ID: 1168561701

View in Genome Browser
Species Human (GRCh38)
Location 19:57390001-57390023
Sequence GTGAGTCAACTGACAAGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168561698_1168561701 -3 Left 1168561698 19:57389981-57390003 CCCACCACGGAGAGGCGGGAGTG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1168561701 19:57390001-57390023 GTGAGTCAACTGACAAGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1168561700_1168561701 -7 Left 1168561700 19:57389985-57390007 CCACGGAGAGGCGGGAGTGAGTC 0: 1
1: 0
2: 4
3: 8
4: 119
Right 1168561701 19:57390001-57390023 GTGAGTCAACTGACAAGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1168561699_1168561701 -4 Left 1168561699 19:57389982-57390004 CCACCACGGAGAGGCGGGAGTGA 0: 1
1: 0
2: 3
3: 7
4: 111
Right 1168561701 19:57390001-57390023 GTGAGTCAACTGACAAGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168561701 Original CRISPR GTGAGTCAACTGACAAGCGC TGG Exonic
902955180 1:19920593-19920615 GTGAGACAAGAGACAAGGGCGGG + Intronic
907143333 1:52209251-52209273 AAGAGTCAACTGACAATGGCAGG + Intronic
915273733 1:154773852-154773874 ATGAGTGAACTCACAAGGGCTGG + Intronic
919209539 1:194462300-194462322 GTGAGACAACTGCCAAACACAGG - Intergenic
1068911366 10:62381710-62381732 GAGAGTCAAGTGAAAAGCCCTGG - Intronic
1070744430 10:78924492-78924514 CTGAGTGAACAGAGAAGCGCTGG - Intergenic
1072263188 10:93702183-93702205 ACGAATCAACTGACAAGAGCGGG + Intronic
1075633338 10:124014620-124014642 GGGAGACAACTGAAAAGCCCCGG - Intronic
1081874567 11:46399800-46399822 AAGAGTCAACTGACCAGCACAGG + Intronic
1089710211 11:120309146-120309168 GTGTGTAAACTGTCAAGCACAGG - Intronic
1093208243 12:16277384-16277406 GTGAGCCATCTGACAAACACAGG + Exonic
1096517553 12:52165512-52165534 GTGAGTTAACAGACAGGAGCAGG - Intergenic
1104086003 12:125474707-125474729 CTGATTTAACTGACAAGCGCAGG + Intronic
1106595567 13:31132628-31132650 GTGAGTCCAATGACAACCACAGG - Intergenic
1108462264 13:50678433-50678455 GGGAGGCAACTAACAATCGCAGG - Intronic
1115379847 14:32723198-32723220 GTGAGTCAACAGACAATAGAAGG - Intronic
1117290934 14:54332024-54332046 GTGAGATAACTGACAATAGCTGG - Intergenic
1122530657 14:102424091-102424113 TTGAGTGTACTGACAAGCGTAGG + Intronic
1126551956 15:49941249-49941271 GTGAATCAACTGTCAAGAGGAGG + Intronic
1135418345 16:22286807-22286829 GTGAGTGCACTGACTAGGGCTGG - Exonic
1137597469 16:49734368-49734390 GTGAGTCCCATCACAAGCGCTGG + Intronic
1138491879 16:57381872-57381894 GTGAGGCAACTGACCAGCTGGGG - Intronic
1138606593 16:58093953-58093975 TTGAGTCAACTGACCAGCTCAGG - Intergenic
1156356795 18:36349033-36349055 GTGAGTCAACTGGAAAGTTCTGG + Intronic
1157567894 18:48692137-48692159 GTGAGACAATTAACAAGCTCAGG - Intronic
1160323142 18:77915020-77915042 GTGACTCAGCTCACAAGCCCAGG - Intergenic
1166582263 19:43912208-43912230 ATGAGTCAGTTGACAAGGGCTGG + Intergenic
1167494500 19:49809600-49809622 GGGAGTCAGCAGACAAGCGTAGG + Intronic
1167606465 19:50483505-50483527 GTGAGTCGACTGTCAAGACCAGG + Exonic
1168561701 19:57390001-57390023 GTGAGTCAACTGACAAGCGCTGG + Exonic
927450472 2:23205403-23205425 GTGAGTGAACTGGCAGGCCCTGG - Intergenic
947321438 2:228923791-228923813 GTCAGTCAATAGATAAGCGCAGG - Intronic
948592313 2:239059383-239059405 TTGAGTAAACTGACAGGCTCCGG + Intronic
1178474604 21:32926530-32926552 GTAAGTCATATGACAAGAGCAGG + Intergenic
964798965 3:160532314-160532336 GAGAGTCAAATGACAAAAGCAGG + Intronic
966083839 3:176041894-176041916 CAGAGTCAATTGACAAGCGGAGG + Intergenic
972696125 4:41448423-41448445 GTGAGGAAACAGACAAGCTCAGG - Intronic
981772942 4:148330896-148330918 GTGAGTCACATGGCAAGAGCTGG - Intronic
984448699 4:179871362-179871384 GTGACTCAACGGTCAAGTGCAGG - Intergenic
985141131 4:186841141-186841163 GAGAGTGAACTGACAGGCGCGGG + Intergenic
986583176 5:9286600-9286622 GTGAGTTAACTGTCCAGCCCTGG - Intronic
1006749514 6:36367774-36367796 GTGACACAGCTGACAAGCGGTGG - Intronic
1014696293 6:124625406-124625428 GTGACTCTACTGACCAGGGCAGG + Intronic
1016137593 6:140564293-140564315 GTAAGTCAACTCACAACCACAGG - Intergenic
1017055485 6:150432087-150432109 GTGAATCAACTGGCAAGGACAGG - Intergenic
1026728582 7:72891893-72891915 GTGACTCAATTCACAAGCACAGG - Intronic
1027115193 7:75473570-75473592 GTGACTCAATTCACAAGCACAGG + Intronic
1035656545 8:1311644-1311666 GTGTGTCAACTGAGATGTGCAGG - Intergenic
1043691533 8:83159545-83159567 GCTAGTCAACTGAAAAGCACTGG + Intergenic
1048244115 8:132775311-132775333 GTGAGTCACGTGACAAGGCCAGG + Intergenic
1050821036 9:9880127-9880149 GTGAGTGAACTCACAAGATCTGG + Intronic
1057302471 9:93894792-93894814 CTGACTCAGCTGCCAAGCGCCGG - Intergenic
1058765024 9:108174196-108174218 GTGAGGGAACTGAAAAGCCCTGG - Intergenic
1059576698 9:115497066-115497088 GTGAGTTGACTGACAAGGGCCGG - Intergenic
1188188580 X:27146108-27146130 GTGAGTGAAATGAAAAGCCCTGG - Intergenic
1198320333 X:135513528-135513550 GTCAGGCAACTGACCAGCGGAGG + Intergenic