ID: 1168553722

View in Genome Browser
Species Human (GRCh38)
Location 19:57320850-57320872
Sequence CAGGATGGCAGCCTCGGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 144}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168553718_1168553722 -3 Left 1168553718 19:57320830-57320852 CCGCTAGGGCTGCAGGGTCTCAG 0: 1
1: 0
2: 2
3: 20
4: 244
Right 1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 144
1168553709_1168553722 15 Left 1168553709 19:57320812-57320834 CCGCGGCATTCCCGGGCCCCGCT 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 144
1168553712_1168553722 5 Left 1168553712 19:57320822-57320844 CCCGGGCCCCGCTAGGGCTGCAG 0: 1
1: 0
2: 1
3: 29
4: 293
Right 1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 144
1168553716_1168553722 -1 Left 1168553716 19:57320828-57320850 CCCCGCTAGGGCTGCAGGGTCTC 0: 1
1: 0
2: 2
3: 17
4: 127
Right 1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 144
1168553717_1168553722 -2 Left 1168553717 19:57320829-57320851 CCCGCTAGGGCTGCAGGGTCTCA 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 144
1168553713_1168553722 4 Left 1168553713 19:57320823-57320845 CCGGGCCCCGCTAGGGCTGCAGG 0: 1
1: 0
2: 1
3: 33
4: 256
Right 1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG 0: 1
1: 0
2: 0
3: 25
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168553722 Original CRISPR CAGGATGGCAGCCTCGGCGC AGG Exonic
900109092 1:998136-998158 CGGGATGGCGACCGCGGCGCTGG + Intergenic
900160776 1:1222426-1222448 CAGCAGGGCAGCCTCAGCCCTGG - Intronic
900341219 1:2190290-2190312 CAGGTTGGCAGCCTGCACGCCGG - Intronic
900490355 1:2945920-2945942 CAGGATGGCTGCCTGTGTGCAGG + Intergenic
900666723 1:3820534-3820556 CAGGATGGCGGCCTCTGTCCAGG + Intronic
901402560 1:9024878-9024900 CAAGATGGCAGCCTCCACGGAGG + Intronic
903262893 1:22140952-22140974 CAGGAAGGCAGCCTCGGCTTTGG - Intronic
904466092 1:30708272-30708294 CAGGATGGCACCATTGGCCCAGG - Intergenic
904886669 1:33743398-33743420 CAGGACGGGCGCCTCGGCGGTGG + Exonic
905912804 1:41665199-41665221 CAGGCTGGTAGCCTCGAAGCAGG - Intronic
906525583 1:46491357-46491379 CTGGAGCGCAGCCTCAGCGCTGG + Intergenic
907496961 1:54851648-54851670 CAGGAGGGCAGCCACGGAGTGGG - Exonic
911652324 1:100403820-100403842 CAGTAAGGCAGGCTCAGCGCTGG - Intronic
912469451 1:109896373-109896395 CAGGATGCGAGCCTCAGCCCTGG - Intergenic
914899688 1:151705122-151705144 CTGGATGGCAGCCTGGGCACTGG + Exonic
915089820 1:153416602-153416624 CAGCATGGCAGGCTGGGCACTGG - Intronic
918910628 1:190563391-190563413 CAGGCTGGCTGCCTCAGCACTGG - Intergenic
919834469 1:201564175-201564197 CAGGCAGGCATCCTCGGCCCTGG + Intergenic
922811180 1:228416500-228416522 CAGGAGGGTAGCCTAGGCGGCGG + Intronic
923017131 1:230135622-230135644 CAGTCTGGCAGGCTCGGCTCTGG + Intronic
1065573905 10:27099920-27099942 CAGAAAGGCGGCCTGGGCGCTGG + Intronic
1067064989 10:43099122-43099144 CAGGATGCTAGCCTCGGCTGTGG - Intronic
1067538570 10:47135401-47135423 CAGGATGGCAGCCTGAGTGCAGG - Intergenic
1069193434 10:65519404-65519426 CAGGATGGCAGGCTCTTCTCTGG + Intergenic
1069905952 10:71732218-71732240 CAGGATGGCAGCCTCGTATGAGG - Intronic
1070112055 10:73495871-73495893 CAGCATGGCCGCCCCGGAGCCGG - Exonic
1072048877 10:91683818-91683840 AAGCATGGCAGCATCGGCGCGGG + Intergenic
1074505156 10:114063298-114063320 CAGCCTGGCAGCCTCTGCTCCGG - Intergenic
1075776321 10:124991259-124991281 CAGGATGGCAGGCCAGGAGCTGG - Intronic
1076389490 10:130087864-130087886 CATGCTGGCAGCCTCCGCTCTGG + Intergenic
1076595292 10:131621161-131621183 CAGCATGGCATCCTCTGAGCTGG + Intergenic
1076738089 10:132467645-132467667 TGGGAGGGCAGCCTCGGCCCGGG - Intergenic
1077330041 11:1980176-1980198 GAGGATGGCAGGCTCAGCACAGG - Intronic
1077404451 11:2376993-2377015 CAGGAGTGCAGCCCCGGTGCCGG - Intronic
1079725085 11:23870540-23870562 CAGGATGGCTGACTTGGAGCAGG - Intergenic
1081481902 11:43497293-43497315 CAGGATGGCACCCACAGGGCAGG - Intergenic
1083272417 11:61579132-61579154 CAGGCTGGCAGCCTCCCCTCTGG - Intronic
1085759930 11:79233111-79233133 CAGTCTGGCAGCCTCAGCGGAGG - Intronic
1087005560 11:93467283-93467305 CTGGTTGGCTGCCTCGGCACTGG - Intergenic
1087008232 11:93489546-93489568 CAGGATGGCACCAACCGCGCAGG + Intronic
1090073496 11:123564025-123564047 CAGGATGGCTGCCTGACCGCTGG - Intronic
1090262400 11:125331010-125331032 CAGGATGGCAGGGTCGGGGGAGG - Intronic
1090403821 11:126465675-126465697 CAGGGTGCCAGCCACGGCCCTGG + Intronic
1202813018 11_KI270721v1_random:35355-35377 GAGGATGGCAGGCTCAGCACAGG - Intergenic
1092820559 12:12350095-12350117 CTGGATGGCAGCAGGGGCGCCGG - Exonic
1103505058 12:121437105-121437127 CAGGATGGCAGCAGTGGGGCGGG + Intronic
1104024072 12:125013634-125013656 CAGGAAGGCAGCCTGGGAGCAGG + Intronic
1104889420 12:132133116-132133138 CAGGGTGGCAGCCACGTCTCTGG - Intergenic
1113546277 13:111153651-111153673 CAGGAAGTGAGCCCCGGCGCCGG - Intronic
1113789742 13:113022043-113022065 CAGCAGGGCAGCCTTGGGGCAGG - Intronic
1117828465 14:59727187-59727209 CCGGATGGCATCCAGGGCGCTGG + Exonic
1118358396 14:65035224-65035246 CAGGATGGCAGCCATAGCCCAGG - Intronic
1118761055 14:68880306-68880328 CAGGGTGGCAGCCTCTGCCTGGG + Intronic
1121025927 14:90616196-90616218 CAGGCAGGTTGCCTCGGCGCCGG - Intronic
1121493711 14:94377972-94377994 CAGGAGGGCAGCCTTGGGGTGGG + Exonic
1122235804 14:100330095-100330117 CAGGCTGGGGGCCTCGGGGCGGG + Exonic
1122843609 14:104478670-104478692 CAGGATAGCAGCCGTGGAGCCGG + Intronic
1122986070 14:105212180-105212202 CAGCATGGCGGCCTCAGCCCAGG + Intronic
1125756717 15:42069958-42069980 CAGGATCGGGGCCTCGGGGCAGG + Exonic
1127103083 15:55587682-55587704 TCGGATCGCAGCCTCGGCCCCGG + Intronic
1128608832 15:69058118-69058140 CATGATGGCAGCCTTGGGGAAGG - Intronic
1129674207 15:77623567-77623589 CAGGAGCTCAGCCTGGGCGCAGG - Intronic
1130040890 15:80404512-80404534 CAAGATGGCAACCCCGGCGGCGG + Exonic
1132155372 15:99492259-99492281 CTGGAAGGCAGCCTCCGTGCTGG + Intergenic
1135078002 16:19410800-19410822 TAGGCTGGCAGCCCGGGCGCTGG - Exonic
1136371218 16:29837338-29837360 CAGGTTGGCAGCCTAGGGGCAGG - Intronic
1136580507 16:31148570-31148592 CACGATGGCGGCCACTGCGCGGG + Exonic
1137248112 16:46721910-46721932 CAGGATTGAGGCCTCGGCACTGG - Intronic
1142295776 16:89221124-89221146 CAGGATGGCAGCCCCTGACCTGG + Exonic
1142625909 17:1191781-1191803 CCTGACGGCAGCCTGGGCGCAGG - Intronic
1146266406 17:31455913-31455935 CAGGATGGCACTCTCAGCGGAGG - Intronic
1146891759 17:36510888-36510910 CAGGACGGCAGCCTCGCTGCTGG - Exonic
1147944795 17:44074837-44074859 CAGCATGGCAGCCTGGGAGCTGG + Intronic
1148240935 17:45998953-45998975 CTGGATGGCAGTCTGGGTGCTGG - Intronic
1148322886 17:46768266-46768288 GAGGCTGGGAGCCTGGGCGCAGG - Intronic
1148578634 17:48728276-48728298 CAGGGTGGCTGCCTGGGCACAGG + Exonic
1152386130 17:79975871-79975893 CAGGATGGCAGCAGCAGCTCCGG + Intronic
1152446798 17:80349530-80349552 GAGGAAGGCACCCTCGGGGCAGG + Intronic
1156099716 18:33578663-33578685 CAGGCGGGCAGCCTCGGCCCAGG - Exonic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160406837 18:78652215-78652237 CAGGAGGGCAGCTCCGGGGCTGG + Intergenic
1160619465 18:80160576-80160598 GAGCGTGGCAGCCTCGGCGCGGG - Exonic
1160723185 19:605904-605926 CAGGACTGCAGCCCCGGCACTGG + Intronic
1161004185 19:1926168-1926190 CAGGATGGCAGGGTCAGCCCTGG - Intergenic
1161175817 19:2841691-2841713 CAGGACGGGAGCCTGGGCCCCGG + Intronic
1161253371 19:3293343-3293365 CTGGATGGCTGCCTGGGCGCTGG - Exonic
1161646421 19:5456024-5456046 CACGATGGCCGCCTCGAAGCCGG - Exonic
1162564070 19:11435510-11435532 CAAGATGGCCGTCTCGGCTCTGG + Intronic
1162740764 19:12772373-12772395 CAGGAGGGCAGCCTCTGGGCTGG - Intronic
1163419397 19:17205761-17205783 CAGCATGGCAGCCACTGGGCAGG - Intronic
1163450914 19:17376992-17377014 CATGATGGCATCCTTGGCGCGGG + Exonic
1165952223 19:39480850-39480872 CAAGATGGCGGCCTCGGCAGCGG + Exonic
1166702743 19:44891533-44891555 CTGGGAGGCAGCCTGGGCGCCGG + Exonic
1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG + Exonic
925336764 2:3104429-3104451 CAGGGTGACAGCCACGGAGCGGG + Intergenic
925612002 2:5709381-5709403 CAGGAAGGCAGCCCCGGCTGGGG + Intergenic
928024822 2:27730726-27730748 CAGGAAGGCATCCTCAGGGCTGG - Intergenic
930029597 2:47049959-47049981 AAGGATGGCAGCTTCGGTGAGGG + Exonic
934556440 2:95289298-95289320 CTGGATGCCAGCCTGGGCTCTGG - Exonic
942454661 2:176129783-176129805 CGGGTCGGCAGCCTCGGCGGCGG + Exonic
1169211352 20:3767757-3767779 CGGGAGGGCGGCCGCGGCGCGGG - Intronic
1173807356 20:45934704-45934726 CAAGATGGCGGCAGCGGCGCTGG + Exonic
1178714699 21:34953457-34953479 CAGGATGGCTGCCTGAGCTCTGG - Intronic
1179614296 21:42571848-42571870 CAGGATGGCGACCACGGTGCAGG - Intronic
1179875822 21:44266873-44266895 CAGGATGGCAGCCTCCACTGTGG + Intergenic
1181163539 22:20971536-20971558 AAGGATGGCAGCCCCAGCCCAGG + Intronic
1181756012 22:25025599-25025621 CAGGATGACAGCCTCAGTTCCGG - Intronic
1181762456 22:25067621-25067643 GAGGATGGCAGGCCAGGCGCAGG - Intronic
1182278617 22:29205808-29205830 CGGGTTGGCAGCGGCGGCGCAGG + Intergenic
1182771815 22:32801810-32801832 CAGCGAGGCTGCCTCGGCGCTGG - Exonic
1183394785 22:37565496-37565518 AATGATGGCAGCCTCTGAGCAGG - Intronic
1184155648 22:42665040-42665062 CAGGGAGGCAGCCTGGGCACAGG - Intergenic
1184164611 22:42720287-42720309 CGGGCTGGCAGCGTCGGCGCCGG - Intronic
1184442163 22:44523529-44523551 CAGGCTGGTAGCCTCAGGGCAGG - Intergenic
1184458872 22:44626067-44626089 CAGGCTGGCCGCCTCCCCGCTGG + Intergenic
1185065062 22:48628009-48628031 CAGGATCGCATCCTCCGCTCCGG - Intronic
950665103 3:14490510-14490532 CAGGAGGGCAGCCTCAGGTCTGG - Exonic
951908012 3:27722410-27722432 CAGGTGGGTAGCCCCGGCGCGGG - Intronic
952706035 3:36379320-36379342 CAAGATGGCAGCATCAGCGCGGG + Intergenic
953413324 3:42702129-42702151 CAGGCTGGCAGCCTCTGCTGTGG - Intronic
954612869 3:51955487-51955509 GAGGATGGCAGCCTGGGCGTCGG + Exonic
968066405 3:195761901-195761923 CAGGAAGGGAGCCTCGGGGGAGG + Intronic
968574020 4:1356670-1356692 CAGGATGGCAGCCGCAGGACCGG + Intronic
968649595 4:1755216-1755238 CACGAAGGCAGCCTGGGCGGGGG + Intergenic
969377922 4:6775416-6775438 CAGGATGTCAGCCTCAGAGCAGG - Intergenic
976778094 4:88728441-88728463 CTGGAAGGCAGCCTTGGGGCTGG - Exonic
978154573 4:105474149-105474171 CAGGATCGCAGCCCGAGCGCCGG - Intergenic
979642326 4:123023742-123023764 CAAGATGGCAGCCTCCGAGCCGG + Intronic
984983947 4:185309228-185309250 AAGCATGGAAGCCTCGGGGCAGG + Intronic
985716649 5:1466853-1466875 GAGGACGGCAGCGTCGGCGAAGG - Exonic
986008022 5:3684317-3684339 CTGGAGGGCAGCCTGGGAGCCGG - Intergenic
986783216 5:11085948-11085970 CAGAATGGCAGCCACAGGGCAGG + Intronic
988993522 5:36693306-36693328 CAGGGTGGCAGCAGCGGCCCAGG - Intergenic
990389834 5:55307652-55307674 CAGGGTGGCAGCCCCGGAGCCGG - Exonic
995512332 5:112921843-112921865 CTGGAGGGCAGCTGCGGCGCCGG - Intronic
997199189 5:131999547-131999569 CAGGAGGGCAGACTCGGGGCAGG - Intronic
998405851 5:141874390-141874412 CAGGAAGGCAGCCAGGGCCCGGG - Intronic
1002025380 5:176393076-176393098 GAGGAGGGCAGCCTTGGCGCAGG + Intronic
1002056322 5:176599722-176599744 CAGGATGGGAGCCTGGGGGCTGG - Exonic
1002846180 6:947391-947413 CAGGATGGAAGCCAGGGCCCAGG + Intergenic
1006775636 6:36590363-36590385 CAGGCTGGCTGCCCCGGCTCAGG + Intergenic
1007406089 6:41637213-41637235 CGGGATGGCCCCCACGGCGCCGG - Intronic
1007506429 6:42338692-42338714 CAGGATGGCAGGCTGGGTGCAGG - Intronic
1017800580 6:157892151-157892173 CAGGATGGAAACCTCAGCCCAGG + Intronic
1021678561 7:23106023-23106045 GAGGATGGCAGCCTCTGGGGTGG + Exonic
1022959701 7:35414783-35414805 CACCATGGCAACCTCGGTGCTGG + Intergenic
1023350654 7:39317266-39317288 CATGTTGGCAGCCTCTGTGCAGG - Intronic
1023868109 7:44248462-44248484 CAGCAGGGCAGCCTCGGAGGTGG - Intronic
1026787922 7:73313397-73313419 CAGGCTGGCTGGCTCGCCGCTGG + Exonic
1029160689 7:98549385-98549407 CAGGAAGGAAGCCTCAGGGCAGG - Intergenic
1033657003 7:143381360-143381382 TCGGGTGGCCGCCTCGGCGCCGG - Exonic
1034916343 7:155042953-155042975 CAGCATGGCAGCCCCTGCACTGG - Intergenic
1035599956 8:891525-891547 CAGGATGGGAGCCTCGCCTGGGG + Intergenic
1035748679 8:1979803-1979825 CAGGTTGGCAGCCTCGGGACAGG + Intronic
1036652498 8:10654309-10654331 CAGGATGCCAGCCTTGAAGCTGG + Intronic
1039476415 8:37841500-37841522 CGGGGTGGCAGCCTCCGCCCTGG + Exonic
1040072524 8:43200265-43200287 CTGGATGGCAGCCGCTGCCCAGG + Exonic
1049356662 8:142192558-142192580 CATGAAGGCAGCCTCAGCACTGG + Intergenic
1052816787 9:33107809-33107831 TAGGATGGCAGCCTTGGGGAGGG - Intronic
1057845438 9:98518932-98518954 CAGGCTGCCAGCCTGGGAGCAGG + Intronic
1058201647 9:102049731-102049753 CAGGATGGCAACATTGGAGCAGG - Intergenic
1062506834 9:136881875-136881897 CAGGAAGGCAGCCGCAGCTCCGG - Intronic
1062529496 9:136993686-136993708 CAGGATTGGACCCTGGGCGCAGG - Intronic
1185856690 X:3542725-3542747 CAGGCTGGCAGCCTGAGGGCTGG + Intergenic
1190843518 X:54169081-54169103 CAGGCTGGAATCCTCGGCTCAGG - Intronic
1190892865 X:54586455-54586477 CAGGATTGCTGCCTCAGCCCTGG - Intergenic
1192864690 X:75118214-75118236 CACAATGGCAGCCTGGGTGCAGG + Intronic
1196388979 X:115190016-115190038 CAGGCTTGCAGCCACGGCGCTGG + Exonic
1199974644 X:152886055-152886077 CAGTATGCCAGGCTCGGGGCGGG - Intergenic
1200753319 Y:6967079-6967101 CAGGGTGGTGGCCTCTGCGCAGG + Intronic