ID: 1168561698

View in Genome Browser
Species Human (GRCh38)
Location 19:57389981-57390003
Sequence CACTCCCGCCTCTCCGTGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168561698_1168561701 -3 Left 1168561698 19:57389981-57390003 CCCACCACGGAGAGGCGGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1168561701 19:57390001-57390023 GTGAGTCAACTGACAAGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1168561698_1168561702 -2 Left 1168561698 19:57389981-57390003 CCCACCACGGAGAGGCGGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1168561702 19:57390002-57390024 TGAGTCAACTGACAAGCGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 67
1168561698_1168561704 6 Left 1168561698 19:57389981-57390003 CCCACCACGGAGAGGCGGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1168561704 19:57390010-57390032 CTGACAAGCGCTGGGGACAGTGG 0: 1
1: 0
2: 0
3: 31
4: 307
1168561698_1168561703 -1 Left 1168561698 19:57389981-57390003 CCCACCACGGAGAGGCGGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1168561703 19:57390003-57390025 GAGTCAACTGACAAGCGCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168561698 Original CRISPR CACTCCCGCCTCTCCGTGGT GGG (reversed) Exonic
900497805 1:2984185-2984207 CATTCCCGGGGCTCCGTGGTGGG + Intergenic
901774259 1:11548772-11548794 CACTCCTGGCTCTCCTTGGCTGG + Intergenic
902872028 1:19319825-19319847 CACTGCAGCCTCTGCCTGGTGGG - Intronic
904470590 1:30733714-30733736 CCCTCCCGCCCCTCCCTGGCAGG - Exonic
911348329 1:96722364-96722386 CTCGCCCGGCCCTCCGTGGTCGG + Intronic
914675542 1:149904895-149904917 CACTCCCCACTCCCCGTGTTTGG - Exonic
914752998 1:150548805-150548827 CACTCCTGCCTCTCCCGTGTTGG - Intergenic
915601207 1:156924265-156924287 CACTCGCGCCTCTGCTGGGTTGG - Intronic
919616158 1:199811355-199811377 CAATCCCTCCTCTCCATGGCTGG + Intergenic
923035248 1:230280932-230280954 CACCCCTGCCACTCTGTGGTCGG + Exonic
923148073 1:231211490-231211512 CACTACCGCCACCCGGTGGTCGG + Intronic
923939776 1:238809163-238809185 CACTCCTGTTGCTCCGTGGTGGG + Intergenic
1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG + Intronic
1064998265 10:21315186-21315208 CACCCCTGCCTCCCCGTGGGTGG + Intergenic
1067715084 10:48684764-48684786 AACTCCAGCAGCTCCGTGGTCGG + Intergenic
1070064166 10:73017347-73017369 CACTCCAGCCTGTCTCTGGTGGG - Intronic
1075688332 10:124379140-124379162 CACTCCCCCCTCACCGTTCTTGG - Intergenic
1076199617 10:128547556-128547578 CACTCCAGCCCCACCGAGGTGGG - Intergenic
1076203276 10:128574808-128574830 CCGTCCCGCCTCCCCGAGGTGGG - Intergenic
1076701982 10:132278019-132278041 CACCCCCACCTCTCCCTGGAGGG - Intronic
1076798397 10:132809712-132809734 TCCTCCCGCCTCACCGTGGCAGG + Intronic
1082839817 11:57679811-57679833 CACACATGCCTCTCCTTGGTGGG + Intronic
1083599610 11:63938834-63938856 CGCTCCCGCCTCCTCCTGGTCGG + Intergenic
1083770617 11:64864881-64864903 CACTCCCCCCTCCCCCTGGATGG + Intronic
1086981014 11:93197872-93197894 CTCTCCCGCCGCTGCGTGGCCGG + Exonic
1090351848 11:126112981-126113003 CACTCCTGCCTCTCCGAGTCTGG + Intergenic
1090817666 11:130314081-130314103 CACTCCGGCCGCTCCGGGTTAGG + Intronic
1091333835 11:134752192-134752214 CAGTCCCACCTCTCCATGGGGGG + Intergenic
1091544492 12:1492313-1492335 CACTCCTGCCTTTCAGTGCTGGG - Exonic
1096501326 12:52065508-52065530 CACTCCCTCCCCTCCCTGATGGG + Intergenic
1099316439 12:81088256-81088278 CACTCACGCCACTCCATTGTGGG - Intronic
1102003284 12:109572149-109572171 CACTCCTGCCTCTTCTTGGATGG - Intronic
1102198372 12:111040509-111040531 CCCTCCCATCTCTCTGTGGTTGG + Intronic
1102245381 12:111352671-111352693 CACTCCCACCACTCCATGATGGG - Intergenic
1104316904 12:127711318-127711340 CACTACCGCCTCCCTGTGGACGG + Intergenic
1104982266 12:132578731-132578753 CACTCTCCCCTCACCGTGTTTGG + Intronic
1106034790 13:26033787-26033809 CACTCCCACTTCTCCATGGAAGG + Intergenic
1113513202 13:110872153-110872175 CCCTCCCGCCTCTCCCTGCGGGG + Intergenic
1128636490 15:69305698-69305720 CTCTCCCTCCTCTGCTTGGTGGG - Intronic
1132712609 16:1276280-1276302 CACTCCCACCTCCCCTTGGTGGG + Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1134179611 16:12036994-12037016 CACCACCGCTTCTCTGTGGTTGG + Intronic
1134204303 16:12224418-12224440 CACTCCCTCCTCTCCAGGCTGGG - Intronic
1138606655 16:58094198-58094220 CACTCCTGCATGTCTGTGGTAGG + Intergenic
1139465378 16:67151221-67151243 CACTCCCGCGTCTCTGGAGTGGG + Intergenic
1141791896 16:86242739-86242761 CACTCTCCCCTCTTCGTCGTGGG + Intergenic
1142124757 16:88404699-88404721 CACTCACCCCTCTGGGTGGTCGG - Intergenic
1142740014 17:1926411-1926433 CACTGCCCCCTTTTCGTGGTGGG + Intergenic
1143174357 17:4947954-4947976 CACTTCCGCCTCTCCCAGGGCGG - Intronic
1143302646 17:5922329-5922351 CAATCCAGCCTCTCTGGGGTCGG - Intronic
1146621830 17:34404698-34404720 AATTCCCGGCTCCCCGTGGTTGG - Intergenic
1151352999 17:73542666-73542688 CACTACTGCCTCTCCGTGGCTGG - Intronic
1151817121 17:76476908-76476930 CACTACGGCCTCGGCGTGGTGGG - Exonic
1152633595 17:81421405-81421427 CACCCCCGCCTCCCGGTGTTTGG - Intronic
1152659292 17:81535006-81535028 CCCTCACGCCTCTCCTGGGTAGG - Intronic
1153630051 18:7061042-7061064 CACTTCAGCCTCTCCATGGCTGG - Intronic
1160972482 19:1775683-1775705 CACTCCCTCCCCTCCGGGGGGGG - Exonic
1161097192 19:2399219-2399241 CACTCCAGCCTCCTCGTGATGGG - Intronic
1166869760 19:45864238-45864260 CCCTCCCGCCTCCCCGAGGGCGG - Exonic
1167080696 19:47274711-47274733 CACCTCCGCCTGTCGGTGGTGGG + Exonic
1167585953 19:50376020-50376042 CACTCCAGCCTCTGCGTCCTGGG - Intronic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
924974800 2:162732-162754 CACTCTGGCCACTCTGTGGTTGG + Intergenic
926043654 2:9693960-9693982 CACCCCTGCCTCTCCGTGGGCGG + Intergenic
931916746 2:66964342-66964364 CATTCCCGCCTCTTAGTGATGGG + Intergenic
932441847 2:71742576-71742598 CACTCCTGACTCTCTGTGTTAGG - Intergenic
933939551 2:87233989-87234011 CACTCCCCTCTCTCCGTGGCAGG - Intergenic
934713956 2:96532472-96532494 CTCTCCCGCCTCATCTTGGTGGG + Intergenic
936353584 2:111731784-111731806 CACTCCCCTCTCTCCGTGGCAGG + Intergenic
946898338 2:224347696-224347718 CACTACTGCCTCTGAGTGGTGGG + Intergenic
1170605678 20:17873790-17873812 CACTCCCACCCCTCCCTGGAAGG + Intergenic
1172100913 20:32483610-32483632 CTCTCCCGCCTCCCCGTGCCCGG - Intronic
1173659040 20:44720275-44720297 CACTCCCTCCTCTCCCTTCTTGG + Intronic
1174474143 20:50784002-50784024 AACTCCCTCCCCTCCGGGGTGGG - Intergenic
1175998492 20:62821749-62821771 CACTCCTGCCTCTCCCTGGAGGG - Exonic
1176302723 21:5106232-5106254 GGCTCCCGCCTCTGCCTGGTGGG - Intergenic
1177762516 21:25418255-25418277 CACTCCTGCCTCTCCATGCCAGG + Intergenic
1179790909 21:43755503-43755525 CCCTCCGGGCTCTCCGTGGTGGG + Intronic
1179854301 21:44155691-44155713 GGCTCCCGCCTCTGCCTGGTGGG + Intergenic
1180934903 22:19619027-19619049 CACTCCTTCCTCCCCGTGGTGGG + Intergenic
1181236040 22:21448211-21448233 CACTTCCGCCTCACCCTGGCCGG - Exonic
1183539955 22:38424025-38424047 CACTCCATCCTCTCCCAGGTGGG - Intergenic
953060128 3:39420623-39420645 CACTCTCCCCTCTCCATGGCTGG + Intergenic
953769981 3:45772359-45772381 CACTCCTGCCACACCCTGGTGGG + Intronic
954640802 3:52096670-52096692 CACTCCTGCCTCTGCCTGGGGGG + Exonic
956664010 3:71625031-71625053 CACTCCAGCCTCCCCGTCCTGGG - Intergenic
962736516 3:138329949-138329971 CCCTCCTGCCTCTCCCTGGCTGG - Intergenic
967864053 3:194175798-194175820 CACTCCTTCCTCTCCATGCTGGG + Intergenic
981576511 4:146211675-146211697 CACCGCCTCCTCTCCGTGGTGGG + Intergenic
986402584 5:7395424-7395446 CCTTCCCGCCTCCCCGCGGTGGG - Intergenic
1000989544 5:167897958-167897980 AACTCCAGCCCCTTCGTGGTGGG + Intronic
1006376711 6:33675627-33675649 CACTCCCTGCTGTCCGTGGTGGG - Intronic
1018708408 6:166479386-166479408 CACTGCCACCTCGCCGTGGCTGG - Intronic
1022108338 7:27212790-27212812 CACTTCTGCCCCTCCGAGGTGGG + Intergenic
1023021408 7:36015062-36015084 GACTCCCTCGTCTCCGAGGTCGG + Intergenic
1024215658 7:47246162-47246184 CCATCCCTCCTCTCCTTGGTAGG - Intergenic
1029650772 7:101890016-101890038 CACTCCCGCCAGTGTGTGGTGGG + Intronic
1030316933 7:108125675-108125697 CACTCCCACCTGTCCGATGTAGG - Intronic
1033724229 7:144095828-144095850 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1033736973 7:144232101-144232123 TCCTCCCACCTCTGCGTGGTGGG - Exonic
1033746084 7:144318845-144318867 TCCTCCCACCTCTGCGTGGTGGG + Exonic
1035044716 7:155956101-155956123 CCCTCCCTGCTCTCCATGGTGGG + Intergenic
1038803716 8:30771926-30771948 AACTCCCTCTTCTGCGTGGTCGG - Intergenic
1040054322 8:43044256-43044278 CACTGCCGCCTCTCCCTCTTGGG - Intronic
1041166854 8:55100681-55100703 CACCCCCGCTTCTCTCTGGTAGG - Intergenic
1041621006 8:59969424-59969446 CAGTCACTCCTCTCCATGGTAGG + Intergenic
1049551924 8:143264011-143264033 CCCTCCTGCCTCTCTGTGATGGG + Intronic
1061121825 9:128647961-128647983 CACTCCTGCCTCTCAGAGGAAGG + Intronic
1186879409 X:13849981-13850003 CACTGCAGCCTCTCCTTTGTAGG - Intronic
1192203836 X:69083243-69083265 CTGTCCCGCCTCCCCATGGTTGG - Intergenic
1198186145 X:134255843-134255865 CACTCCTGCATCTCCTTTGTCGG + Intergenic
1199377147 X:147126669-147126691 CACTGGCGCCTGTCCGGGGTTGG - Intergenic