGCTTAAGCTAGGAGG - Intronic
954353214 3:50062982-50063004 GGAGGACTGCTTAAGCCCATGGG - Intronic
954741335 3:52753210-52753232 GGAGGATTGCTTGAGCCGGGAGG + Intronic
955048732 3:55388365-55388387 GGAGAACTGCTTGAACCAGGAGG - Intergenic
955184362 3:56700916-56700938 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
955330680 3:58044532-58044554 GGAGGATTGCTTGAGCCTGGCGG + Intronic
955424490 3:58773463-58773485 GGAGGACTGCTTGAGCCTGGAGG + Intronic
955806179 3:62737376-62737398 GGAGGATTGCTGAGCCCAGGAGG + Intronic
956445495 3:69321931-69321953 GGAGGACTACTTGAGCCTGGGGG - Intronic
956647087 3:71466766-71466788 AGAGCACTGCCTAGGGCAGGGGG + Intronic
958047302 3:88301815-88301837 GCAGGAATGCTTGAGCCAGGAGG - Intergenic
958137970 3:89520707-89520729 GGAGGATTGCTTGAGCCAGGAGG + Intergenic
958591485 3:96163855-96163877 GGAAGATTGCTTAGCCCAGTAGG + Intergenic
958931452 3:100212293-100212315 GGAGGATCGCTTGAGCCAGGAGG - Intergenic
959096213 3:101958927-101958949 GGAGGATTGCTTGGGCCTAGGGG + Intergenic
959903721 3:111687774-111687796 GGAGAACTGCTTGAGCCAGGAGG - Intronic
959959863 3:112285854-112285876 GGAGGACTGCTTGAGCCAGGAGG - Intronic
960097708 3:113703684-113703706 GGAGGATTGCTTGAGCCAGGAGG + Intergenic
960805885 3:121583615-121583637 GGAGGATTGCTTGAGCCAGGAGG - Intronic
961228750 3:125280589-125280611 GGAGGATCACTTGGGCCAGGAGG + Intronic
961654807 3:128435364-128435386 GCAGGACTGGTTAGTCCAGGTGG + Intergenic
961776315 3:129288604-129288626 GGAGGATGGCTTGAGCCAGGAGG + Intronic
962496258 3:135943254-135943276 GGAGGATCGCTTCAGCCAGGAGG - Intergenic
963012807 3:140789295-140789317 GGAGGATTGTTTGAGCCAGGGGG + Intergenic
963300964 3:143596885-143596907 GGAGGACTGCTTGAGCCGAGGGG - Intronic
964366710 3:155958346-155958368 GGAGGATTGCTTGAACCAGGAGG - Intergenic
964469682 3:157039526-157039548 GGAGGACTGCTTGAGCCTCGGGG + Intronic
964500840 3:157346695-157346717 GGAAGATTGCTTGAGCCAGGAGG - Intronic
964587005 3:158317647-158317669 GGAGGACTGCTTGAGCCCAGGGG - Intronic
964768549 3:160201364-160201386 GGAGGACCACTTGAGCCAGGAGG + Intergenic
965094034 3:164199668-164199690 GGAGGATTGATTGAGCCAGGAGG - Intergenic
965322105 3:167263125-167263147 GGAGAATTGCTTGAGCCAGGAGG - Intronic
965544576 3:169902664-169902686 GGAAGATTGCCTAGGCCTGGGGG - Intergenic
965578419 3:170242349-170242371 AGAGGATTGCTTAGCCCAGGAGG + Intronic
965752658 3:171992379-171992401 GGAGGACTGCTTGAGCCTGGAGG - Intergenic
966146214 3:176814629-176814651 GGAGCACTGCAGAGGCCATGTGG - Intergenic
966395251 3:179495384-179495406 GGTGGATTGCTTGAGCCAGGAGG + Intergenic
966524776 3:180908864-180908886 GGAGGATTGCTTGAGCCTGGAGG - Intronic
966723699 3:183089521-183089543 GGAGGATTGCTTGAGCCTGGGGG + Intronic
966751198 3:183323705-183323727 AGAGGACTGCTTGGGCCTGGAGG + Intronic
967022179 3:185532417-185532439 GGAGGACTGCTTGTGCCTGGGGG + Intronic
967126491 3:186429091-186429113 GGAGAATTGCTTGGACCAGGAGG + Intergenic
967442513 3:189525599-189525621 GGTGGATTGCTTGAGCCAGGAGG + Intergenic
967463556 3:189776028-189776050 GAAGGACTGCTTAGCCCAGGAGG + Intronic
968021497 3:195394803-195394825 GGAGGACTGCTTGAGCCCGGAGG + Intronic
968053984 3:195676859-195676881 GGAGGATTGCTTGAACCAGGAGG + Intergenic
968101907 3:195972287-195972309 GGAGGATTGCTTGAACCAGGAGG - Intergenic
968147880 3:196314729-196314751 GGAGGATCGCTTGAGCCAGGAGG + Intronic
968569700 4:1333108-1333130 GGAGGACTGCTTGAGCCCAGGGG + Intronic
968662711 4:1805379-1805401 GGAGGGCTGCTTCGGCCAGGTGG + Exonic
968699367 4:2047389-2047411 CGAGGCCTGCATGGGCCAGGCGG + Intergenic
968999116 4:3965724-3965746 GGAGAACTGCTTGAGCCCGGGGG - Intergenic
969814786 4:9679191-9679213 GGAGAACTGCTTGAGCCCGGGGG + Intergenic
969870632 4:10102391-10102413 GGAGAGGTGATTAGGCCAGGAGG + Intronic
970031180 4:11676800-11676822 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
970467143 4:16335823-16335845 GGAGGAGTGCTTGAGCCCGGGGG + Intergenic
970903907 4:21193024-21193046 GGAGGACAGCTTGAGACAGGAGG + Intronic
970905885 4:21215904-21215926 GGAGGATGGCTTGGGCTAGGAGG - Intronic
970947072 4:21707084-21707106 GGAGGACTTCCTATGCCAGTAGG - Intronic
971192943 4:24444960-24444982 GGAGGATTGCTAAGCCCAGGAGG + Intergenic
971199586 4:24499821-24499843 GGAGGATTGCTTGAACCAGGGGG + Intergenic
971539620 4:27800029-27800051 GGAGGCCTTCTGTGGCCAGGAGG - Intergenic
971922726 4:32963580-32963602 GGAGGATCGCTTGAGCCAGGAGG - Intergenic
972305691 4:37827321-37827343 GGGGGACTCCTGAAGCCAGGCGG - Intronic
972510542 4:39764974-39764996 GGAGAATGGCTGAGGCCAGGAGG - Intronic
972642289 4:40936339-40936361 GGAGGATTGCTTGAGCCAGGAGG - Intronic
972689512 4:41382879-41382901 GGAGGATTGCTTGGCCCAGGAGG - Intronic
973011363 4:45078868-45078890 GGAGAATTGCTTGAGCCAGGCGG - Intergenic
973758474 4:54097083-54097105 GGTGGAGTGCCTTGGCCAGGAGG + Intronic
973949407 4:55996209-55996231 GGAAGACTGCTTGAGCCAGGAGG - Intronic
974800420 4:66810818-66810840 GGAGAATTGCTTAAGGCAGGAGG + Intergenic
974874274 4:67683985-67684007 GGAGAATTGCTTGAGCCAGGAGG + Intronic
975242813 4:72081714-72081736 GGAGGACTGCTTGAGCCCAGAGG - Intronic
975752570 4:77539152-77539174 GGAGAAATGCTTGAGCCAGGAGG - Intronic
975777010 4:77798222-77798244 GGAGGACTGCTTGAGCCCAGAGG + Intronic
976170179 4:82295351-82295373 GGAGGATTGATTGAGCCAGGAGG - Intergenic
976284576 4:83359125-83359147 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
976800821 4:88989509-88989531 GGAGGACTGCTTGAGCCCGGAGG + Intronic
976965794 4:91039116-91039138 GGAGGATTGCTTGAGCCAAGTGG - Intronic
977899026 4:102397160-102397182 GGAGGAAGACTTAGGCCGGGAGG - Intronic
977905412 4:102472522-102472544 GGAGAATTGCTTGGGCCTGGGGG - Intergenic
977952120 4:102984204-102984226 GGAAGATTGCTTACCCCAGGAGG - Intronic
978573418 4:110164927-110164949 GGAGGATTGCTTGAGCCTGGGGG - Intronic
979295034 4:119022420-119022442 GGAGGATTGTTTGAGCCAGGAGG - Intronic
979354456 4:119686532-119686554 GGAGGATTGCTTAAGCCTAGGGG + Intergenic
979533655 4:121795390-121795412 GGAGAATTGCTTGAGCCAGGAGG + Intergenic
981895167 4:149789812-149789834 GGAGGATTGTTGAGCCCAGGAGG + Intergenic
981991330 4:150924420-150924442 GGAGGATTGCTTGACCCAGGAGG + Intronic
982689394 4:158531124-158531146 GGAGGATTGCTTGAGCCAGGGGG - Intronic
982742497 4:159072551-159072573 GGAGAATTGCTTAGTCCAGGAGG - Intergenic
983052967 4:163070091-163070113 GGAGGATTGCTTAGGGCCAGGGG + Intergenic
983199111 4:164841684-164841706 GGAGGATTGCTTGAGCCTGGTGG - Intergenic
983397579 4:167220466-167220488 GGAGGATTGCTTGATCCAGGAGG - Intronic
983559117 4:169083729-169083751 GGAGGATTGTTGAGCCCAGGAGG + Intergenic
984007382 4:174329035-174329057 GGAGGATTGCTTGAGCCAAGGGG - Intronic
984607633 4:181803843-181803865 GGAGGATTGCTTGAGCCAGGAGG + Intergenic
984705005 4:182841207-182841229 GGAGGATTGCTTGGCCCGGGAGG + Intergenic
985147996 4:186914183-186914205 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
985535058 5:459985-460007 GGAGAACAGATTAGGCAAGGGGG - Intronic
985687042 5:1287407-1287429 AGAGGACGGCTCAGGCCAGAAGG + Intronic
985737113 5:1590218-1590240 GGAGGATTGCTTGAACCAGGAGG - Intergenic
986290233 5:6393886-6393908 GCAGGACTGCTTCTGACAGGTGG - Intergenic
986712855 5:10500403-10500425 GGAGGACTGCTTGGGGCCAGGGG + Intergenic
987112020 5:14697265-14697287 GGAGAACTGCTTGAACCAGGAGG - Exonic
987342152 5:16948787-16948809 GGAGGATTGCTTGAGCCAGGGGG - Intergenic
987405107 5:17517195-17517217 GGAGAATTGTTTAGGCCAGGAGG + Intergenic
987767229 5:22248207-22248229 GGAGAATTGCTTAACCCAGGAGG + Intronic
988933857 5:36063724-36063746 GGAGGATCGCTTGAGCCAGGAGG - Intronic
989564261 5:42885856-42885878 GGAGGACTGCTTGAGCCAGGAGG - Intronic
989720500 5:44522654-44522676 GGAAGATTGCTTGAGCCAGGAGG + Intergenic
990584510 5:57197446-57197468 GGAGAACTGCTTGAACCAGGAGG - Intronic
990644322 5:57826702-57826724 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
991366634 5:65875188-65875210 GGAGGATTGCTTGAGCCTGGAGG + Intergenic
991390024 5:66132676-66132698 GGAGGACTGCTTGAGGCAAGGGG + Intergenic
991390791 5:66141555-66141577 GGAGGACTGCTTGAGCCTGGGGG - Intronic
992090315 5:73311128-73311150 GGAGGATTGCTTGAGTCAGGAGG - Intergenic
992272266 5:75077294-75077316 GGAGGACTGCTTGGGGCCAGGGG - Intronic
992304538 5:75422524-75422546 GGAGGACTGCTTGGGCCTGGGGG + Intronic
992710106 5:79444292-79444314 GGAGGACTGCTTGAGCCCAGGGG - Intronic
992771632 5:80054243-80054265 GGAGGATTGCTTGAGCCTGGGGG - Intronic
992810977 5:80388214-80388236 GGAGGATTGCTTGAGCCTGGTGG + Intergenic
992841306 5:80697996-80698018 GGAGGATTGCTTGAGCCTGGGGG - Intronic
993997022 5:94735367-94735389 GGAGGATTGCTTGAGCCAGGAGG - Intronic
994903520 5:105805763-105805785 AGAGGATTGCTCAAGCCAGGAGG - Intergenic
995817518 5:116188717-116188739 GGAGGATTGCTTGAGCCGGGAGG - Intronic
997245082 5:132341024-132341046 GGAGAACTGCTTGACCCAGGAGG + Intronic
997698832 5:135882163-135882185 GGAGGACTGCTAAGGCAGGGAGG + Intronic
997896397 5:137721713-137721735 GGAGGACTGCTTGTGCCCAGGGG + Intronic
997967801 5:138373571-138373593 GGAGGATGGCTTAAGCCTGGGGG - Intronic
998038477 5:138936107-138936129 GCAGGATGGCTTAGGCCAGGCGG - Intergenic
998081725 5:139281099-139281121 GGAGGTTTGCTTGGCCCAGGAGG - Intronic
998235658 5:140396632-140396654 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
998375116 5:141685409-141685431 GGAGGATTGCTTGAGCCAGGAGG + Intergenic
998423791 5:142010595-142010617 TGAGTATTGCTTGGGCCAGGAGG - Intronic
998429104 5:142055094-142055116 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
998787112 5:145724831-145724853 GGAGGATTGCTTGAGCCTGGAGG - Intronic
999223893 5:150003862-150003884 GAAGGATTGCTGAGCCCAGGAGG + Intronic
999802658 5:155052205-155052227 GGAGGATTGCTCGTGCCAGGAGG + Intergenic
999968276 5:156832990-156833012 GGAGGATTGCTTAAGCATGGGGG + Intergenic
1000049207 5:157547387-157547409 TGAGGAGTGATTAGGCCATGAGG + Intronic
1000731716 5:164842997-164843019 GGAGGACTGCTTAAGGCCAGGGG - Intergenic
1000772933 5:165379602-165379624 GGAGGATTGCTTGAGCCAGGGGG + Intergenic
1000886109 5:166749443-166749465 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1001068352 5:168558892-168558914 GGAGGATTGATGAGCCCAGGAGG + Intronic
1001635807 5:173209361-173209383 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1001980534 5:176034846-176034868 GGAGGCCAGCTTGGGCCAGGAGG - Intergenic
1002120357 5:176998962-176998984 GGAGGACTGTTTGAGCTAGGGGG + Intronic
1002236927 5:177809219-177809241 GGAGGCCAGCTTGGGCCAGGAGG + Intergenic
1002381187 5:178831309-178831331 GGAGGCCAGCTTGGGCCAGGAGG - Intergenic
1002514112 5:179744274-179744296 GGAGAACTGCTTAAACCCGGGGG - Intronic
1003364057 6:5456122-5456144 GGAGGATTGCTTGAGCCTGGAGG + Intronic
1003682829 6:8272628-8272650 GGAGGATTGCTTGAGGCAGGAGG + Intergenic
1004411226 6:15383224-15383246 GGAAGACTGCTTAAGCCCAGGGG - Intronic
1004779861 6:18896286-18896308 GGAGGATGGCTTGAGCCAGGAGG + Intergenic
1004789337 6:19006716-19006738 GGAGGATTGCTTAAGCCCAGGGG + Intergenic
1005596301 6:27381646-27381668 GGAGGATTGCTTGACCCAGGAGG + Intronic
1006179340 6:32144994-32145016 GGAGGATTGCTTGGGCCTGAGGG - Intergenic
1006440931 6:34053306-34053328 GGAGAAGGCCTTAGGCCAGGAGG - Intronic
1006510876 6:34520405-34520427 GGAGAAGGCCTTAGGCCAGGAGG + Intronic
1006548817 6:34803092-34803114 GGAGGATTGCTTGAGCCGGGAGG + Intronic
1006633779 6:35447842-35447864 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1006759954 6:36451576-36451598 GGAGGACTGCTTAAGCCCGGAGG - Intronic
1006939935 6:37745012-37745034 AGAGGACTGCCCAGGCAAGGAGG + Intergenic
1007000657 6:38309277-38309299 GGAGAATTGCTTAACCCAGGAGG + Intronic
1007636189 6:43301237-43301259 TGAGGACAGCTTCAGCCAGGAGG + Exonic
1007719294 6:43875870-43875892 GAATCACTGCTTAGGGCAGGGGG - Intergenic
1008014441 6:46502643-46502665 TGAGGACTGCTTGTTCCAGGGGG - Intergenic
1008111728 6:47502365-47502387 GGAGCACTGCTTGACCCAGGAGG - Intronic
1008906424 6:56682261-56682283 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1009690413 6:67024538-67024560 GGAGGATTGCTTGTGCCTGGGGG + Intergenic
1010934039 6:81839058-81839080 GGGGTATTGCTTAGGGCAGGAGG + Intergenic
1011241912 6:85280790-85280812 GGAGGACTGCTTGAGCCCAGTGG - Intergenic
1011568006 6:88700417-88700439 GGAGGACAGCTTTAGCAAGGAGG - Intronic
1011601304 6:89062597-89062619 GGAGGATCGCTTAGGCCTGGGGG + Intergenic
1011662165 6:89603910-89603932 GGAGGATTGCTAAGCCCAGGAGG + Intronic
1011666737 6:89641813-89641835 GGAGAACTGCTTGAACCAGGAGG - Intergenic
1011845364 6:91556700-91556722 GGAGGACTGCTTGAGCCTGGTGG + Intergenic
1012232537 6:96777326-96777348 GGAGGATTGCTTGACCCAGGAGG - Intergenic
1012402884 6:98858945-98858967 GGAGGACAGCTTCCACCAGGAGG - Intergenic
1012403007 6:98860163-98860185 GGAGGATGGCTTGAGCCAGGAGG - Intergenic
1012466593 6:99522552-99522574 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1012581860 6:100879559-100879581 GGAGGACTGCTTGAGCCTAGGGG + Intronic
1013049385 6:106517234-106517256 GGAGGATTGCTTGAGCCAAGGGG - Intronic
1013160344 6:107537728-107537750 GGAGGATTGCTTAGCCCAGGAGG + Intronic
1013220850 6:108075591-108075613 GGAGGATGGCTTGAGCCAGGAGG + Intronic
1013331235 6:109102286-109102308 GCAGGACTGCTTGAGCCAAGGGG - Intronic
1013360913 6:109393305-109393327 GGAGGATCACTTAAGCCAGGAGG - Intronic
1013541267 6:111112258-111112280 GGAGGACTGCTTGAGCCTAGAGG - Intronic
1013789723 6:113822978-113823000 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1014032731 6:116724697-116724719 GGAGGACTGCTTGAGCCAGGAGG - Intronic
1014037237 6:116781092-116781114 GGAGGATCACTTAAGCCAGGAGG - Intergenic
1014230516 6:118897062-118897084 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1014361062 6:120474671-120474693 GGAGGATTGCTTGAACCAGGGGG + Intergenic
1014601788 6:123421881-123421903 GGAGGACTGCTTGAGCCTAGGGG + Intronic
1015101626 6:129488217-129488239 GGAGAAATGCTTAAACCAGGGGG + Intronic
1015118118 6:129671471-129671493 GGAAGACTGCTTGAGCCTGGGGG + Intronic
1015237510 6:130987885-130987907 GGAGGACTGCTTGAGCCCAGGGG + Intronic
1015242923 6:131046143-131046165 GGAGGATTGCTTCAGTCAGGAGG - Intronic
1016209795 6:141516978-141517000 GGAGGATTGCTTGAGCCGGGAGG - Intergenic
1016448316 6:144155314-144155336 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1016764318 6:147775023-147775045 CCAGGACTATTTAGGCCAGGAGG - Intergenic
1017753245 6:157508454-157508476 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1018424970 6:163671758-163671780 GGAGGGCTGCTTAGACTGGGCGG - Intergenic
1019143611 6:169963000-169963022 GGAAGACTGCGAAGGCCAGGTGG - Intergenic
1019154144 6:170027725-170027747 TGTGGACTTATTAGGCCAGGAGG + Intergenic
1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG + Exonic
1019528400 7:1491673-1491695 GGAGGACTGCTTGAGCCCAGAGG + Intronic
1019701767 7:2477651-2477673 GTGGGACTGCTGAGGCCGGGAGG + Intergenic
1019783129 7:2956397-2956419 GAAGGATTGCTTAAGCCAGGAGG + Intronic
1019923444 7:4177424-4177446 AGAGAACTCCTTAGGGCAGGGGG - Intronic
1020253224 7:6485641-6485663 GGAGGATTGCTTGGGCCCAGGGG + Intergenic
1020384976 7:7591368-7591390 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1020698978 7:11453387-11453409 TGAGGACTCCTAGGGCCAGGAGG + Intronic
1020708025 7:11570079-11570101 GGAGGATTGCTTCACCCAGGAGG + Intronic
1021165752 7:17338443-17338465 GGAGGACTGCCTGAGCCTGGAGG - Intronic
1021439469 7:20661623-20661645 GGATAACTGCTTATCCCAGGAGG - Intronic
1021599761 7:22353978-22354000 GGAGGACCGCTTGAGCCAGAAGG + Intronic
1021742805 7:23704631-23704653 GGAGGACTGCTTGAGCCAGGAGG + Intergenic
1022016540 7:26354439-26354461 GGAGGATTGCTTGAGCCTGGTGG - Intronic
1022168101 7:27792870-27792892 AGAGGATTGCTTGAGCCAGGAGG + Intronic
1022893962 7:34730360-34730382 GGAAGACTGTTCAGGCCAGAGGG - Intronic
1023008709 7:35905608-35905630 GGAGGACTGCTTGAGCCCAGAGG - Exonic
1023786428 7:43713041-43713063 GGAGAATTGCTTGAGCCAGGAGG - Intronic
1023944839 7:44795503-44795525 GGAGGATTGCTTGAGCCCGGAGG - Intergenic
1024254210 7:47527815-47527837 GGAGGATGGCTTGGGCCAGGAGG + Intronic
1025191790 7:56901305-56901327 GGAGGACTGCTTGAGCCTGGGGG - Intergenic
1025680160 7:63675629-63675651 GGAGGACTGCTTGAGCCTGGGGG + Intergenic
1025827614 7:65023425-65023447 GGAGGACTGCTTGAGCCCTGGGG - Intergenic
1025915147 7:65859881-65859903 GGAGGACTGCTTGAGCCCTGGGG - Intergenic
1025988939 7:66480103-66480125 GGAGAATTGCTTAAGCCTGGTGG + Intergenic
1026333406 7:69372978-69373000 GGAGGACTGCTTGAGCCCAGAGG + Intergenic
1026391842 7:69910716-69910738 GGAGGATCGCTTAAACCAGGAGG - Intronic
1026392899 7:69920375-69920397 GGAGGATTGCTTGAGCCAGGAGG - Intronic
1026908075 7:74074694-74074716 GGAGGATCACTTAAGCCAGGAGG + Intergenic
1026939914 7:74281701-74281723 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1026985162 7:74550495-74550517 GGAGGATCGCTTGAGCCAGGAGG + Intronic
1027211900 7:76156110-76156132 GGAGAATTGCTTAAGCCTGGTGG + Intergenic
1027526571 7:79276872-79276894 GGAGGATTGCTTGAGCCAAGAGG + Intronic
1028891265 7:95990937-95990959 GGAGGATTGCTTGAGCCTGGAGG + Intronic
1030004615 7:105104941-105104963 GGAGGACTGCTTGAGCCCAGGGG + Intronic
1030212792 7:107012928-107012950 GGAGGATTGCTGAGGTTAGGAGG - Intergenic
1030816049 7:114038841-114038863 GGAGGACTGCTTGGGCCCAGGGG + Intronic
1031605663 7:123764198-123764220 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1032199932 7:129813245-129813267 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1032305985 7:130733239-130733261 GGAGAACTGCTTGGGGCAGAGGG + Exonic
1032584560 7:133134415-133134437 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1032786567 7:135205427-135205449 AGAGGACTTCTGAGGCCATGGGG + Intronic
1033358953 7:140624233-140624255 GGAGAGCTGCTGAGGCCAGGAGG - Intronic
1033634575 7:143199801-143199823 GGAGAATTGCTTGAGCCAGGAGG - Intergenic
1033670054 7:143483465-143483487 GGAGGATTGCTTGAGCCTGGGGG - Intergenic
1034218997 7:149430126-149430148 GGAGGACAGCTTCCCCCAGGAGG - Intergenic
1034279398 7:149842084-149842106 GGATAAATGCTTGGGCCAGGTGG + Intronic
1034635015 7:152560262-152560284 GGAGGACTGCTGAAGCCCAGAGG + Intergenic
1034904172 7:154929347-154929369 GGAGGAGTGCTTGAGCCAGGTGG + Intronic
1035001237 7:155613714-155613736 GGAGGATCGCTTAAGCCAGGAGG + Intronic
1035535344 8:386674-386696 GGAGGACTGCTTGAGCCCAGAGG - Intergenic
1035582135 8:747066-747088 CCAGGACAGCTCAGGCCAGGAGG - Intergenic
1036195830 8:6713642-6713664 GGAGGACCGCTTGAGCCCGGGGG - Intronic
1036395449 8:8366766-8366788 GGAGGATTGCTTGAGCCAGGAGG - Intronic
1036552046 8:9824477-9824499 GGAGGATCGCTTGAGCCAGGAGG + Intergenic
1037420872 8:18701054-18701076 AGAGGATTGCTTAAGCCAGGAGG - Intronic
1037496676 8:19447297-19447319 GGGGGACTGGTATGGCCAGGTGG + Intronic
1037836072 8:22215473-22215495 GGAGGACTGCTTGAGCTGGGAGG + Intergenic
1037940125 8:22944994-22945016 GGAGGATTGCTTGAGCCTGGAGG - Intronic
1038112871 8:24518722-24518744 GGAGGATTGCTTGAGCCTGGGGG + Intronic
1038128822 8:24705670-24705692 GGAGGGCTGCTTCAGCCAGAAGG + Intergenic
1038185786 8:25273510-25273532 GGAGAACTGCTTGAGCCCGGAGG + Intronic
1038318999 8:26511681-26511703 GGAGGACTGCTTGAGCCGAGTGG + Intronic
1038574831 8:28696005-28696027 GGAGGATCGCTTGAGCCAGGAGG - Intronic
1039547059 8:38417945-38417967 AGAGGGCTGCTTTGGGCAGGTGG - Exonic
1039566938 8:38558561-38558583 GGAGGACTGCTTGAGCCCAGCGG + Intergenic
1039668133 8:39559809-39559831 GGAGGACTGCTTGAGCCCTGGGG + Intergenic
1041669917 8:60481619-60481641 AGAGGATCGCTTAGCCCAGGAGG - Intergenic
1041737423 8:61126228-61126250 GGAGGACAGGTCAGGCCATGAGG - Intronic
1041801672 8:61807254-61807276 GGAAGACTGCTTGAGCCCGGGGG - Intergenic
1043474474 8:80592910-80592932 GGAGGATTGCTTAAGGCAGGAGG - Intergenic
1044071892 8:87771556-87771578 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1044307246 8:90652008-90652030 GGAGGATAACTTAAGCCAGGAGG - Intronic
1044720617 8:95142343-95142365 GGAGGACAGCTTGAGCCTGGGGG - Intronic
1044801345 8:95960125-95960147 GGAGGATTGCTAAGCCCAGGAGG + Intergenic
1044974211 8:97647470-97647492 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1045178662 8:99755677-99755699 GGAGAATTGCTTGAGCCAGGAGG + Intronic
1045200516 8:99975771-99975793 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1045513246 8:102831863-102831885 GGAGGACTGCTTAAGCCGGGAGG + Intronic
1045756775 8:105552898-105552920 GGAGGATTGCTTGAGCCCGGGGG - Intronic
1047192290 8:122689069-122689091 GGAGGACCGCTTGAGCCAGGAGG + Intergenic
1047867725 8:129045831-129045853 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1048338194 8:133518638-133518660 GGAGGACTCCCTAGGCTTGGAGG + Intronic
1048819260 8:138364935-138364957 GGAGAACTGCTTGAACCAGGAGG - Intronic
1049124246 8:140772336-140772358 GGAGGACTGCTGGAGCCAGGAGG + Intronic
1049168474 8:141141815-141141837 GGAGGACTGCTTGAGCCGAGGGG + Intronic
1049362686 8:142219777-142219799 GAAGGACGGCTGAGGCCTGGAGG - Intronic
1049427820 8:142545116-142545138 GGAGGACTGTGGAGGCCAGGTGG + Intergenic
1049610430 8:143552653-143552675 AGAGCCCTGCTAAGGCCAGGGGG - Intergenic
1049691647 8:143963731-143963753 GGAGGATTGCTTAACCCTGGAGG - Intronic
1049810300 8:144565186-144565208 AGAGGACTGTCTGGGCCAGGAGG + Intronic
1050416559 9:5423791-5423813 GGAGGATTGCTTGAGCCTGGGGG - Intronic
1050466891 9:5936263-5936285 GGAGGACTGCTTGAGCCTGGAGG + Intronic
1050548552 9:6729448-6729470 GGAGGACTGCTTGAGCCCAGGGG + Intronic
1050813312 9:9777605-9777627 GGAGAATTGCTTGAGCCAGGAGG + Intronic
1051200038 9:14607312-14607334 GGAGGATGGCTTGAGCCAGGAGG + Intergenic
1051390278 9:16556197-16556219 GGAGGACTGCTTGGGCCCTGGGG + Intronic
1052291938 9:26852147-26852169 GGAGGATTGCTTCAGCCAGGAGG - Intronic
1053127103 9:35591024-35591046 GGCTGACTTCTTAGGCCAGAAGG - Intergenic
1053554136 9:39117080-39117102 GGAGAATTGCTTAACCCAGGAGG - Intronic
1055907227 9:81308763-81308785 AGAGGACTGCTTGAGCAAGGAGG - Intergenic
1055968547 9:81888805-81888827 GGAGAATTGCTTAACCCAGGAGG + Intergenic
1056113857 9:83422919-83422941 GGAGGATTGCTTAGGCCACCAGG + Intronic
1056172328 9:83997884-83997906 GGAGGACTGCTTGAGCCCAGAGG - Intronic
1056389177 9:86124715-86124737 GGAGGATTGCTTGAGCCCGGGGG + Intergenic
1056530755 9:87485471-87485493 GGAGGGTTGCTGAGCCCAGGAGG - Intergenic
1057475527 9:95397888-95397910 GGAGAATTGCTTGAGCCAGGAGG + Intergenic
1058464222 9:105212100-105212122 GGAGGATAGCTTAAGCCAGAAGG + Intergenic
1058986436 9:110212402-110212424 TGAGGACAGCATAGGCTAGGTGG - Intergenic
1059008759 9:110433560-110433582 GGAGGATCGCTGAGCCCAGGAGG - Intronic
1059179139 9:112195519-112195541 GGAGGATTGCTTGAGCCTGGAGG + Intergenic
1059183651 9:112244586-112244608 GGAGGACTGCCTGAGCCTGGAGG + Intronic
1059189190 9:112307361-112307383 GGAGGATTGATTGAGCCAGGAGG + Intronic
1059280226 9:113126546-113126568 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
1060369334 9:123055280-123055302 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1060490420 9:124080157-124080179 GGAGGATTGCTTGAGCCCGGAGG - Intergenic
1060492683 9:124096588-124096610 GGAGGACTGCTTGAGCCCGGAGG - Intergenic
1060739740 9:126090498-126090520 GGAGGATTGCTTGAGCCTGGGGG + Intergenic
1061008938 9:127943965-127943987 GGCGGGCTGCTGAGGGCAGGTGG - Intronic
1061112796 9:128587173-128587195 GGAAGACTGCTGAGCACAGGAGG - Intronic
1061172480 9:128967868-128967890 GGAGGATTGCTTGAGCCCGGTGG + Intronic
1061315044 9:129790152-129790174 GGAGGATTGCTTCAGCCTGGAGG - Intergenic
1061619166 9:131799950-131799972 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
1061633730 9:131891660-131891682 GGAGGGCTGCTTTGGGCAAGGGG + Intronic
1062172810 9:135144830-135144852 GGAGGGTTGCTAAGGCCTGGAGG + Intergenic
1062647218 9:137554526-137554548 GGAGGATTGTTGAGCCCAGGAGG - Intergenic
1062672188 9:137717517-137717539 GGAGGATTGCTTGAGCCTGGTGG + Intronic
1062738337 9:138150966-138150988 GGAGCACTGACCAGGCCAGGTGG - Intergenic
1185503860 X:618274-618296 GGATGACAGCTGAGGCCAGCAGG + Intergenic
1185932151 X:4215242-4215264 GGAGGATTGCTTGAGCCAAGGGG - Intergenic
1186021418 X:5260599-5260621 GGAGGATTGCTTGAGCCATGAGG + Intergenic
1186163097 X:6798874-6798896 GGAGGACTGCTTGAGCCCAGGGG - Intergenic
1186184195 X:7003964-7003986 AGAGGACTGCTTGAGCCTGGAGG - Intergenic
1187073729 X:15913917-15913939 GGAGGATTGCTTAAGCCCGGGGG - Intergenic
1187117594 X:16368885-16368907 GGAGGAATTCTGAGGCCAGCAGG - Intergenic
1187386682 X:18855391-18855413 GGAGGACTGCTTGAGCCTAGGGG - Intergenic
1187866229 X:23725725-23725747 GGAGGACTGCTTGAGCCAGGAGG + Intronic
1187914347 X:24139492-24139514 GGAGGATTGCTTGAGCCTGGAGG + Intergenic
1187952757 X:24486719-24486741 GGAGGATCGCTTGAGCCAGGAGG - Intronic
1188010592 X:25051806-25051828 GGAGGATTGCTTGGGCCCAGAGG - Intergenic
1188942483 X:36257512-36257534 GGAGGATCGCTGAGTCCAGGAGG - Intronic
1189602264 X:42640009-42640031 GGAGGATTGCTTGAGCCAGGAGG - Intergenic
1189835364 X:45015338-45015360 GGAGGACTGCTTGAGCCCAGGGG - Intronic
1190073002 X:47294142-47294164 GGAAGACTGCTTAAGCCCAGGGG - Intergenic
1190121228 X:47660952-47660974 GGAGGATTGCTTGAGCCCGGTGG - Intergenic
1192374062 X:70541097-70541119 GGAGGATCGCTTAAGCCTGGGGG + Intronic
1192483494 X:71505038-71505060 GGAGGACTGCTTGATCCTGGGGG + Intronic
1192820942 X:74644717-74644739 GGAGGACTGCTTATGCTGAGAGG - Intergenic
1193116527 X:77780848-77780870 GGAGGATTGCTTGAGCCAGGAGG + Intronic
1194616884 X:96115242-96115264 GGAGGGTTGCTTAAGCCTGGAGG + Intergenic
1195137159 X:101920127-101920149 GGAGAATCGCTTAGCCCAGGAGG - Intronic
1196209610 X:112981158-112981180 GGAGGACTGCTTGAGCCCAGGGG + Intergenic
1197704235 X:129622527-129622549 GGAGGATTGCTTGAACCAGGAGG + Intergenic
1197945378 X:131833091-131833113 GGAGGATTGCTTGAGCCTGGAGG - Intergenic
1198193321 X:134333173-134333195 GGAGGATTGCTTGAGTCAGGAGG - Intergenic
1198403871 X:136293298-136293320 GGAGGATTGCTTGACCCAGGAGG - Intergenic
1199438671 X:147843593-147843615 GGAGGACCGCTTGAGCCTGGGGG - Intergenic
1200060460 X:153481554-153481576 CGATGACTGCCTGGGCCAGGAGG - Intronic
1200295947 X:154920541-154920563 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1201237732 Y:11927712-11927734 GAAGGATTACCTAGGCCAGGAGG + Intergenic
1201653003 Y:16312089-16312111 GGAGGACTGCTTGAGCCATGAGG + Intergenic