ID: 1168553271

View in Genome Browser
Species Human (GRCh38)
Location 19:57317592-57317614
Sequence CAAGCCGCTCGGTCTCCGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168553264_1168553271 -8 Left 1168553264 19:57317577-57317599 CCGCCGCCTAGTCCTCAAGCCGC No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553257_1168553271 11 Left 1168553257 19:57317558-57317580 CCCATCCTCCTCCCCGCGGCCGC No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553261_1168553271 0 Left 1168553261 19:57317569-57317591 CCCCGCGGCCGCCGCCTAGTCCT No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553263_1168553271 -2 Left 1168553263 19:57317571-57317593 CCGCGGCCGCCGCCTAGTCCTCA No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553260_1168553271 3 Left 1168553260 19:57317566-57317588 CCTCCCCGCGGCCGCCGCCTAGT No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553258_1168553271 10 Left 1168553258 19:57317559-57317581 CCATCCTCCTCCCCGCGGCCGCC No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553255_1168553271 13 Left 1168553255 19:57317556-57317578 CCCCCATCCTCCTCCCCGCGGCC No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553253_1168553271 28 Left 1168553253 19:57317541-57317563 CCACTAACTGGTTAGCCCCCATC No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553259_1168553271 6 Left 1168553259 19:57317563-57317585 CCTCCTCCCCGCGGCCGCCGCCT No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553256_1168553271 12 Left 1168553256 19:57317557-57317579 CCCCATCCTCCTCCCCGCGGCCG No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data
1168553262_1168553271 -1 Left 1168553262 19:57317570-57317592 CCCGCGGCCGCCGCCTAGTCCTC No data
Right 1168553271 19:57317592-57317614 CAAGCCGCTCGGTCTCCGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168553271 Original CRISPR CAAGCCGCTCGGTCTCCGCG GGG Intergenic
No off target data available for this crispr